Download ecoli lysis - KSU Faculty Member websites

Performing your original search, growth of bacteria and lysis after death in E.coli and P.aeruginosa,
in PNAS will retrieve 90366 results.
PNAS | May 14, 2002 | vol. 99 | no. 10 | 70667071
This Article
Abstract
Full Text (PDF)
Alert me when this article is cited
Alert me if a correction is posted
Services
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My File Cabinet
Download to citation manager
Cited by other online articles
Search for citing articles in:
ISI Web of Science (32)
Request Copyright Permission
Google Scholar
Articles by Tauschek, M.
Articles by Robins-Browne, R. M.
Articles citing this Article
PubMed
PubMed Citation
Articles by Tauschek, M.
Articles by Robins-Browne, R. M.
Pubmed/NCBI databases
Gene
GEO Profiles
Nucleotide Protein
|
Previous Article
Next Article
| Table of Contents
Substance via MeSH
Microbiology
Identification of a protein secretory pathway for the
secretion of heat-labile enterotoxin by an
enterotoxigenic strain of Escherichia coli
Marija Tauschek*, , Rebecca J. Gorrell*, , Richard A. Strugnell*, and Roy M.
Robins-Browne*, ,
*
Department of Microbiology and Immunology, University of Melbourne, Victoria
3010, Australia; and Microbiological Research Unit, Murdoch Children's Research
Institute, and Royal Children's Hospital, Parkville, Victoria 3052, Australia
Communicated by Harley W. Moon, Iowa State University, Ames, IA, March
14, 2002 (received for review October 26, 2001)
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Abstract
Enterotoxigenic Escherichia coli (ETEC) is an enteric pathogen that causes choleralike diarrhea in humans and animals. ETEC secretes a heat-labile enterotoxin (LT),
which resembles cholera toxin, but the actual mechanism of LT secretion is presently
unknown. We have identified a previously unrecognized type II protein secretion
pathway in the prototypic human ETEC strain, H10407 (serotype O78:H11). The
genes for this pathway are absent from E. coli K-12, although examination of the K12 genome suggests that it probably once possessed them. The secretory pathway
bears significant homology at the amino acid level to the type II protein secretory
pathway required by Vibrio cholerae for the secretion of cholera toxin. With this in
mind, we determined whether the homologous pathway of E. coli H10407 played a
role in the secretion of LT. To this end, we inactivated the pathway by inserting a
kanamycin-resistance gene into one of the genes (gspD) of the type II secretion
pathway by homologous recombination. LT secretion by E. coli H10407 and the gspD
mutant was assayed by enzyme immunoassay, and its biological activity was assessed
by using Y-1 adrenal cells. This investigation showed that the protein secretory
pathway is functional and necessary for the secretion of LT by ETEC. Our findings
have revealed the mechanism for the secretion of LT by ETEC, which previously was
unknown, and provide further evidence of close biological similarities of the LT and
cholera toxin.
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Introduction
Enterotoxigenic Escherichia coli (ETEC) is an enteric pathogen that causes watery
cholera-like diarrhea in animals and humans (1). Infections with ETEC pose a major
health problem in developing countries, accounting for more than 200 million cases
of diarrhea and approximately 380,000 deaths annually among children under 5 years
of age (2). ETEC is also the most common cause of diarrhea among travelers from
industrialized to less developed countries, including military troops on deployment
(2).
ETEC secrete at least one of two types of enterotoxins, known as heat-labile (LT) and
heat-stable enterotoxin, respectively (1, 3). LT is an 84-kDa multimeric protein
comprised of a single A subunit and a pentamer of identical B subunits. The
pentameric B subunit mediates binding to GM1 ganglioside on intestinal epithelial
cells, after which the toxin is internalized and processed. The free A subunit then
catalyses the ADP-ribosylation of Gs , a GTP-binding regulatory protein, leading to
activation of adenylate cyclase, production of excessive amounts of cAMP, disruption
of electrolyte transport across the intestinal lumen, and diarrhea (4). Prostaglandins
and neurotransmitters of the enteric nervous system also play a role in the induction
of fluid secretion by LT (5, 6). Although a great deal is known about the structure and
biological activity of LT, little is known about the mechanism of its secretion by
ETEC.
LT is structurally and biologically related to cholera toxin (CT), the major virulence
determinant of Vibrio cholerae, with over 77% nucleotide (4) and protein homology
(1). Both CT and plasmid-encoded LT are secreted by V. cholerae (7-9), with
secretion taking place in two membrane translocation steps (10). Initially, the A and
B subunits are produced with N-terminal signal peptides that are cleaved during Secdependent translocation across the cytoplasmic membrane via the general secretory
pathway into the periplasmic space (7, 10, 11). Here they undergo folding and
assembly to form the mature holotoxin, which is then transported across the outer
membrane via a type II protein secretion pathway (10) known as the main terminal
branch of the general secretory pathway (12). In contrast to V. cholerae, when the
nonpathogenic laboratory strain of E. coli K-12 is transformed with either an LT- or a
CT-expressing plasmid, the toxins are not efficiently secreted but are retained mainly
within the periplasm, indicating that E. coli K-12 does not possess or express the
pathway used by V. cholerae to secrete these toxins (11, 13, 14). Although E. coli K12 does possess the genes for a type II secretion pathway (15), which appears to play a
role in the secretion of endogenous endochitinase (16), this pathway is evidently
unable to transport CT or LT. This inability to transport CT or LT may be because the
level of expression of the genes encoding this pathway is extremely low under
standard growth conditions (17). Nevertheless, when human isolates of ETEC are
grown in culture, LT is detectable in the supernatant (18, 19), suggesting that ETEC
possesses a functional pathway for the secretion of LT. This suggestion is supported
by other work that shows LT does not remain in the periplasm of these bacteria (20).
In this paper, we report the identification of a type II protein secretion pathway in
ETEC that is absent from E. coli K-12. This secretion pathway is highly homologous
to the pathway responsible for the secretion of CT and LT by V. cholerae and is
required for the secretion of LT by ETEC.
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Materials and Methods
Bacterial Strains, Plasmids, and Growth Conditions.
The bacterial strains and plasmids used in this study are listed in Table 1 (21, 22).
Strains were routinely grown at 37°C in Luria broth (1% tryptone/0.5% yeast
extract/171 mM NaCl) (23) or CAYE medium [2% Casamino acids/0.6% yeast
extract/43 mM NaCl/38 mM K2HPO4/0.25% glucose/0.1% (vol/vol) trace salts
solution consisting of 203 mM MgSO4/25 mM MnCl2/18 mM FeCl3] (24)
supplemented with 100 µg/ml of ampicillin (CSL, Parkville, Victoria, Australia) or
50 µg/ml of kanamycin (Sigma-Aldrich) when necessary. Y1 mouse adrenal cells
(CSL) were maintained in DMEM (23) supplemented with 10% FBS (CSL) and
100 µg/ml of gentamicin (Sigma-Aldrich) and incubated at 37°C in an atmosphere
containing 5% CO2.
Table 1. Bacterial strains and plasmids used in this study
View this table:
[in this window]
[in a new window]
Growth and Viability Studies.
Bacterial growth was assayed by measuring the optical density at OD600 of cultures
every hour by using an Ultrospec III spectrophotometer (Pharmacia). To determine
the extent of cell death (lysis), the Molecular Probes Baclight Live/Dead kit was used
(Molecular Probes). Both live and dead bacteria were labeled simultaneously as
instructed by the manufacturer, after which they were visualized by using a Leica
DM-LB HC microscope with a I3 fluorescein filter (excitation 450-490 nm). The
percentage of live and dead bacteria was ascertained by counting at least 100 cells in
at least five separate random fields.
Preparation and Manipulation of DNA.
Plasmid DNA was isolated by using the Wizard Plus SV DNA Purification System
(Promega). Standard restriction digestion and cloning procedures using DNAmodifying enzymes supplied by Promega or New England Biolabs were used (23).
Electrocompetent E. coli XL1-Blue, H10407, and MT13 cells were obtained by
growing the bacteria to midlogarithmic phase (OD600 0.5-0.8) at 37°C. Cells were
then washed three times with sterile cold 10% glycerol in distilled water and
resuspended in 1/75 the original culture volume. Transformation was achieved by
using a Bio-Rad Gene Pulser and electroporation conditions 1.80 kV, 200 , and
25 µF.
DNA Amplification, Sequencing, and Analysis.
PCR was used to amplify the genes for the putative type II secretion pathway and to
confirm insertional inactivation of gspD by allelic exchange. Genomic DNA of E. coli
H10407 was prepared by the boiling lysis method (23). PCR amplifications were
performed with Vent DNA polymerase (New England Biolabs), which has
proofreading activity, or with AmpliTaq polymerase (Applied Biosystems) in a
reaction volume of 25-50 µl in a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystems). The PCR conditions involved denaturation for 5 min at 94°C,
followed by 35 cycles of 30 sec at 94°C, 30 sec at 55°C, and 1-4 min at 72°C, with a
final extension for 5 min at 72°C.
Nucleotide sequencing was performed by using an ABI PRISM Big Dye Terminators,
Ver. 3.0, Cycle Sequencing Kit (Applied Biosystems). Reactions were analyzed on an
Applied Biosystems ABI PRISM 377 DNA sequencer. Nucleotide sequence data were
edited and assembled into contiguous sequence with the SEQUENCHER program
(Gene Codes, Ann Arbor, MI).
Nucleotide sequence and amino acid similarity searches with sequences in the public
databases were performed by using the BLASTN, BLASTP, and BLASTX programs (25)
available from the National Center for Biotechnology Information web site
(www.ncbi.nlm.nih.gov).
Construction of a Functionally Nonpolar gspD Mutant.
A 1.9-kb fragment containing 1.6 kb of gspD was amplified by PCR from E. coli
H10407 genomic DNA by using oligonucleotide primers P35 (5'ATTGTCGGTTATGCAGCGAAGC) and P109 (5'-TCCACCTTCGAGACTTCC).
The PCR product was ligated into pGEM-T Easy and electroporated into XL1-Blue
to generate pMT37. A SmaI flanked kanamycin-resistance gene was excised from
pUC4-KIXX and inserted into the unique SnaBI site of pMT37 generating plasmid,
pMT39. A 3.3-kb EcoRI fragment of pMT39, which contained the kanamycin-
resistance gene and flanking gspD sequences, was ligated into the EcoRI site of the
temperature sensitive suicide vector pST76-A (22). The resulting construct, pMT42,
was transformed into E. coli H10407 by electroporation. Bacteria were plated on LB
agar containing kanamycin and incubated at 30°C overnight. Transformants of
E. coli H10407 were then incubated at 42°C for 24 h to obtain cells cured of the free
plasmid. Bacterial colonies were replica plated on LB agar containing ampicillin or
kanamycin to identify ampicillin-sensitive kanamycin-resistant transformants. One of
these was E. coli MT13, in which inactivation of gspD by insertion of the kanamycinresistant gene was confirmed by using PCR analysis.
Complementation of the gspD Mutant.
A 5.5-kb fragment containing gspD, gspE, and gspF was amplified by PCR from
E. coli H10407 genomic DNA by using Vent DNA polymerase and oligonucleotide
primers P35 (5'-ATTGTCGGTTATGCAGCGAAGC) and P36 (5'ACTCCTGCAAATTCCAGTTACC). The PCR product was A-tailed with AmpliTaq
polymerase, ligated into pGEM-T Easy behind the lac promoter, and electroporated
into XL1-Blue to generate pMT6. The correct orientation of the insert was verified by
restriction analysis, and its sequence was determined to ensure that fidelity had been
maintained during amplification. pMT6 was digested with NcoI to generate a deletion
derivative, pMT44, in which only gspD was retained on a 3.8-kb fragment. pMT44
was then transformed into E. coli MT13 by electroporation.
Preparation of Culture Supernatants and Periplasmic Extracts.
E. coli H10407, MT13, and MT13(pMT44) were cultured overnight in 5 ml of LB
broth at 37°C in a rotary shaker set at 180 rpm. Five milliliters of prewarmed CAYE
medium in 50-ml Erlenmeyer flasks was then inoculated with 125 µl of the overnight
bacterial cultures and incubated at 37°C with vigorous aeration (220 rpm in a rotary
shaker). To isolate culture supernatants, 4-, 8-, and 24-h cultures were clarified of
cells by centrifugation at 3,000 × g for 20 min at 4°C and by passage through a filter
with a 0.20-µm-diameter pore size (Sartorius).
To prepare periplasmic extracts, bacterial pellets from cultures used to prepare the
supernatants were washed in 1 ml of PBS, pH 7.2 and resuspended in an equal
volume of PBS containing 12,000 units/ml polymyxin B (Sigma-Aldrich). After
incubation with gentle shaking at 37°C for 30 min, the periplasmic extracts were
separated from cell debris by centrifugation at 16,000 × g for 3 min. They were then
filtered as described above, after which the volume of the extract was adjusted to
match that of the culture supernatant. Supernatants and periplasmic extracts were
assayed immediately or stored at 4°C and assayed within 48 h.
The integrity of the supernatant and periplasmic fractions was determined by
assaying these fractions for the periplasmic enzyme alkaline phosphatase by using the
Sigma 104 alkaline phosphatase kit as follows: 0.05 ml of 221 phosphate buffer,
0.05 ml of p-nitrophenyl phosphate (PNPP), and 0.01 ml of either periplasmic or
supernatant extracts were incubated at room temperature for 30 min, after which the
reactions were stopped by the addition of 0.1 ml of 5.0 M NaOH. Hydrolysis of PNPP
was detected at OD420.
Assays for LT.
LT was assayed for receptor binding by enzyme immunoassay (EIA) (26) and for
biological activity by using Y-1 adrenal cells (27). The EIA was modified from a
previously described method (26), with all washes performed three times by using
PBS containing 0.5% (vol/vol) Tween-20 (PBS-T), and all samples, standards, and
antibodies diluted in PBS-T containing 1% (vol/vol) FBS. In addition, all incubations
were at 37°C. Briefly, microtiter plates (Nalge Nunc) were coated with 0.1 µg of GM1
ganglioside (Sigma-Aldrich) in 0.06 M sodium carbonate-bicarbonate buffer (pH 9.6)
and incubated overnight at 4°C. Plates were washed, blocked with 5% (vol/vol) FBS
in PBS for 1 h, and washed again. After initial dilution (culture supernatants 1 in
2 and periplasmic extracts 1 in 5), samples were serially diluted 5-fold and added to
the wells. Standard curves were generated in each assay plate by using 2-fold serial
dilutions of purified LT (Sigma-Aldrich), at a starting concentration of 400 ng/ml.
Plates were incubated for 2 h, washed, and incubated for 1 h with rabbit anti-CT
antiserum (Sigma-Aldrich) diluted 1 in 5,000. After washing, horseradish peroxidaseconjugated sheep anti-rabbit IgG (Sigma-Aldrich), diluted 1 in 1,000, was added and
incubated for 1 h. After further washing, bound antibody was detected by using the
chromogenic substrate, TMB (Kirkegaard & Perry Laboratories). After 3 min at room
temperature, the reaction was stopped by the addition of 2 M H2SO4 (30 µl/well), and
the OD450 was measured in an ELX800 Universal microplate reader (Bio-Tek,
Winooski, VT). Each assay was performed in triplicate on at least three separate
occasions. Regression analysis (R2 > 0.96) was used to generate a standard curve for
determination of LT concentrations in the test samples.
To measure biological activity of the toxin preparations, Y1 mouse adrenal cells were
seeded in 96-well microtiter plates at a concentration of 2 × 104 cells per well. After
48 h, the growth medium was replaced with DMEM supplemented with 1% FBS and
gentamicin (100 µl), containing duplicate samples of bacterial culture supernatant
and periplasmic extracts, serially diluted 2-fold after an initial dilution of 1 in 10. The
cells were incubated for 18 h and then examined for typical rounding by a blinded
operator by using phase-contrast microscopy at a magnification of ×200. The end
point of the assay was defined as the highest dilution that showed more than 50% cell
rounding. Each assay was performed in duplicate on at least two separate occasions.
Two-fold dilutions of purified LT at a starting concentration of 10 ng/ml were assayed
in the same plates and the result used to determine the sensitivity of the assay.
Prevalence of the Type II Secretion Pathway in ETEC Strains.
To determine the prevalence of the novel type II secretion pathway in ETEC strains
of clinical origin, a variety of ETEC isolates of different serotypes and toxin profiles
were examined by PCR for a 1.0-kb fragment of gspD by using primers P78 (5'TTCGGAAATCGCCCGCGTGC) and P109 (5'-TCCACCTTCGAGACTTCC), and
for a 1.2-kb fragment of gspK by using primers P5 (5'GCAGCAGGTGACTAACGGC) and P12 (5'-CAGGGCTTAACCACGGGTC).
Statistical Analysis.
All analyses were performed by using Student's t test. A value of P < 0.05 was taken
to indicate statistical significance.
Nucleotide Sequence Accession Number.
The E. coli H10407 type II secretion locus has been assigned GenBank accession no.
AY056599.
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Results
Identification, Sequencing, and Characterization of the Type II Secretion Genes.
In our work, to characterize pathogenicity islands in rabbit-specific strains of
enteropathogenic E. coli (28), we identified and sequenced a novel type II protein
secretion pathway from one particular strain (GenBank accession no. AF426313).
Using primers generated from this sequence, we found that several other pathogenic
strains of E. coli possessed this pathway, including the prototypic human ETEC strain
H10407. We then determined the sequence of the H10407 chromosome encompassing
the putative genes for this pathway by amplifying and sequencing overlapping
fragments (GenBank accession no. AY056599). Computer analysis of 11,765 bp of
this sequence revealed 13 ORFs, 11 of which were organized in a single operon, with
several of the ORFs overlapping. Because the genetic organization of the type II gene
cluster is relatively well conserved (29), we designated the newly identified genes
gspC-M to comply with current nomenclature (Fig. 1A). Interestingly, a search of the
public databases for homologous sequences revealed that the 5' and 3' ends of the
ETEC type II secretion pathway are also present in the E. coli K-12 strain, MG1655
(15) (Fig. 1B).
Fig. 1. (A) Schematic diagram of the genetic
organization of the chromosomal region
containing the genes (solid arrows) for the
putative type II secretion pathway in ETEC
H10407. *, Insertion site of the K gene in E.
coli MT13. (B) Chromosomal region common
to ETEC strain, H10407 and E. coli K-12
strain, MG1655, with the percentage
View larger version (25K):
identity/similarity of homologous proteins
[in this window]
shown in parentheses. , Percentage
[in a new window]
identity/similarity over 286 amino acid residues;
, percentage identity/similarity over 276 amino
acid residues. (C) Arrangement of the genes
encoding the type II pathway for the secretion
of CT by V. cholerae [accession nos. AF109904
(30), AF055371 (31), and L33796 (10)], and,
in parentheses, the percentage identity/similarity
of homologous proteins of ETEC H10407 and
V. cholerae, TRH7000. §, In V. cholerae
TRH7000, the prepilin peptidase gene,
pilD/vcpD, is not linked to the type II secretion
gene cluster. ¶, There is no homologue of epsN
in the ETEC H10407 type II secretion gene
cluster. (D) Arrangement of the genes encoding
the type II secretion pathway in E. coli K-12,
strain MG1655 [accession no. AE000409 (15)],
and, in parentheses, the percentage
identity/similarity of homologous proteins of
ETEC H10407 and E. coli K-12, strain
MG1655. , NSH, no significant homology.
The first complete ORF of the ETEC type II secretion gene cluster is pppA; PppA is
96% identical to its homologue in MG1655. The next closest homology (46%
identity, 63% similarity) is to VcpD (PilD), the prepilin peptidase required for the
secretion of CT by V. cholerae (30, 31). Downstream of pppA is a small ORF, yghG,
which encodes a putative outer membrane lipoprotein, showing 24% identity and
49% similarity to a conserved hypothetical protein of unknown function from
V. cholerae, but which is not colocated with either vcpD (pilD) or the type II gene
cluster. The proteins encoded by the genes gspC-M, which evidently comprise a single
operon, show the closest homology to the type II secretion proteins of V. cholerae
(10), with sequence identities ranging from 76 to 24% and similarities ranging from
86 to 47% (Fig. 1C).
To determine the prevalence of the type II secretion pathway in clinical isolates of
ETEC, we performed PCR analysis for gspD and gspK on a variety of ETEC strains
of serotypes O6:H16, O8:H9, O20:H-, O25:H-, O25:H42, O75:H4, O78:H11,
O114:H21, O128:H21, O148:H28, O149:H10, O27:H20, O159:H34, and Onontypeable:H9. The test bacteria included 11 that produced LT only, 9 that
produced both LT and heat-stable enterotoxin, and 4 that produced heat-stable
enterotoxin only. All 24 of these strains tested positive for both gspD and gspK.
Determination of the Role of the Type II Pathway in the Secretion of LT by
ETEC Strain H10407.
Because V. cholerae requires a type II protein secretory pathway to secrete CT, we
investigated whether the homologous pathway of E. coli H10407 played a role in the
secretion of LT. To this end, we inactivated the pathway by inserting a kanamycin
resistance gene into gspD by homologous recombination (Fig. 1A). We chose this
gene for inactivation because in Pseudomonas aeruginosa, the homologue of GspD
forms multimeric complexes, is localized within the outer membrane, and is the
putative pore of the type II secretion apparatus (32, 33). Insertional inactivation of
gspD in ETEC H10407 yielded the mutant strain, MT13.
To determine whether MT13 was able to secrete LT, we used an EIA (26) to compare
LT secretion by MT13 with that by E. coli H10407. Comparison of the growth curves
of E. coli H10407 and MT13 showed no difference between them and indicated that
suitable time points to assay the culture medium for LT were 4 h (representing
midlogarithmic phase), 8 h (early-stationary phase), and 24 h (late-stationary phase)
(Fig. 2A). The detection limit of the EIA using purified LT was determined to be
0.4 ng/ml, with a standard curve that was linear between 2.6 and 24.0 ng/ml (data not
shown). This portion of the curve was used to estimate the amount of LT in the test
samples. The results of these assays (Fig. 2B) showed that by 4 h, H10407 had
secreted 58.5 ± 3.7 (mean ± SD) ng/ml of LT into the supernatant, but the amount of
LT in the supernatant of the gspD mutant MT13 was below the level of detection
(<0.4 ng/ml; P = 0.001). At the same time point, however, the amount of LT in the
periplasm of the mutant (31.3 ± 2.6 ng/ml) was approximately 10-fold greater than
that of the wild type (3.4 ± 0.1 ng/ml; P < 0.001) (Fig. 2C). These results indicate that
MT13 could synthesize LT but could not secrete it. By 8 h the amount of LT secreted
into the medium by H10407 had increased to 90.3 ± 7.6 ng/ml, but the amount of LT
in the supernatant of MT13 was still below the level of detection (P = 0.002). At the
same time point the amount of toxin retained in the periplasm of the mutant had fallen
to 1.5 ± 0.1 ng/ml, but was still significantly greater than that found in the wild type,
which was below detectable levels (P = 0.002). The reduction in the amount of LT in
the periplasm of the mutant could be due to proteolytic degradation/turnover (14), as
the A subunit is susceptible to a variety of proteases (11). By 24 h, E. coli H10407 had
secreted 193.6 ± 1.2 ng/ml of LT into the medium. At this time point,
29.1 ± 1.1 ng/ml of LT was detectable in the supernatant for MT13 (P < 0.001), but
the amount of toxin retained in the periplasm of MT13 was still significantly greater
than the wild type (P < 0.005). The integrity of the cell fractions used for these studies
was confirmed by assays for the periplasmic enzyme alkaline phosphatase. These
assays showed no alkaline phosphatase activity in the supernatants from E. coli
H10407 or MT13 at 4 and 8 h and comparable amounts of enzyme activity in
supernatants at 24 h and in the periplasmic extracts from both strains at all time
points.
Fig. 2. (A) Growth curves of E. coli H10407
(interrupted line) and MT13 (solid line) in
CAYE broth. (B) Concentration of LT (detected
View larger version (15K): by *, EIA, and , Y1 adrenal cell assay) in
supernatants of CAYE broth, 4, 8, and 24 h
[in this window]
after inoculation with E. coli H10407 or MT13.
[in a new window]
(C) Concentration of LT (detected by *, EIA,
and , Y1 adrenal cell assay) in centrifuged
bacteria pellets obtained from the broth
cultures depicted in B. Error bars indicate SD.
Complementation of MT13 with a wild-type copy of gspD in trans on plasmid
pMT44 restored LT secretion into culture supernatants to 74% of wild-type levels at
4 h, 76% at 8 h, and 89% at 24 h. These findings are similar to those reported when
an epsD (gspD homologue) mutant of V. cholerae, strain N16961, was transcomplemented by a plasmid clone of wild-type epsD (34). Together, these data show
that the type II secretion pathway is required for the secretion of LT in E. coli
H10407.
The results of the bacterial viability/cell lysis assays showed no difference between
E. coli H10407 and MT13. At 4 and 8 h, there was less than 1% cell lysis, and at
24 h there was 34% cell lysis, which could account for the presence of LT in the
supernatant of MT13.
Biological Activity of LT.
To determine whether the LT produced by the mutant strain MT13 was biologically
active, we used the Y1 adrenal cell bioassay. This assay is based on the observation
that LT causes Y1 adrenal cells to change from their usual elongated spindle
morphology to a more rounded shape. These morphological changes are
indistinguishable from those induced by CT (18) and are concentration dependent. Y1
cells seeded in 96-well microtiter plates were incubated with cell-free supernatants
and periplasmic extracts from E. coli H10407 and MT13. The morphological changes
induced in the Y1 cells by these preparations were identical, indicating that the LT
produced by strain MT13 was biologically active (Fig. 3).
Fig. 3. Phase-contrast photomicrographs of
cultured Y1 adrenal cells 18 h after addition of
a 1 in 40 dilution of cell free CAYE culture
medium from 4-h cultures of (A) E. coli H
10407 or (B) E. coli MT13. C shows the effect
View larger version (82K): of a 1 in 40 dilution of a periplasmic extract
[in this window]
from a 4-h culture of E. coli MT13.
[in a new window]
A semiquantitative assay (27) using Y1 adrenal cells and 2-fold dilutions of the cellfree supernatants and periplasmic extracts was used to determine the amount of LT in
these fractions. Using purified LT, we determined the sensitivity of the assay (amount
of toxin that induced rounding in 50% of the cells) to be 49 pg/ml. This value was
used to estimate the amount of LT in the test samples. The result of this assay
confirmed those of the EIA, namely that the gspD mutant was capable of LT synthesis
but was markedly defective in LT secretion (Figs. 2 and 3).
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Discussion
Heat-labile enterotoxin is a major virulence determinant of ETEC, which must be
released from the bacteria before it can act on host cells. The failure to identify a
protein secretory pathway in ETEC fostered the view that ETEC release LT only
when the bacteria undergo lysis (35). Contradicting this view are the data, confirmed
in this study, that the kinetics of LT secretion by ETEC resemble those exhibited by
V. cholerae when secreting CT, with an increase in toxin concentration that increases
with cell density and less than 10% of toxin retained within the periplasm (8).
Moreover, Horstman and Kuehn (20) demonstrated that in ETEC strain, ETEC
2 (ATCC 43886), LT does not remain in the periplasm but is found associated with
the cell exterior. They propose that in the absence of an identified LT secretory
mechanism, such as a type II secretion pathway, vesicles may play a role in the
secretion of the toxin. Fleckenstein et al. (36) reported a gene, leoA, which is required
for the secretion of LT by E. coli strain H10407. However, LeoA bears no homology
to any known protein involved in the secretion of CT (36), hence its discovery does
not shed any light on the mechanism of LT secretion by ETEC.
In this study, we have shown that the prototypic ETEC strain, H10407, possesses a
protein secretory pathway highly homologous to that used by V. cholerae to secrete
CT, and that genes that encode components of this pathway are present in a wide
variety of ETEC strains, suggesting that this protein secretory pathway is highly
conserved among ETEC strains. Inactivation of this pathway by mutagenesis of the
gspD gene completely ablated LT secretion, yet LT secretion was restored when the
gspD mutant was complemented in trans with a copy of the wild-type gspD gene. We
also showed that the gspD mutant retained the ability to synthesize biologically active
LT, and that the kinetics of toxin release by this strain closely resembled those in LTproducing derivatives of E. coli K-12 (37), which also lack this secretory pathway.
Taken together, these data demonstrate that ETEC possess a type II secretion pathway
that is responsible for the secretion of LT.
Although E. coli K-12 does contain the genes for a complete type II secretion
pathway at minute 74.5 of the genome (15), these genes are not expressed under
standard laboratory conditions (16). The percentage identity between the predicted
proteins of these genes and their homologues present in the type II secretion pathway
of ETEC H10407 ranges from no significant homology to 65% (Fig. 1D).
Interestingly, the E. coli K-12 type II secretion pathway is absent from ETEC H10407
(data not shown). If it were present and functional, it may have complemented the
gspD mutant, as occurred with a strain of P. aeruginosa that retained the capacity for
extracellular secretion despite carrying a mutation in gspD (xcpQ), because it
contained a second gspD homologue, xqhA (38).
An interesting feature of this recently identified ETEC type II secretion pathway is
that remnants of it are present in the E. coli K-12 strain, MG1655, at minute 67 on the
genetic map (15). This finding suggests that K-12 strains may have originally
possessed this pathway and that it was lost during the course of evolution. Francetic et
al. have cloned the pppA gene from E. coli K-12 (39), which encodes prepilin
peptidase (PppA). They determined that it is functional and present in two LTproducing ETEC strains. The putative prepilin peptidase encoded in the type II
secretion locus of ETEC H10407 is 96% identical to PppA from E. coli K-12 and
presumably acts by processing individual components of the pathway before
assembly.
Both LT and CT are encoded by mobile genetic elements. They share over 77%
homology at the nucleotide and amino acid levels for their A and B subunits (7), and
the plasmid-borne genes encoding LT are presumed to have originated from the
ancestral genes for CT (40), which are encoded by a prophage (41). Bacteria with a
type II secretory pathway that acquired toxin-encoding genes by interbacterial
transfer would secrete the toxins relatively efficiently and consequently would be
expected to have a survival advantage over those that do not, because their enhanced
virulence would lead to greater numbers of bacteria being excreted in feces with
improved prospects of their transmission to new hosts.
Acknowledgements
We are indebted to Dr. M. M. Levine, University of Maryland School of Medicine,
and to Dr. H. R. Smith Public Health Laboratory Service, London, U.K., for the gift
of bacterial strains that were used in this study; and to R. Good for advice and
assistance. This study was supported in part by a grant from the Australian National
Health and Medical Research Council. M.T. was supported by an Australian
Postgraduate Research Award.
Abbreviations
CT, cholera toxin; EIA, enzyme immunoassay; ETEC, enterotoxigenic E. coli; LT,
heat-labile enterotoxin.
Footnotes
To whom reprint requests should be addressed. E-mail: [email protected] .
Data deposition: The sequence reported in this paper has been deposited in the
GenBank database (accession no. AY056599).
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
References
1. Nataro, J. P. & Kaper, J. B. (1998) Clin. Microbiol. Rev. 11, 142201[Abstract/Free Full Text].
2. World Health Organization. (1999) Wkly. Epidemiol. Rec. 74, 98-101[Medline] .
3. Gyles, C. L. (1992) Can. J. Microbiol. 38, 734-746[ISI][Medline] .
4. Spangler, B. (1992) Microbiol. Rev. 56, 622-647[Abstract/Free Full Text].
5. Beubler, E. & Schuligoi, R. (2000) Ann. N.Y. Acad. Sci. 915, 339346[Abstract/Free Full Text].
6. Mourad, F. H. & Nassar, C. F. (2000) Gut 47, 382-386[Abstract/Free Full Text].
7. Connell, T. D. , Metzger, D. J. , Wang, M. , Jobling, M. G. & Holmes, R. K.
(1995) Infect. Immun. 63, 4091-4098[Abstract].
8. Hirst, T. R. , Sanchez, J. , Kaper, J. B. , Hardy, S. J. & Holmgren, J. (1984) Proc.
Natl. Acad. Sci. USA 81, 7752-7756[Abstract/Free Full Text].
9. Neill, R. J. , Ivins, B. E. & Holmes, R. K. (1983) Science 221, 289291[Abstract/Free Full Text].
10. Sandkvist, M. , Michel, L. O. , Hough, L. P. , Morales, V. M. , Bagdasarian, M. ,
Koomey, M. , DiRita, V. J. & Bagdasarian, M. (1997) J. Bacteriol. 179, 69947003[Abstract/Free Full Text].
11. Hirst, T. R. & Holmgren, J. (1987) J. Bacteriol. 169, 10371045[Abstract/Free Full Text].
12. Pugsley, A. P. (1993) Microbiol. Rev. 57, 50-108[Abstract/Free Full Text].
13. Michel, L. O. , Sandkvist, M. & Bagdasarian, M. (1995) Gene 152, 4145[CrossRef][ISI][Medline] .
14. Pearson, G. D. & Mekalanos, J. J. (1982) Proc. Natl. Acad. Sci. USA 79, 29762980[Abstract/Free Full Text].
15. Blattner, F. R. , Plunkett, G. , Bloch, C. A. , Perna, N. T. , Burland, V. , Riley, M.
, Collado-Vides, J. , Glasner, J. D. , Rode, C. K. , Mayhew, G. F. , et al. (1997)
Science 277, 1453-1474[Abstract/Free Full Text].
16. Francetic, O. , Belin, D. , Badaut, C. & Pugsley, A. P. (2000) EMBO J. 19, 6697-
6703[CrossRef][ISI][Medline] .
17. Francetic, O. & Pugsley, A. P. (1996) J. Bacteriol. 178, 35443549[Abstract/Free Full Text].
18. Donta, S. T. , Moon, H. W. & Whipp, S. C. (1974) Science 183, 334336[Abstract/Free Full Text].
19. Kunkel, S. L. & Robertson, D. C. (1979) Infect. Immun. 23, 652659[Abstract/Free Full Text].
20. Horstman, A. L. & Kuehn, M. J. (2000) J. Biol. Chem. 275, 1248912496[Abstract/Free Full Text].
21. Evans, D. G. , Evans, D. J., Jr. & Pierce, N. F. (1973) Infect. Immun. 7, 873880[Abstract/Free Full Text].
22. Posfai, G. , Koob, M. D. , Kirkpatrick, H. A. & Blattner, F. R. (1997) J. Bacteriol.
179, 4426-4428[Abstract/Free Full Text].
23. Ausubel, F. M. , Brent, R. , Kingston, R. E. , Moore, D. D. , Seidman, J. G. &
Smith, J. A. (1991) Current Protocols in Molecular Biology (Wiley, New York).
24. Mundell, D. H. , Anselmo, C. R. & Wishnow, R. M. (1976) Infect. Immun. 14,
383-388[Abstract/Free Full Text].
25. Altschul, S. F. , Gish, W. , Miller, W. , Myers, E. W. & Lipman, D. J. (1990) J.
Mol. Biol. 215, 403-410[CrossRef][ISI][Medline] .
26. Ristaino, P. A. , Levine, M. M. & Young, C. R. (1983) J. Clin. Microbiol. 18,
808-815[Abstract/Free Full Text].
27. Sack, D. A. & Sack, R. B. (1975) Infect. Immun. 11, 334336[Abstract/Free Full Text].
28. Tauschek, M., Strugnell, R. A. & Robins-Browne, R. M. (2002) Mol. Microbiol.,
in press.
29. Sandkvist, M. (2001) Infect. Immun. 69, 3523-3535[Free Full Text].
30. Fullner, K. J. & Mekalanos, J. J. (1999) Infect. Immun. 67, 13931404[Abstract/Free Full Text].
31. Marsh, J. W. & Taylor, R. K. (1998) Mol. Microbiol. 29, 14811492[CrossRef][ISI][Medline] .
32. Bitter, W. , Koster, M. , Latijnhouwers, M. , de Cock, H. & Tommassen, J. (1998)
Mol. Microbiol. 27, 209-219[CrossRef][ISI][Medline] .
33. Hardie, K. R. , Lory, S. & Pugsley, A. P. (1996) EMBO J. 15, 978988[ISI][Medline] .
34. Ali, A. , Johnson, J. A. , Franco, A. A. , Metzger, D. J. , Connell, T. D. , Morris, J.
G., Jr. & Sozhamannan, S. (2000) Infect. Immun. 68, 19671974[Abstract/Free Full Text].
35. Wai, S. N. , Takade, A. & Amako, K. (1995) Microbiol. Immunol. 39, 451456[ISI][Medline] .
36. Fleckenstein, J. M. , Lindler, L. E. , Elsinghorst, E. A. & Dale, J. B. (2000) Infect.
Immun. 68, 2766-2774[Abstract/Free Full Text].
37. Hirst, T. R. , Randall, L. L. & Hardy, S. J. (1984) J. Bacteriol. 157, 637642[Abstract/Free Full Text].
38. Martinez, A. , Ostrovsky, P. & Nunn, D. N. (1998) Mol. Microbiol. 28, 12351246[CrossRef][ISI][Medline] .
39. Francetic, O. , Lory, S. & Pugsley, A. P. (1998) Mol. Microbiol. 27, 763775[CrossRef][ISI][Medline] .
40. Yamamoto, T. , Gojobori, T. & Yokota, T. (1987) J. Bacteriol. 169, 13521357[Abstract/Free Full Text].
41. Waldor, M. K. & Mekalanos, J. J. (1996) Science 272, 1910-1914[Abstract].
www.pnas.org/cgi/doi/10.1073/pnas.092152899
This article has been cited by other articles in
HighWire Press-hosted journals: (Search Google Scholar for
Other Citing Articles)
M. D. Bodero, M. C. Pilonieta, and G. P. Munson
Repression of the Inner Membrane Lipoprotein NlpA by Rns in
Enterotoxigenic Escherichia coli
J. Bacteriol., March 1, 2007; 189(5): 1627 - 1632.
[Abstract] [Full Text] [PDF]
J. Yang, D. L. Baldi, M. Tauschek, R. A. Strugnell, and R. M. RobinsBrowne
Transcriptional Regulation of the yghJ-pppA-yghGgspCDEFGHIJKLM Cluster, Encoding the Type II Secretion
Pathway in Enterotoxigenic Escherichia coli
J. Bacteriol., January 1, 2007; 189(1): 142 - 150.
[Abstract] [Full Text] [PDF]
S. F. Sarkar, J. S. Gordon, G. B. Martin, and D. S. Guttman
Comparative Genomics of Host-Specific Virulence in Pseudomonas
syringae
Genetics, October 1, 2006; 174(2): 1041 - 1056.
[Abstract] [Full Text] [PDF]
C. G. Moreira, K. Palmer, M. Whiteley, M. P. Sircili, L. R. Trabulsi, A. F. P.
Castro, and V. Sperandio
Bundle-Forming Pili and EspA Are Involved in Biofilm Formation
by Enteropathogenic Escherichia coli
J. Bacteriol., June 1, 2006; 188(11): 3952 - 3961.
[Abstract] [Full Text] [PDF]
Q. Chen, S. J. Savarino, and M. M. Venkatesan
Subtractive hybridization and optical mapping of the
enterotoxigenic Escherichia coli H10407 chromosome: isolation of
unique sequences and demonstration of significant similarity to
the chromosome of E. coli K-12.
Microbiology, April 1, 2006; 152(Pt 4): 1041 - 1054.
[Abstract] [Full Text] [PDF]
J. K. Crane, S. S. Choudhari, T. M. Naeher, and M. E. Duffey
Mutual Enhancement of Virulence by Enterotoxigenic and
Enteropathogenic Escherichia coli
Infect. Immun., March 1, 2006; 74(3): 1505 - 1515.
[Abstract] [Full Text] [PDF]
K. P. Allen, M. M. Randolph, and J. M. Fleckenstein
Importance of Heat-Labile Enterotoxin in Colonization of the Adult
Mouse Small Intestine by Human Enterotoxigenic Escherichia coli
Strains
Infect. Immun., February 1, 2006; 74(2): 869 - 875.
[Abstract] [Full Text] [PDF]
M. J. Kuehn and N. C. Kesty
Bacterial outer membrane vesicles and the host-pathogen
interaction
Genes & Dev., November 15, 2005; 19(22): 2645 - 2655.
[Abstract] [Full Text] [PDF]
F. Yang, J. Yang, X. Zhang, L. Chen, Y. Jiang, Y. Yan, X. Tang, J. Wang,
Z. Xiong, J. Dong, Y. Xue, Y. Zhu, X. Xu, L. Sun, S. Chen, H. Nie, J. Peng,
J. Xu, Y. Wang, Z. Yuan, Y. Wen, Z. Yao, Y. Shen, B. Qiang, Y. Hou, J. Yu,
and Q. Jin
Genome dynamics and diversity of Shigella species, the etiologic
agents of bacillary dysentery
Nucleic Acids Res., November 7, 2005; 33(19): 6445 - 6458.
[Abstract] [Full Text] [PDF]
R. H. Massol, J. E. Larsen, Y. Fujinaga, W. I. Lencer, and T. Kirchhausen
Cholera Toxin Toxicity Does Not Require Functional Arf6- and
Dynamin-dependent Endocytic Pathways
Mol. Biol. Cell, August 1, 2004; 15(8): 3631 - 3641.
[Abstract] [Full Text] [PDF]
E. M. Berberov, Y. Zhou, D. H. Francis, M. A. Scott, S. D. Kachman, and
R. A. Moxley
Relative Importance of Heat-Labile Enterotoxin in the Causation
of Severe Diarrheal Disease in the Gnotobiotic Piglet Model by a
Strain of Enterotoxigenic Escherichia coli That Produces Multiple
Enterotoxins
Infect. Immun., July 1, 2004; 72(7): 3914 - 3924.
[Abstract] [Full Text] [PDF]
M. A. Soderberg, O. Rossier, and N. P. Cianciotto
The Type II Protein Secretion System of Legionella pneumophila
Promotes Growth at Low Temperatures
J. Bacteriol., June 15, 2004; 186(12): 3712 - 3720.
[Abstract] [Full Text] [PDF]
A. L. Horstman, S. J. Bauman, and M. J. Kuehn
Lipopolysaccharide 3-Deoxy-D-manno-octulosonic Acid (Kdo)
Core Determines Bacterial Association of Secreted Toxins
J. Biol. Chem., February 27, 2004; 279(9): 8070 - 8075.
[Abstract] [Full Text] [PDF]
N. C. Kesty and M. J. Kuehn
Incorporation of Heterologous Outer Membrane and Periplasmic
Proteins into Escherichia coli Outer Membrane Vesicles
J. Biol. Chem., January 16, 2004; 279(3): 2069 - 2076.
[Abstract] [Full Text] [PDF]
A. Ly, J. Henderson, A. Lu, D. E. Culham, and J. M. Wood
Osmoregulatory Systems of Escherichia coli: Identification of
Betaine-Carnitine-Choline Transporter Family Member BetU and
Distributions of betU and trkG among Pathogenic and
Nonpathogenic Isolates
J. Bacteriol., January 15, 2004; 186(2): 296 - 306.
[Abstract] [Full Text] [PDF]
A. A. Rambow-Larsen and A. A. Weiss
Temporal Expression of Pertussis Toxin and Ptl Secretion Proteins
by Bordetella pertussis
J. Bacteriol., January 1, 2004; 186(1): 43 - 50.
[Abstract] [Full Text] [PDF]
I. Belyi, M. R. Popoff, and N. P. Cianciotto
Purification and Characterization of a UDP-Glucosyltransferase
Produced by Legionella pneumophila
Infect. Immun., January 1, 2003; 71(1): 181 - 186.
[Abstract] [Full Text] [PDF]
This Article
Abstract
Full Text (PDF)
Alert me when this article is cited
Alert me if a correction is posted
Services
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My File Cabinet
Download to citation manager
Search for citing articles in:
ISI Web of Science (32)
Request Copyright Permission
Google Scholar
Articles by Tauschek, M.
Articles by Robins-Browne, R. M.
Articles citing this Article
PubMed
PubMed Citation
Articles by Tauschek, M.
Articles by Robins-Browne, R. M.
Pubmed/NCBI databases
Gene
GEO Profiles
Nucleotide Protein
Substance via MeSH
Current Issue | Archives | Online Submission | Info for Authors | Editorial Board | About
Subscribe | Advertise | Contact | Site Map
Copyright © 2002 by the National Academy of Sciences