C. elegans daf-6 Encodes a Patched-Related Protein
... that these vacuoles contained matrix material. Consistent with this observation, EM cross-sections of daf6(e1377) animals revealed that amphid cilia resided within a sheath cell pocket containing material similar in electron density to matrix material (Figure 1O). These findings are also consistent ...
... that these vacuoles contained matrix material. Consistent with this observation, EM cross-sections of daf6(e1377) animals revealed that amphid cilia resided within a sheath cell pocket containing material similar in electron density to matrix material (Figure 1O). These findings are also consistent ...
Chapter-Translation (Prokaryotes)
... may be attached to endoplasmic reticulum to give it a rough surface. Ribosomes make up the large part of cells in many species for example in E.coli, they almost occupy 1/4th of cell mass. In fact ribosomes form the backbone for many molecules during the process of protein synthesis. The ribosomes o ...
... may be attached to endoplasmic reticulum to give it a rough surface. Ribosomes make up the large part of cells in many species for example in E.coli, they almost occupy 1/4th of cell mass. In fact ribosomes form the backbone for many molecules during the process of protein synthesis. The ribosomes o ...
Protein Engineering in the Development of
... The aggregation or assembly of two or more domains into a coiled-coil bundle is reversible with changes in pH, temperature, and ionic strength. The conditions under which assembly occurs are dependent on the primary sequence. The reversible assembly makes the leucine zipper domain ideal to serve as ...
... The aggregation or assembly of two or more domains into a coiled-coil bundle is reversible with changes in pH, temperature, and ionic strength. The conditions under which assembly occurs are dependent on the primary sequence. The reversible assembly makes the leucine zipper domain ideal to serve as ...
Alpha Diagnostic Intl Inc., 6203 Woodlake Center Dr, San Antonio
... tissue of the body and is derived from the mesodermal layer of embryonic germ cells. There are three types of muscles (skeletal, cardiac and smooth): Skeletal muscle or "voluntary muscle" is anchored by tendons to bone. Smooth muscle or "involuntary muscle" is found within the walls of organs and st ...
... tissue of the body and is derived from the mesodermal layer of embryonic germ cells. There are three types of muscles (skeletal, cardiac and smooth): Skeletal muscle or "voluntary muscle" is anchored by tendons to bone. Smooth muscle or "involuntary muscle" is found within the walls of organs and st ...
the scf ubiquitin ligase: insights into a molecular machine
... (LRR)), the domain is an arc-shaped α–β-repeat structure that is also found in many protein-binding contexts, including the extracellular-binding domain of certain surface receptors11,12. In most cases, FBLs also seem to involve substrate phosphorylation for their interaction, but this does not seem ...
... (LRR)), the domain is an arc-shaped α–β-repeat structure that is also found in many protein-binding contexts, including the extracellular-binding domain of certain surface receptors11,12. In most cases, FBLs also seem to involve substrate phosphorylation for their interaction, but this does not seem ...
Figure 2
... You have already learned that a covalent bond forms when electrons are shared between atoms. A coordinate-covalent bond(represented by a green arrow in this diagram) forms when both of the shared electrons come from the same atom, called the donor atom (blue). An anion or molecule containing the don ...
... You have already learned that a covalent bond forms when electrons are shared between atoms. A coordinate-covalent bond(represented by a green arrow in this diagram) forms when both of the shared electrons come from the same atom, called the donor atom (blue). An anion or molecule containing the don ...
Roles of Chromatin insulators in gene regulation and diseases
... responsible for this connection are just starting to emerge. Chromatin insulators are key determinants of proper gene regulation and precise organization of chromosomal structures. These elements are DNA-protein complexes which can mediate interactions within and between chromosomes. In doing so, th ...
... responsible for this connection are just starting to emerge. Chromatin insulators are key determinants of proper gene regulation and precise organization of chromosomal structures. These elements are DNA-protein complexes which can mediate interactions within and between chromosomes. In doing so, th ...
replication. phosphorylation in duck hepatitis B virus Multiple
... We have investigated the role of phosphorylation of the capsid protein of the avian hepadnavirus duck hepatitis B virus in viral replication. We found previously that three serines and one threonine in the C-terminal 24 amino acids of the capsid protein serve as phosphorylation sites and that the pa ...
... We have investigated the role of phosphorylation of the capsid protein of the avian hepadnavirus duck hepatitis B virus in viral replication. We found previously that three serines and one threonine in the C-terminal 24 amino acids of the capsid protein serve as phosphorylation sites and that the pa ...
Fast and simple purification of GST fusion proteins using prepacked
... Fig 3. SDS-PAGE analysis of a GST fusion protein purified with GSTrap affinity columns. A cytoplasmic extract from an E. coli culture expressing a GST fusion protein was loaded onto GSTrap 1 ml and GSTrap 5 ml columns (8 ml and 40 ml of lysate, respectively). Fusion protein was eluted using 10 mM re ...
... Fig 3. SDS-PAGE analysis of a GST fusion protein purified with GSTrap affinity columns. A cytoplasmic extract from an E. coli culture expressing a GST fusion protein was loaded onto GSTrap 1 ml and GSTrap 5 ml columns (8 ml and 40 ml of lysate, respectively). Fusion protein was eluted using 10 mM re ...
glycan associated protein of Legionella (PpiA)
... chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and 5'CTTGTTGCCTCATAAATAAACTCTC 3' (reverse position 639-615). Oligonucleotide synthesis was ...
... chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and 5'CTTGTTGCCTCATAAATAAACTCTC 3' (reverse position 639-615). Oligonucleotide synthesis was ...
Osmotic Signaling in Plants. Multiple Pathways
... animal life, are becoming well documented in some aspects. Current knowledge of plant signaling networks was first based on the identification of some receptors that perceive the signal as well as many transcription factors and target genes that mediate the responses. However, the list of the identi ...
... animal life, are becoming well documented in some aspects. Current knowledge of plant signaling networks was first based on the identification of some receptors that perceive the signal as well as many transcription factors and target genes that mediate the responses. However, the list of the identi ...
midtermstudyguidehe325_2015
... Be able to list 3 reasons why we eat the way we do and which ones influence you Know the 6 classes of essential nutrients Know the definition of a kilocalorie Know what balance, variety, and moderation are Know what nutrient density means and be able to list examples Be able to draw the ...
... Be able to list 3 reasons why we eat the way we do and which ones influence you Know the 6 classes of essential nutrients Know the definition of a kilocalorie Know what balance, variety, and moderation are Know what nutrient density means and be able to list examples Be able to draw the ...
In-silico Prediction of Surface Residue Clusters
... Both authors have contributed equally to this work ...
... Both authors have contributed equally to this work ...
Garrett-Engele* C. M., Siegal*, M. L., Manoli, D. S., Williams, B. C., Li. H., and Baker, B. S.
... length polymorphism (RFLP) mapping. A clone containing the ix gene was identified by its ability to rescue ix mutant phenotypes when introduced into flies by P-element-mediated germline transformation. The ix protein has sequence similarity to proteins proposed to act as transcriptional activators, ...
... length polymorphism (RFLP) mapping. A clone containing the ix gene was identified by its ability to rescue ix mutant phenotypes when introduced into flies by P-element-mediated germline transformation. The ix protein has sequence similarity to proteins proposed to act as transcriptional activators, ...
Laboratory Report Guidelines and Rubric
... statements: short summary of the function of AS1 and AS2, the scientific reason for why the experiments were done, an overview of the general methods used, and the main outcome. Although abstracts are short, they are probably the hardest of all sections to write. Introduction The introduction needs ...
... statements: short summary of the function of AS1 and AS2, the scientific reason for why the experiments were done, an overview of the general methods used, and the main outcome. Although abstracts are short, they are probably the hardest of all sections to write. Introduction The introduction needs ...
Heart Failure
... leading causes of morbidity and mortality in Western society. Numerous pathways have been causally implicated in the transition from myocyte hypertrophy to failure,2 including programmed cell death, cellular atrophy, and very recently, autophagy.3,4 However, mechanisms governing the transition from ...
... leading causes of morbidity and mortality in Western society. Numerous pathways have been causally implicated in the transition from myocyte hypertrophy to failure,2 including programmed cell death, cellular atrophy, and very recently, autophagy.3,4 However, mechanisms governing the transition from ...
Introduction to Adipose Tissue Adipose tissue is not merely an
... enzyme PEPCK, and glycerol-3-phosphate dehydrogenase (GPD1). PPARγ also functions in macrophage lipid metabolism by inducing the expression of the macrophage scavenger receptor, CD36. The CD36 receptor is also known as fatty acid translocase (FAT) and it is one of the receptors responsible for the c ...
... enzyme PEPCK, and glycerol-3-phosphate dehydrogenase (GPD1). PPARγ also functions in macrophage lipid metabolism by inducing the expression of the macrophage scavenger receptor, CD36. The CD36 receptor is also known as fatty acid translocase (FAT) and it is one of the receptors responsible for the c ...
npgrj_nchembio_91 405..407 - The Scripps Research Institute
... to alanine, and the probe reactivity profiles of mutant enzymes were compared to that of wild-type (WT) ALDH-1 following transient transfection in COS-7 cells. Consistent with previous studies9, the SE probe was found to label both WT and C303A mutant ALDH-1 but not the E269A mutant (Fig. 2a). Notab ...
... to alanine, and the probe reactivity profiles of mutant enzymes were compared to that of wild-type (WT) ALDH-1 following transient transfection in COS-7 cells. Consistent with previous studies9, the SE probe was found to label both WT and C303A mutant ALDH-1 but not the E269A mutant (Fig. 2a). Notab ...
Word - The Open University
... To make things quicker to draw when we are dealing with larger molecules, the atoms are not usually represented as coloured balls but by the chemical symbol for the element, and the bonds between the atoms are drawn as lines. Chemical analysis of the human body shows that 13 major elements, with sma ...
... To make things quicker to draw when we are dealing with larger molecules, the atoms are not usually represented as coloured balls but by the chemical symbol for the element, and the bonds between the atoms are drawn as lines. Chemical analysis of the human body shows that 13 major elements, with sma ...
Leukaemia Section t(3;7)(q26;q21) Atlas of Genetics and Cytogenetics in Oncology and Haematology
... in AML with t(3;12) translocation. EVI1 is also involved in other translocations such as t(2;3)(p13;q26), t(2;3)(q23;q26), t(3;17)(q26;q22) and t(3;13)(q26;q13-14). Other studies have reported abnormal expression of EVI1 in MDS and AML without 3q26 structural abnormalities, suggesting that inappropr ...
... in AML with t(3;12) translocation. EVI1 is also involved in other translocations such as t(2;3)(p13;q26), t(2;3)(q23;q26), t(3;17)(q26;q22) and t(3;13)(q26;q13-14). Other studies have reported abnormal expression of EVI1 in MDS and AML without 3q26 structural abnormalities, suggesting that inappropr ...
Genomic Tagging of the Anaphase-Promoting Complex Activator
... p27Kip1 are stabilized, and this process commits a cell to senescence (11). Finding out whether Tax and Cdc20 physically interact could help verify this theory. Point mutations of Tax have been assayed for comparison against wildtype activity (11). The phenotypes suggested that the growth arrest bin ...
... p27Kip1 are stabilized, and this process commits a cell to senescence (11). Finding out whether Tax and Cdc20 physically interact could help verify this theory. Point mutations of Tax have been assayed for comparison against wildtype activity (11). The phenotypes suggested that the growth arrest bin ...
PDF
... response to GA and include mutants with alterations in both GA perception and GA signal transduction. Hence, GA-insensitive mutants display a similar dwarf phenotype to GA-deficient mutants, except that they fail to respond to exogenous GA. By contrast, mutants with constitutively active GA response ...
... response to GA and include mutants with alterations in both GA perception and GA signal transduction. Hence, GA-insensitive mutants display a similar dwarf phenotype to GA-deficient mutants, except that they fail to respond to exogenous GA. By contrast, mutants with constitutively active GA response ...
Prokaryote Gene Expression Section 1 Overview of RNA
... They add the specific amino acid to the correct tRNA in an ATP dependent charging reaction Each enzyme recognises a specific amino acid and its cognate tRNA, but does not only use the anti-codon for the specificity of this reaction There are 20 amino acids, 24-60 tRNAs and generally approximately th ...
... They add the specific amino acid to the correct tRNA in an ATP dependent charging reaction Each enzyme recognises a specific amino acid and its cognate tRNA, but does not only use the anti-codon for the specificity of this reaction There are 20 amino acids, 24-60 tRNAs and generally approximately th ...
Characterization and expression of an mRNA encoding a wound
... peptide protects the exposed fracture surface from pathogenic invasion. Some expression is also apparent in nonzone cells and, whilst no cell separation takes place in this tissue, the process of explant generation may provide a sufficient wound signal to promote transcription of the TAB7 gene in th ...
... peptide protects the exposed fracture surface from pathogenic invasion. Some expression is also apparent in nonzone cells and, whilst no cell separation takes place in this tissue, the process of explant generation may provide a sufficient wound signal to promote transcription of the TAB7 gene in th ...
conference on multiple hereditary exostoses abstract
... multiple EXT mutations have been described. A review of the literature documented 82 and 39 different mutations in the EXT1 and EXT2 genes respectively. Twenty of the EXT1 mutations and 4 of the EXT2 mutations were identified in more than one family. The EXT1 gene mutations include 45 frameshift, 14 ...
... multiple EXT mutations have been described. A review of the literature documented 82 and 39 different mutations in the EXT1 and EXT2 genes respectively. Twenty of the EXT1 mutations and 4 of the EXT2 mutations were identified in more than one family. The EXT1 gene mutations include 45 frameshift, 14 ...
Protein moonlighting
Protein moonlighting (or gene sharing) is a phenomenon by which a protein can perform more than one function. Ancestral moonlighting proteins originally possessed a single function but through evolution, acquired additional functions. Many proteins that moonlight are enzymes; others are receptors, ion channels or chaperones. The most common primary function of moonlighting proteins is enzymatic catalysis, but these enzymes have acquired secondary non-enzymatic roles. Some examples of functions of moonlighting proteins secondary to catalysis include signal transduction, transcriptional regulation, apoptosis, motility, and structural.Protein moonlighting may occur widely in nature. Protein moonlighting through gene sharing differs from the use of a single gene to generate different proteins by alternative RNA splicing, DNA rearrangement, or post-translational processing. It is also different from multifunctionality of the protein, in which the protein has multiple domains, each serving a different function. Protein moonlighting by gene sharing means that a gene may acquire and maintain a second function without gene duplication and without loss of the primary function. Such genes are under two or more entirely different selective constraints.Various techniques have been used to reveal moonlighting functions in proteins. The detection of a protein in unexpected locations within cells, cell types, or tissues may suggest that a protein has a moonlighting function. Furthermore, sequence or structure homology of a protein may be used to infer both primary function as well as secondary moonlighting functions of a protein.The most well-studied examples of gene sharing are crystallins. These proteins, when expressed at low levels in many tissues function as enzymes, but when expressed at high levels in eye tissue, become densely packed and thus form lenses. While the recognition of gene sharing is relatively recent—the term was coined in 1988, after crystallins in chickens and ducks were found to be identical to separately identified enzymes—recent studies have found many examples throughout the living world. Joram Piatigorsky has suggested that many or all proteins exhibit gene sharing to some extent, and that gene sharing is a key aspect of molecular evolution. The genes encoding crystallins must maintain sequences for catalytic function and transparency maintenance function.Inappropriate moonlighting is a contributing factor in some genetic diseases, and moonlighting provides a possible mechanism by which bacteria may become resistant to antibiotics.