Download Brown, V, Small, K, Lakkis, L, Feng, Y, Gunter, C, Wilkinson, KD and Warren, ST: Purified recombinant Fmrp exhibits selective RNA-binding as an intrinsic property of the fragile X mental retardation protein. Journal of Biological Chemistry 273:15521-15527 (1998).

THE JOURNAL OF BIOLOGICAL CHEMISTRY
© 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 273, No. 25, Issue of June 19, pp. 15521–15527, 1998
Printed in U.S.A.
Purified Recombinant Fmrp Exhibits Selective RNA Binding as an
Intrinsic Property of the Fragile X Mental Retardation Protein*
(Received for publication, February 10, 1998, and in revised form, April 22, 1998)
Victoria Brown‡§, Kersten Small‡§¶, Lisa Lakkis‡§, Yue Feng‡§, Chris Gunter‡§,
Keith D. Wilkinson§, and Stephen T. Warren‡§i**
From the ‡Howard Hughes Medical Institute, the §Department of Biochemistry, and the iDepartments of Pediatrics and
Genetics, Emory University School of Medicine, Atlanta, Georgia 30322
Fragile X syndrome is caused by the transcriptional
silencing of the FMR1 gene due to a trinucleotide repeat
expansion. The encoded protein, Fmrp, has been found
to be a nucleocytoplasmic RNA-binding protein containing both KH domains and RGG boxes that associates
with polyribosomes as a ribonucleoprotein particle.
RNA binding has previously been demonstrated with in
vitro-translated Fmrp; however, it remained uncertain
whether the selective RNA binding observed was an
intrinsic property of Fmrp or required an associated
protein(s). Here, baculovirus-expressed and affinity-purified FLAG-tagged murine Fmrp was shown to bind
directly to both ribonucleotide homopolymers and human brain mRNA. FLAG-Fmrp exhibited selectivity for
binding poly(G) > poly(U) >> poly(C) or poly(A). Moreover, purified FLAG-Fmrp bound to only a subset of
brain mRNA, including the 3* untranslated regions of
myelin basic protein message and its own message. Recombinant isoform 4, lacking the RGG boxes but maintaining both KH domains, was also purified and was
found to only weakly interact with RNA. FLAG-purified
I304N Fmrp, harboring the mutation of severe fragile X
syndrome, demonstrated RNA binding, in contrast to
previous suggestions. These data demonstrate the intrinsic property of Fmrp to selectively bind RNA and
show FLAG-Fmrp as a suitable reagent for structural
characterization and identification of cognate RNA
ligands.
Fragile X syndrome, a common mental retardation syndrome, results from an unstable CGG repeat expansion in the
59-untranslated region of the FMR1 gene, leading to transcriptional silencing and the absence of Fmrp protein (1– 4). Characterization of in vitro-translated Fmrp has shown it to be an
RNA-associated protein with selectivity for homopolymer RNA
and some human brain transcripts (5, 6). Fmrp contains nuclear localization and export sequences (7), as well as RGG box
and KH domain motifs found in many RNA-binding proteins.
The RGG box has been found in hnRNP1 U, hnRNP A1, nucleolin, and fibrillarin and has been shown to autonomously bind
* This work was supported in part by Grants R37 HD20521 and
P01 HD35576 from the National Institutes of Health. The costs of
publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ An associate of the Howard Hughes Medical Institute.
** An investigator of the Howard Hughes Medical Institute. To whom
correspondence should be addressed: Howard Hughes Medical Institute, Emory University School of Medicine, 4035 Rollins Research Center, 1510 Clifton Rd., Atlanta, GA 30322. Tel.: 404-727-5979; Fax: 404727-5408; E-mail: [email protected].
1
The abbreviations used are: hnRNP, human nuclear ribonucleoprotein; mRNP, messenger ribonucleoprotein particle; ERBB, 20 mM
This paper is available on line at http://www.jbc.org
homopolymeric RNA (8). However, the amino acid context surrounding the RGG box may influence the specificity and avidity
of the RNA-nucleic acid interaction (8, 9). The KH domain is
highly conserved in hnRNP K, yeast MER-1 splicing regulator,
Sam68, and chicken vigillin, among other RNA-binding
proteins (10).
Fmrp expression is widespread but not ubiquitous. The majority of Fmrp is associated with polyribosomes and has been
found to form an mRNP, which can be stripped from ribosomes
by EDTA or RNase treatment (11–14). A prevailing model
suggests that Fmrp directly binds specific mRNAs in the nucleus as part of a hnRNP particle and then mediates its transport to the cytoplasm and delivery of the mRNP to the ribosome
(4, 7).
Homopolymer binding assays performed with in vitro-translated Fmrp and carboxyl-terminal truncated Fmrp proteins
suggested a role for both the KH domain and RGG box in RNA
binding (15). However, whether the observed RNA binding by
Fmrp is mediated directly by the KH domain or through a
KH-associated protein present in the translation mixture is
unknown (5, 6, 12, 15). Prior to this work, all RNA binding
studies with Fmrp were performed in cell lysates. Because
these in vitro systems contain concentrated quantities of ribosomes and other translation factors and because Fmrp has
been shown to associate with mRNP particles and polyribosomes, direct binding of the Fmrp and RNA could not be verified. Because Fmrp associates with large protein complexes, we
could not disregard the possibility that another protein in the
translation mix was actually binding the RNA and that Fmrp
was associating tightly yet peripherally with an RNA-binding
protein in the RNP complex (5, 6, 11–14). Furthermore, if the
Fmrp was truly making direct contact with the RNA, the specificity of the interaction might be modulated by other proteins
bound to Fmrp. Similar situations exist for other RNA-binding
proteins, such as the mammalian erythropoietin RNA-binding
protein ERBP (16) and the Drosophila SR splicing proteins
(17).
We report here that the RNA binding activity and specificity
of Fmrp is an intrinsic property of the protein. The purified
FLAG-Fmrp binds in a salt-resistant manner to ribonucleic
homopolymers with a high affinity for poly(G) and poly(U) but
with weak affinity for poly(C) and poly(A). Purified Fmrp also
binds specifically to the 39-untranslated region of its own message and a subset of human brain transcripts. In addition, an
isoform 4 of Fmrp, lacking RGG boxes, was shown to only
weakly bind RNA, whereas the I304N mutation of the second
KH domain was found to retain RNA binding ability. These
studies show that purified recombinant Fmrp is suitable for
HEPES, pH 7.9, 2 mM MgCl2, 10 mM ZnCl2, 0.02% Nonidet P-40, 70 mM
NH4Cl; UTR, untranslated region.
15521
15522
Characterizing Recombinant Fmrp
further biochemical and structural studies and will be a useful
reagent to identify cognate mRNAs.
EXPERIMENTAL PROCEDURES
Materials—Baculovirus transfer vector pVL1393 and Sf9 cells were
obtained from Invitrogen Corp. BaculoGold wild type baculovirus was
purchased from Pharmingen, and Grace’s medium, pluronic F-68, and
antibiotic/antimycotic were purchased from Life Technologies, Inc. M2
matrix, FLAG peptide, and anti-M2 monoclonal antibody were from
Kodak Scientific Imaging Systems. Secondary antibodies and ECL reagents were from Amersham Pharmacia Biotech. CNBr-activated
Sepharose 4B (Amersham Pharmacia Biotech) was conjugated with
polyadenylic, polyguanylic, polycytidylic, or polyuridylic acid (Sigma).
Bacterial vector pQE31 and Ni-NTA resin were obtained from Qiagen.
Anti-Fmrp primary antibody was a generous gift from Jean-Louis
Mandel.
Fmrp Constructs—The baculoviral constructs used in wild type Fmrp
production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length
fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17
cDNA (18) includes 123 bases upstream of the translational start codon,
all 17 exons and 2288 bases of 39 untranslated region, including a
terminal poly(A)17 tail. Briefly, polymerase chain reaction was performed using an upstream primer (59ACCTCCCGGAGGATGGAGGACTACAAGGACGACGATGACAAGGAGC TGGTGGTGGAAGTGC-39)
containing at its 59-terminus an EcoN1 restriction site (underlined), a
methionine and glutamate codon followed by sequence encoding the
FLAG epitope, and a downstream primer (59-ATGAAATCTTGAGGCAAGCTGCC-39). The fragment was digested with EcoN1 and BstB1.
The purified oligo was then cloned into Mc2.17 in pBS KS1 previously
restricted with EcoN1 and BstB1, deleting the endogenous sequence
between the 59 EcoN1 site and the initiating ATG of fmr1. The cloning
junctions were sequenced to verify the correct protein reading frame.
For the I304N point mutant Fmrp construct, a SacII/SnaBI fragment
carrying the FLAG epitope was removed from the wild type cDNA and
ligated into the Mc2.17 point mutant cDNA that was previously restricted with SacII and SnaBI and that carried the A to T missense at
nucleotide 1034 (19). For the wild type and I304N constructs, a 3.9-kb
EcoRI fragment containing the full, tagged cDNA without the 39-terminal 256 bases of the 39-UTR was cloned into the nonfusion baculovirus
pVL1393 vector downstream of the AcMNPV enhancer-promoter. These
constructs were co-transformed into Sf9 cells with BaculoGold AcMNPV DNA using a cationic liposome method as recommended (Invitrogen). Sf9 cells were cultured in 13 Grace’s medium with 10% FBS, 0.1%
pluronic F-68, and 1 3 antibiotic/antimycotic (Life Technologies, Inc.).
Occlusion body-negative recombinant plaques on an Sf9 cell lawn were
visually identified, isolated, and purified by screening crude cell lysates
for recombinant protein production via Western blotting using antiFLAG M2 and/or anti-Fmrp primary antibody. Viral DNA was extracted from high titer stocks and sequenced to confirm the amino acid
codon at position 304.
For isoform 4 Fmrp production, the coding region of Mc2.14 (18) was
modified by polymerase chain reaction to add SacI and SalI sites to the
ends of the coding fragment. The fragment was subsequently ligated in
frame to the SacI/SalI digested vector pQE31 (Qiagen). This construct
places the His6 tag 59 to the polylinker. The pQE expression construct
was then transformed into the M15[pREP4] E. coli host strain (Qiagen),
which carries the pPREP4 repressor plasmid. Transformants were selected on plates containing both ampicillin and kanamycin and were
screened for the insert.
Recombinant FLAG-Fmrp—In Sf9 cells, virus was amplified to high
titer by serial infections with plaque-purified, protein-producing virus
as recommended (Invitrogen). Large scale purification of recombinant
protein was performed as follows: 4 3 108 cells were infected with high
titer virus for 72 h at a multiplicity of infection 5 5 in spinning culture.
Cells were harvested and resuspended in PBS, pH 7.2–7.4, containing 1
M NaCl and protease inhibitors: 1 mg/ml pepstatin, 2 mg/ml leupeptin
and aprotinin, 10 mM N-ethylameleimide, 2 mM iodoacetamide and
diisopropyl fluorophosphate, and 100 mg/ml phenylmethylsulfonyl fluoride. Cells were disrupted by nitrogen cavitation for 10 min at 450 psi
and subjected to centrifugation at 14,500 3 g for 20 min, followed by
shearing the supernatant through an 18-gauge needle before centrifugation at 60,000 3 g for 1 h. Soluble protein was loaded onto an
anti-FLAG M2 affinity column, washed with 1 3 PBS, 1 M NaCl,
protease inhibitors, and eluted with 150 mg/ml FLAG peptide. Fractions
were analyzed via Coomassie Blue-stained SDS-PAGE gel, Western
blotting, and Bradford protein concentration assay (Bio-Rad). Fractions
containing FLAG-Fmrp were dialyzed against 13 PBS, 0.75 M NaCl,
10% glycerol for 2 h; against 13 PBS, 0.5 M NaCl, 10% glycerol for 2 h;
and against 13 PBS, 0.3 M NaCl, 10% glycerol overnight. Buffer to
sample ratio was 1000:1 for each dialysis.
Recombinant His6 Isoform 4 Fmrp—Briefly, bacteria containing the
His6 isoform 4 construct were grown at 37 °C in Luria broth containing
50 mg/ml carbenicillin and 25 mg/ml kanamycin until the A600 reached
0.8. We used carbenicillin, a less labile, semisynthetic form of ampicillin, for selection to ensure plasmid maintenance (QIAexpressionist,
Qiagen). Recombinant protein production was then induced by the
addition of isopropyl-1-thio-b-D-galactopyranoside to a final concentration of 2 mM for 5 h, and the cells were harvested at 4000 3 g for 10 min.
For purification, the cells were lysed for 1 h in Buffer A (6 M GuHCl, 0.1
M sodium phosphate, 0.01 M Tris-HCl, pH 8.0), followed by centrifugation at 10,000 3 g for 15 min at 4 °C. The supernatant was subjected to
a Ni-NTA column that was previously equilibrated with Buffer A. The
column was then washed with 10 column volumes of Buffer B (8 M urea,
0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 8.0) followed by 5 column
volumes of Buffer C (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl,
pH 6.3) until the A280 was less than 0.01. Recombinant His6 isoform 4
Fmrp was eluted with 18 ml of Buffer D (8 M urea, 0.1 M sodium
phosphate, 0.01 M Tris-HCl, pH 5.9), followed by 18 ml of Buffer E (8 M
urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 4.5). 3-ml fractions
were collected and analyzed by SDS-PAGE.
Purified His6 isoform 4 Fmrp was refolded using cetyltrimethylammonium bromide and b-cyclodextrin while simultaneously removing
the urea as described by Rozema and Gellman (20). Protein was first
slowly dialyzed from 8 M urea down to 3 M urea and then, at a concentration of 1.6 mg/ul, was refolded by the addition of 50 mM CTAB to a
final concentration of 2.28 mM. Dialysis was then performed against 23
mM Tris, 2.28 mM CTAB for 2 h at 4 °C. Next, 2.5 ml of 16 mM
b-cyclodextrin was added, and the resulting solution was allowed to
stand overnight at 4 °C. The protein was then concentrated with a Mr
10,000 cutoff filter, simultaneously changing the buffer to 13 PBS pH
7.4 (Ultrafree-15 Centrifugal Filter Device Biomax-10K NMWL membrane from Millipore, catalog no. UFV2BGC10).
Homopolymer Assays—Assays were performed according to previously established procedures (15, 21). Briefly, homopolymer RNA was
conjugated to CNBr-activated beads previously washed with 1 mM HCl
and then conjugated with RNA either in carbonate buffer, pH 8.0, for
primary amine linkage (Amersham Pharmacia Biotech; as recommended), MES buffer, pH 6.0, for aromatic amine linkage (22), or potassium
phosphate buffer, pH 8.5, for 59 phosphate linkage (23), 8 –72 h at 4 °C.
Beads were washed with three volumes of conjugation buffer and then
twice with 100 mM Tris-HCl, pH 8.0, and blocked for at least 4 h in 100
mM Tris-HCl, pH 8.0. After blocking, the beads were washed in alternating high/low pH buffers (Amersham Pharmacia Biotech; as recommended), and conjugation efficiency was determined via alkaline hydrolysis of an aliquot overnight at room temperature. The amount of
nucleic acids released was determined by measuring absorbance at 258
nm. Samples of identically prepared, mock conjugated naked beads
were alkaline hydrolyzed and analyzed to exclude background absorbance. The absorbance values and extinction coefficients were used to
equalize input of immobilized homopolymer RNA for each binding reaction. Experiments shown were performed with beads prepared in the
carbonate buffers. Indicated amounts of FLAG-Fmrp and approximately 5 mg of homopolymer RNA beads were at 30 °C in 0.5 ml of
binding buffer (100 mM NaCl, 10 mM Tris-HCl, pH 7.5, 2.5 mM MgCl2,
2.5% Triton X-100) or the buffer indicated. After incubation, the beads
were washed 5 times for 10 min each at 4 °C in 0.5 ml of binding buffer.
The second wash contained 1 mg/ml heparin. Beads were pelleted at
12,000 rpm in a microcentrifuge, resuspended in SDS sample buffer,
boiled for 20 min, and pelleted. Supernatants were transferred to fresh
tubes and pelleted, and 50% of the volume was loaded on a 12% SDSPAGE minigel for electrophoresis (Bio-Rad). This procedure was used to
equalize the amount loaded for each reaction and to avoid loading
agarose matrix onto the gel. Fmrp eluted from the beads was detected
by Western blotting using enhanced chemiluminesence (Amersham
Pharmacia Biotech).
Ultraviolet Cross-linking Assays—Full-length (4.2 kb) fmr1 message
containing all 17 exons was transcribed and 32P-labeled in vitro with T3
polymerase (Stratagene) using 44 mCi of 32P-UTP. One microgram of
4.2-kb Mc2.17 sequence (19) in pBS SK1 vector restricted with XhoI
served as template. Fmr1 message (500 ng, ;4.7 3 106 counts) was
mixed with protein in 30-ml reactions in 13 ERBB binding buffer. The
mix was incubated at 30 °C for 30 min and uv cross-linked on ice 11
times for 30 s (120 mJ) each (24). RNase A (Sigma) was added, and the
mix was incubated at 37 °C for 10 min. SDS sample buffer was added,
Characterizing Recombinant Fmrp
and the sample was boiled for 3–5 min and then loaded on 7.5%
SDS-PAGE minigels (Bio-Rad). Gels were silver-stained, and autoradiography was performed overnight.
Filter Binding Assays—Recombinant Fmrp and 32P-labeled fulllength fmr1 message as described above were mixed in 50-ml reaction
volumes of 13 ERBB buffer for 30 min at 30 °C. Nitrocellulose filters
(Millipore, HAWP 025 00) were pretreated with 0.4 M potassium hydroxide for 40 min, 0.1 M Tris-HCl, pH 7.0 –7.9, for 30 min, and binding
buffer for 5 min prior to use. The reaction mix was filtered (;10 s), and
the filters were washed with 2.5 ml of IPP150 (150 mM NaCl, 10 mM
Tris-HCl, pH 8.0, 0.1% Nonidet P-40, 0.1% NaN3) (25). Specific activity
for the fmr1 probe was 1.5 3 104 counts/fmol (see Fig. 5A) and 7.28 3
103 counts/fmol (see Fig. 5C). Filters were dried, and the nucleic acids
retained on the filter were dried and quantitated via scintillation counting (Beckman).
Fmr1 and Human Brain Transcript Binding Assays—Fmr1 cDNA
(Mc2.17 cloned into pBS KS1)18 message containing all 17 exons was
linearized with either XhoI (139-UTR) or NsiI (239-UTR) and then
transcribed, as described above, and biotinylated in vitro (6). For human brain transcript assays, plasmid DNA from each randomly chosen
clone in a pCMV-SPORTTM human brain cDNA library (Life Technologies, Inc.) was linearized by NotI restriction, transcribed, and biotinylated in vitro using Sp6 polymerase (Stratagene). Each message (80 ng)
was mixed with 250 ng of FLAG-Fmrp in 13 ERBB buffer and incubated in a 10-ml reaction volume at 30 °C for 30 min. The RNA was
captured with streptavidin-linked magnetic beads (Dynal) and washed
three times for 10 min each with 0.7 ml of IPP150 buffer at room
temperature. Protein was eluted by boiling the beads in SDS-sample
buffer, and visualized via SDS-PAGE and Western blotting. Alternatively, the messages were mixed with 2 ml of TnTR transcription/translation mix (Promega) containing either 35S-labeled wild type Fmrp or
35
S-labeled isoform 4 Fmrp. Neither of the 35S-labeled proteins had the
FLAG epitope. Reactions were performed as above, and the protein was
eluted by boiling the beads in protein sample buffer, separated by 12%
SDS-PAGE, visualized via phosphorimage, and quantitated by MacBas,
version 2.0, software.
RESULTS
Expression and Purification—The mouse cDNA Mc2.17 encodes the Fmrp with 97% amino acid identity and greater than
98% predicted amino acid similarity to human FMRP (18). We
have inserted an eight-amino acid FLAG peptide epitope tag
between the second and third amino acids of Fmrp and cloned
the full-length construct into the pVL1393 baculovirus transfer
vector. Cotransfecting Sf9 insect cells with pVL1393-FLAGfmr1 and linear BaculoGold DNA yielded recombinant baculovirus expressing FLAG-Fmrp using its natural ATG start
codon controlled by the polyhedrin promoter. Cell lysates analyzed by SDS-PAGE gels stained for protein show that cells
infected with the recombinant baculovirus produce an extra
;85-kDa protein band (Fig. 1, A and C). Western analysis
using the anti-FLAG M2 primary antibody detected the FLAGtagged protein in infected cell lysates only, and showed no
cross-reactivity to insect proteins (Fig. 1B). Western analysis
using monoclonal anti-Fmrp primary antibody detects the
same protein band, with no cross-reactivity to insect cell proteins, confirming its identity as FLAG-Fmrp (data not shown).
Similar to Fmrp-translated in vitro and endogenous full-length
FMRP in human lymphoblastoid cells, the recombinant protein
migrates with an anomalously high apparent molecular
weight, larger than predicted from primary amino acid sequence (26). After lysing the cells, FLAG-Fmrp was purified by
affinity chromatography using anti-FLAG M2 antibody matrix
and analyzed by Coomassie Blue-stained SDS-PAGE and
Western blotting (Fig. 1, C and B, respectively). One hundred
ml of Sf9 cell suspension culture at 1 3 106 to 3 3 106 cells per
ml produced approximately 1 mg of purified FLAG-Fmrp
protein.
Homopolymer Binding—We next asked whether the purified
recombinant Fmrp displayed the biochemical properties previously observed for Fmrp that had been translated and assayed
within wheat germ extract or rabbit reticulocyte lysate (5, 15).
15523
FIG. 1. Expression and purification of recombinant Fmrp. Murine cDNA Mc2.17 with an amino-terminal FLAG epitope was constructed in the baculovirus pVL1393 and infected into Sf9 cells for 72 h.
Cells were harvested and lysed by nitrogen bomb cavitation, and protein was purified using M2 anti-FLAG affinity chromatography. Lysates were resolved by 12% SDS-PAGE and proteins detected via Ponceau S staining (A) or immunoblotting (B) with M2 anti-FLAG
monoclonal antibody (Kodak Scientific Imaging Systems). Lane 1, uninfected lysate; lane 2, infected lysate; lane 3, 250 ng of purified,
dialyzed FLAG-Fmrp. C, Coomassie Blue staining of proteins resolved
on 12% SDS-PAGE gel. Lane M, molecular weight marker (3 1000);
lane 1, uninfected cell lysate; lane 2, infected cell lysate load; lane 3,
anti-FLAG affinity column flow through; lane 4, column wash; lane 5,
;300 ng of eluted FLAG-Fmrp.
The importance of this question may not be intuitive; our first
assumption was that if the protein had not become denatured
during purification, then it would behave identically to the
unpurified in vitro-translated Fmrp. However, upon careful
examination of previous work and considering that Fmrp is one
component of multiprotein mRNPs or translation machinery,
we could not be certain that Fmrp was the component of the
translation lysate that directly bound the mRNA (11–14). We
performed RNA binding assays with the purified protein, using
homopolymer RNAs conjugated to Sepharose beads (21). The
purified FLAG-Fmrp preferentially bound poly(G) much stronger than poly(U) and barely bound poly(C) or poly(A). This
specificity is identical to that previously observed with in vitrotranslated Fmrp (5) (Fig. 2A).
To further assess the binding specificity, we performed competition assays with ribonucleotide homopolymers. Because
preliminary evidence showed that Fmrp to has a slow on-rate,
requiring at least 10 min for complete binding (data not
shown), we premixed Fmrp with free competitor poly(G) or
poly(U) for 15 min and then added poly(G)-beads to the binding
reaction and incubated 20 –25 min. The G-beads were washed,
and the yield of captured Fmrp was analyzed (Fig. 2B). Poly(G)
competed effectively with agarose-conjugated poly(G); an
equivalent molar amount of competitor poly(G) reduced the
amount of Fmrp captured by at least 50%, whereas a 50-fold
molar excess of free poly(G) completely eliminated agaroseconjugated poly(G) from binding to Fmrp. As expected from the
poor binding of agarose-conjugated poly(U) to Fmrp, free
poly(U) was ineffective in competing with agarose-conjugated
poly(G) for Fmrp binding. Conjugation by either a primary
amine linkage or an aromatic amine linkage, as described
under “Experimental Procedures,” did not change these results
(data not shown).
To further characterize the interaction of Fmrp with poly(G),
a battery of binding conditions were assayed (Fig. 3). The
purified Fmrp bound poly(G) homopolymer beads with a salt
15524
Characterizing Recombinant Fmrp
FIG. 2. Purified recombinant Fmrp binds selectively to RNA
homopolymers. A, purified FLAG-Fmrp (0, 125, 250, and 500 ng of
input, increasing concentrations indicated by open triangles) was mixed
with agarose beads previously conjugated with the indicated homopolymer ribonucleic acid, poly(G), poly(U), poly(A), poly(C), or naked agarose beads (2) (21). The beads were washed, captured protein was eluted
by boiling in SDS buffer, and approximately half of the eluted protein
was subjected to SDS-PAGE and Western blotting using anti-FLAG M2
primary antibody. Control, 250 ng of recombinant Fmrp loaded directly
onto the gel is shown as a detection standard. B, competition with free
homopolymers: FLAG-Fmrp was preincubated with homopolymer RNA
competitor poly(G) or poly(U) in the molar ratios 1, 10, 50 indicating
[RNA competitor]:[poly(G) RNA-beads] or with no competitor, 0. Then
the poly(G) beads were added to the binding reaction. The beads were
pelleted, washed, and captured FLAG-Fmrp eluted. One half of the
eluted protein detected by SDS-PAGE and Western blotting. Input
shows one half of the input FLAG-Fmrp loaded directly onto the gel.
FIG. 3. Characterizing the poly(G) RNA-Fmrp interaction. 500
ng of purified FLAG-Fmrp was mixed in a binding reaction with ;5 mg
of immobilized poly(G) RNA under the conditions indicated. Input lane
shows 1⁄4 input FLAG-Fmrp loaded directly onto the gel. The 13 binding
buffer contained 100, 250, or 500 mM NaCl in the recipe in the indicated
lanes (see under “Experimental Procedures”). Heparin, 1 mg/ml heparin
competitor present during the binding reaction. ytRNA, 500 mg/ml
yeast tRNA present during the binding reaction. ERBB, 13 ERBB
binding buffer used for the binding reaction.
sensitivity identical to that reported for Fmrp translated in cell
lysates in that binding is abrogated when the binding buffer
contains 500 mM NaCl (5). Purified Fmrp retained its binding
capacity at 30 and 4 °C and in the presence of up to 500 mg per
ml of yeast tRNA as competitor. Heparin effectively inhibits
Fmrp-poly(G) interaction when present during binding but has
no effect when present during the washes (see under “Experimental Procedures”). Heparin has commonly been used during
initial stages of DNA-binding and RNA-binding protein purification and competes with DNA for RNA polymerase II in
transcription assays in vitro (27–29). Recombinant Fmrp also
bound poly(G) in 1 3 ERBB buffer, which was used to characterize in vitro-translated Fmrp binding to human brain
messages (6).
uv Cross-linking—Earlier studies with in vitro-translated
Fmrp indicated that it associates with its own message (6). To
demonstrate direct binding of Fmrp to its own message, we
performed a uv cross-linking assay. As shown by autoradio-
FIG. 4. Fmrp directly binds fmr1 3*-UTR. A, 600 ng of 32P-labeled
fmr1 message incubated with 1 mg bovine serum albumin (lane 3) or 0.3,
0.6, 1.2, 2.4, and 4.8 mg of purified FLAG-Fmrp (lanes 4 – 8) for 25 min
at 30 °C. The reaction was uv-cross-linked, RNased, and analyzed by
SDS-PAGE and autoradiograph, shown here. The silver-stained gel was
aligned with its autoradiograph to locate molecular weight standards.
Lane 1, bovine serum albumin, lane 2, fmr1 message, no protein; lane 9,
Fmrp. The arrowhead indicates the position of bovine serum albumin in
the gel; large arrow indicates the position of the major species of
FLAG-Fmrp purified; and small arrow indicates a minor species of
FLAG-Fmrp purified; both species are reactive with anti-FLAG antibody (data not shown). B, purified Fmrp is captured by its own biotinylated fmr1 message in the transcript binding assay and detected by
Western blotting (see under “Experimental Procedures”). 139-UTR,
full-length fmr1, 239-UTR, truncated fmr1. Control reactions performed with input FLAG-Fmrp (250 ng) alone or fmr1 message alone
are shown. Protein was analyzed by SDS-PAGE using 7.5% polyacrylamide (A) or 12% polyacrylamide (B).
graph in Fig. 4A, radiolabeled full-length 4.2-kilobase fmr1
message was mixed in a binding reaction with purified recombinant Fmrp. The reaction was then cross-linked by uv irradiation, treated with RNase, and separated by 7.5% SDS-polyacrylamide gel electrophoresis. The gel was silver-stained to
visualize Fmrp, and then autoradiography was used to detect
message cross-linked to protein. One microgram of bovine serum albumin failed to cross-link to any fmr1 message (Fig. 4A,
lane 3), whereas with increasing amounts of Fmrp, there was a
concomitant increase in the amount of message cross-linked to
the protein (Fig. 4A, lanes 4 – 8). With increasing Fmrp concentrations, a higher molecular weight band became apparent; at
4.8 mg of Fmrp, it became the predominant labeled band (Fig.
4A, lane 8). Both species were recognized by either anti-Fmrp
or anti-FLAG antibodies (data not shown). The basis for the
appearance of the higher molecular weight species is unclear at
the present time.
To further demarcate the portion of the fmr1 message interacting with Fmrp, transcripts driven off a template cleaved
with either XhoI or NsiI were evaluated in a biotinylated RNA
capture assay (see under “Experimental Procedures”). XhoI
cleaves fmr1 immediately downstream of the poly(A) tail, providing for a full-length fmr1 message. NsiI cleaves fmr1 approximately 200 nt downstream from the stop codon and therefore produces a run-off transcript deleted for the final 2084
nucleotides of the 39-UTR. As shown in Fig. 4B, such truncation
diminishes Fmrp binding by .90%, suggesting that the dominant site of interaction of the fmr1 transcript is in the 39-UTR.
The minor amount of Fmrp bound to the truncated transcript
may reflect either a weak binding site upstream of the NsiI site
or, more likely, the presence of a small population of uncleaved
template in the transcription reaction producing a minor species of full-length transcript. FLAG-Fmrp captured in this RNA
Characterizing Recombinant Fmrp
15525
FIG. 6. Recombinant Fmrp binds to human brain messages.
FLAG-Fmrp binds differentially to human brain RNAs. Fmrp was
mixed in a binding reaction with biotinylated RNAs transcribed in vitro
from randomly chosen human brain cDNA clones 1– 4. 139UTR, the
fmr1 message with its 39UTR; 239UTR, the fmr1 message lacking a
39UTR. Protein bound to captured messages was eluted and analyzed
by 12% SDS-PAGE and Western blotting.
FIG. 5. RNA binding by purified wild type Fmrp but not isoform 4 Fmrp. Full-length (4.2 kb) fmr1 RNA labeled with 32P-UTP was
bound to purified FLAG-Fmrp at the indicated concentrations. Binding
reactions were filtered through 0.45 mm nitrocellulose filters and
washed with 40 volumes of IPP150 buffer, and the nucleic acid retained
on the filters was detected by scintillation counting. A, binding reactions analyzed at 5.7 and 57 nM FLAG-Fmrp. B, in vitro-translated
isoform 4 Fmrp, predicted from reverse transcription-polymerase chain
reaction analysis (18), lacks exon 14 and RGG sequences, has a novel
carboxyl terminus, and is deficient in nuclear export (7). Here, 35Slabeled Fmrp isoform 4 was assayed for fmr1 RNA binding in the
biotinylated transcript binding assay (see under “Experimental Procedures”). T, input translation material; B, material bound by fmr1 message. C, comparing the binding of recombinant wild type Fmrp (60 nM)
to recombinant His6 isoform 4 Fmrp (60 nM) by filter binding assay.
binding assay and analyzed on 7.5% polyacrylamide gels allows
separation of the two FLAG-tagged species as detected by
Western analysis using the anti-FLAG primary antibody (data
not shown).
mRNA Binding—Filter binding assays were performed as an
additional method to assess RNA binding. 32P-labeled fmr1
message alone exhibited a low binding capacity when up to 1
nM quantities were passed through 0.45 mm nitrocellulose filters. However, when premixed with 5.7 nM purified Fmrp, the
binding of the labeled fmr1 message increased with increasing
RNA levels, as judged by captured radioactivity (Fig. 5A). Saturation appeared evident at approximately 500 pM message.
When the binding assay was repeated with 57 nM Fmrp, a
10-fold increase in bound radioactivity was observed at all RNA
concentrations tested.
We next tested the ability of a naturally occurring isoform of
Fmrp to bind RNA in this assay. Isoform 4 is a variant Fmrp
produced by alternative splicing that results in the deletion of
exon 14 (18). This deletion causes a reading frameshift between
exons 13 and 15, thereby creating a novel carboxyl terminus.
Isoform 4 lacks the RGG-box motifs and the nuclear export
signal (7). The in vitro transcription/translation product of
isoform 4 was first tested for its ability to bind fmr1 message
according to the previously published method of biotinylatedRNA capture of radiolabeled protein. As shown in Fig. 5B and
consistent with our previous observation (6), approximately
40% of the full-length Fmrp, translated from plasmid 2.17
transcript, was captured by biotinylated fmr1 message. In contrast, despite an 8-fold increase in isoform 4 Fmrp, less than
0.5% of the input isoform 4 was captured by this assay. Accordingly, hexahistidine-tagged isoform 4 protein, prepared and
isolated as described under “Experimental Procedures,” did not
bind fmr1 RNA when tested in the filter binding assay. As
shown in Fig. 5C, very little fmr1 message was captured over
the range of concentrations tested. These data demonstrate
that this naturally occurring isoform fails to bind RNA in vitro,
thereby implying a functional distinction between isoforms of
Fmrp.
The biotinylated fmr1 message capture assay was next modified using purified Fmrp instead of radiolabeled in vitro-translated Fmrp, and bound protein was detected by Western analysis. In this assay, as in the previous assays, purified
recombinant Fmrp bound to its own message. This binding was
dramatically reduced if the message was truncated in the 39UTR (Fig. 6). In order to determine whether the purified Fmrp
selectively binds complex mRNAs, we tested four cloned human
brain cDNAs. The transcribed RNAs most likely to contained
the 39-ends of brain messages, due to the construction of the
cDNA library (pCMV-SPORT human brain library, Life Technologies, Inc.). As shown in Fig. 6, two of the clones tested
produced biotinylated transcript that fail to capture purified
Fmrp (lanes 1 and 4), whereas the other two cDNAs produced
transcripts that exhibited modest and rather marked affinity to
Fmrp (lanes 2 and 3, respectively). These results were consistent with those observed with the in vitro-translated protein;
ability to capture Fmrp was not related to the size of the
transcripts assayed. These experiments were performed with
equivalent molar amounts of each transcript in the presence of
100-fold excess of yeast tRNA as a nonspecific RNA competitor.
The cDNAs were partially sequenced, and a Basic Local Alignment Search Tool data base search identified cDNAs 2 and 3 as
the 39-UTR of myelin basic protein and human EST KIAA0017,
respectively.
I304N Fmrp—The FLAG-tagged version of Fmrp was modified to produce the I304N missense mutation of severe fragile X
syndrome (19). It previously been suggested that this amino
acid change results in the unfolding of the second KH domain
and may abrogate RNA binding (30). This speculation was
supported by the reduced binding of in vitro-translated I304N
Fmrp to poly(G) RNA and abolished binding of in vitro-translated I304N Fmrp to poly(U) RNA at 250 mM NaCl (15). Here,
15526
Characterizing Recombinant Fmrp
FIG. 7. Purified recombinant I304N Fmrp binds preferentially
to poly(G) homopolymer. Standard binding reactions in 13 binding
buffer with 100 mM NaCl were performed using purified recombinant
wild type Fmrp (G and U) or with purified recombinant Fmrp carrying
the point mutation found in severe fragile X sydrome (G, U, A, C, and
2). Input lanes: 250 ng of purified protein loaded directly onto gel
represents 1⁄2 of the input protein in each reaction; 2 indicates naked
beads (no RNA). Approximately 55% of the reaction yield was visualized by SDS-PAGE and immunoblotting (see under “Experimental
Procedures”).
recombinant I304N Fmrp was purified as described above for
wild type Fmrp and subjected to homopolymer binding. As
shown in Fig. 7, I304N protein clearly bound selectively to
poly(G), although with slightly reduced yield as compared with
wild type; this is seen more clearly in the poly(U) experiments.
DISCUSSION
We have used the baculovirus system to express high levels
of FLAG-Fmrp and purify the protein to apparent homogeneity
under relatively nondenaturing conditions. The purified FLAGFmrp protein appears biochemically intact and active. It displays the same homopolymer association properties as in vitrotranslated Fmrp, binding poly(G) . poly(U) .. poly(C) and
poly(A). The RNA binding activity is therefore an intrinsic
property of the Fmrp molecule, independent of Fmrp interaction with other proteins. This point is of some significance.
Because previous studies did not utilize purified preparations,
it had remained unclear whether or not the selectivity and,
indeed, RNA binding were functional attributes of Fmrp alone
or required association with other proteins. The selective RNA
binding demonstrated by the purified protein will now allow
the capture and characterization of cognate RNA species by
epitope-immobilized purified Fmrp.
We have also demonstrated that FLAG-Fmrp directly binds
to the 39-untranslated portion of its own transcript. Moreover,
of the two RNAs found in this study to bind Fmrp well, one was
the 39-UTR of myelin basic protein. Although it is difficult at
the present time to discern any similarity between these RNA
sequences that may direct binding, the observation of 39-UTR
interaction is interesting. The 39-UTRs of mRNA have been
found to often be targets for RNA-binding proteins, the interactions of which may regulate translational efficiency and or
mRNA stability (31–35). Although it is premature to interpret
the Fmrp binding to the 39-UTRs of both its own message and
that of myelin basic protein, one might speculate a functional
significance. Additional studies, such as adding either 39-UTR
to a reporter construct and transfecting into normal and Fmrpdeficient cells, are needed.
It was also demonstrated, utilizing both in vitro-translated
and purified protein, that a naturally occurring isoform of
Fmrp, isoform 4, is severely impaired in RNA binding. This
isoform is devoid of exon 14-coded residues and, because of a
frameshift at the alternative splice, has a distinct carboxyl
terminus (18). The loss of exon 14 results in the absence of the
nuclear export signal from Fmrp, leading to nuclear localization (7), whereas the alternative carboxyl terminus no longer
contains the RGG box (18, 36). Because isolated KH domains
have been considered sufficient to direct RNA binding (37), it is
unexpected that isoform 4 interacts only weakly with RNA. It
is possible that either the RGG box directs RNA binding or any
or all of the absent sequences alter the conformation of the KH
domains, limiting their ability to interact with RNA. Whatever
the mechanism, these data imply that isoform 4 does not bind
RNA as well as the wild type does. It is also confined to the
nucleus, thereby having significantly distinct attributes from
the full-length Fmrp. Because it is possible that isoform 4 may
still interact with at least some of the nuclear proteins that
normally constitute the mRNP along with full-length Fmrp
(13), isoform 4 may act to sequester these proteins, perhaps
limiting the formation of the normal Fmrp mRNP. Although it
is possible that the purification and refolding of isoform 4 may
have produced a nonnative conformation in the protein, parallel studies with in vitro-translated isoform 4 support the observed impaired RNA binding of this isoform.
In contrast to the diminished RNA binding of isoform 4, we
demonstrate that protein bearing the I304N mutation in the
second KH domain of Fmrp retains a significant amount of
RNA binding ability. This is in contrast to earlier studies that
speculated that, based upon NMR-derived structure of an isolated KH domain, the I304N mutation should abolish RNA
binding due to complete unfolding of the KH structure (30). Our
observation of RNA binding by the purified I304N protein
(albeit slightly less than the wild type protein, but with selectivity similar to that of the wild type protein) suggests that the
I304N mutation is not destabilizing when incorporated within
the full-length protein. The unfolding of the isolated KH domain, apparently caused by this mutation, was supported by
work of Siomi et al. (5, 15), which showed that in vitro-translated I304N Fmrp lost poly(U) binding in 250 mM NaCl,
whereas wild type protein did not. We also demonstrate that
purified I304N protein has a greater salt sensitivity than wild
type protein in regard to poly(U) binding (in 100 mM NaCl, the
I304N protein was unable to bind poly(U) but retained poly(G)
binding). Our observation of a more severe salt sensitivity with
the purified mutant protein than the in vitro-translated protein
(which could bind poly(U) at 100 mM NaCl (15)) may suggest
that interacting proteins within the reticulocyte lysate may
partially stabilize the I304N Fmrp. Indeed, this possibility is
supported by our recent observation that the human cellular
I304N FMRP retains RNA binding in vivo but forms a mRNP of
altered mass and density, suggesting that the mutation influences protein-protein interaction more than RNA-protein interaction at physiological salt concentrations (13).
As described above, recombinant epitope-tagged forms of
Fmrp can be prepared in mg quantities at near homogeneous
levels of purity. The observations that wild type purified Fmrp
has autonomous and selective RNA binding, whereas the
I304N mutation in the second KH domain exhibits selective
RNA binding with a greater salt sensitivity, demonstrate that
the functional attributes of the protein were maintained
throughout the purification process. The significant reduction
in RNA binding by isoform 4 suggests distinctive functional
attributes for this alternatively spliced form of Fmrp. Based on
the above characterization of the purified proteins, structural
studies of Fmrp are now possible, the results of which should
shed considerable insight specifically into Fmrp and, more
broadly, into KH domain proteins in general.
Acknowledgments—We thank David Uhlinger, Fuping Zhang, and
Claude Ashley for technical assistance.
REFERENCES
1. Verkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, V. H., Kuhl, D. P. A.,
Pizutti, A., Reiner, D., Richards, S., Zhang, F., Eussen, B. E., van Ommen,
C. J. B., Blonden, L. A. J., Riggins, G. J., Chastain, J. L., Kunst, C. B.,
Galjaard, H., Caskey, C. T., Nelson, D. L., Dostra, B. A., and Warren, S. T.
(1991) Cell 65, 904 –914
2. Sutcliffe, J. S., Nelson, D. L., Zhang, F., Pieretti, M., Caskey, C. T., Saxe, D.,
and Warren, S. T. (1992) Hum. Mol. Genet. 1, 397– 400
3. Pieretti, M., Zhang, F. P., Fu, Y. H., Warren, S. T., Oostra, B. A., Caskey, C. T.,
and Nelson, D. L. (1991) Cell. 66, 817– 822
4. Eberhart, D. E., and Warren, S. T. (1996) Cold Spring Harbor Symp. Quant.
Biol. 61, 679 – 687
5. Siomi, H., Siomi, M. C., Nussbaum, R. L., and Dreyfuss, G. (1993) Cell 74,
291–298
Characterizing Recombinant Fmrp
6. Ashley, C. A., Jr., Wilkinson, K. D., Reines, D., and Warren, S. T. (1993)
Science 262, 563–566
7. Eberhart, D. E., Malter, H. E., Feng, Y., and Warren, S. T. (1996) Hum. Mol.
Genet. 5, 1083–1091
8. Kiledjian, M., and Dreyfuss, G. (1992) EMBO J. 11, 2655–2664
9. Burd, C. G., and Dreyfuss, G. (1994) Science 265, 615– 621
10. Siomi, H., Matunis, M. J., Michael, W. M., and Dreyfuss, G. (1995) Nucleic
Acids Res. 2, 1193–1198
11. Khandjian, E. W., Corbin, F., Woerly, S., and Rousseau, F. (1996) Nat. Genet.
12, 91–93
12. Tamanini, F., Meijer, N., Verheij, C., Willems, P. J., Galjaard, H., Oostra,
B. A., and Hoogeveen, A. T. (1996) Hum. Mol. Genet. 5, 809 – 813
13. Feng, Y., Absher, D., Eberhart, D. E., Brown, V., Malter, H. E., and Warren,
S. T. (1997) Mol. Cell. 1, 109 –118
14. Siomi, M. C., Zhang, T., Siomi, H., and Dreyfuss, G. (1996) Mol. Cell. Biol. 16,
3825–3832
15. Siomi, H., Choi, M., Siomi, M. C., Nussbaum, R. L., and Dreyfuss, G. (1994)
Cell 77, 33–39
16. Scandurro, A. B., Rondon, I. J., Wilson, R. B., Tenenbaum, S. A., Garry, R. F.,
and Beckman, B. S. (1997) Kidney Int. 51, 579 –584
17. Yeakley, J. M., Mortin, J. P., Rosenfeld, M. G., and Fu, X. D. (1996) Proc. Natl.
Acad. Sci. U. S. A. 93, 7582–7587
18. Ashley, C. T., Sutcliffe, J. S., Kunst, C. B., Leiner, H. A., Eithler, E. E., Nelson,
D. L., and Warren, S. T. (1993) Nat. Genet. 4, 244 –251
19. De Boulle, K., Verkerk, A. J., Reyniers, E., Vits, L., Hendricks, J., Van Roy, B.,
Van den Bos, F., de Graaff, E., Oostra, B. A., and Willems, P. J. (1993) Nat.
Genet. 3, 31–35
20. Rozema, D., and Gellman, S. H. (1995) J. Am. Chem. Soc. 117, 2373–2374
21. Swanson, M. S., and Greyfuss, G. (1988) Mol. Cell. Biol. 8, 2237–2241
22. Wagner, A. F., Bugianesi, R. L., and Shen, T. Y. (1971) Biochem. Biophys. Res.
15527
Commun. 45, 184 –189
23. Poonian, M. S., Schlaback, A. J., and Weissback, A. (1971) Biochemistry 10,
424 – 427
24. Kessler, M. M., Henry, M. F., Shen, E., Zhao, J., Gross, S., Silver, P. A., and
Moore, C. L. (1997) Genes Dev. 11, 2545–2546
25. Sherly, D., Boelens, W., van Venrooij, W. J., Dathan, N. A., Hamm, J., and
Mattaj, I. W. (1989) EMBO J. 8, 4163– 4170
26. Small, K., and Warren, S. T. (1995) Mental Retard. Dev. Disabil. Res. Rev. 1,
245–250
27. Reines, D., Chamberlin, M. J., and Kane, C. M. (1989) J. Biol. Chem. 264,
10799 –10809
28. Moreno, C. S., Emory, P., West, J. E., Durand, B., Reith, B. M., and Boss, J. M.
(1995) J. Immunol. 155, 4313– 4321
29. Dolganov, G. M., Chestukhin, A. V., and Shenyakin, M. F. (1981) Eur. J.
Biochem. 114, 247–254
30. Musco, G., Stier, G., Joseph, C., Morelli, M. A., Nilges, M., Gibson, T. J., and
Pastore, A. (1996) Cell 85, 237–245
31. Kwon, Y. K., and Hecht, N. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,
3584 –3588
32. Sonenberg, N. (1994) Curr. Opin. Genet. Dev. 4, 310 –315
33. Amara, F. M., Sun, J., and Wright, J. A. (1996) J. Biol. Chem. 271,
20126 –20131
34. Wickens, M., Anderson, P., and Jackson, R. J. (1997) Curr. Opin. Genet. Dev.
7, 220 –232
35. Ostareck, D. H., Ostareck-Lederer, A., Wilm, M., Thiele, B. J., Mann, M., and
Hentze, M. W. (1997) Cell 89, 597– 606
36. Verkerk, A. J. M. H., de Graaff, E., De Boulle, K., Eichler, E. E., Konecki, D. S.,
Reyniers, E., Manca, A., Poustka, A., Willems, P. J., Nelson, D. L., and
Oostra, B. A. (1993) Hum. Mol. Genet. 2, 399 – 404
37. Dejgaard, K., and Leffers, H. (1996) Eur. J. Biochem. 241, 425– 431