Download Small, K, Wagener, M and Warren, ST: Isolation and characterization of the complete mouse emerin gene. Mammalian Genome 8:337-341 (1997).

Mammalian Genome 8, 337–341 (1997).
© Springer-Verlag New York Inc. 1997
Isolation and characterization of the complete mouse emerin gene
Kersten Small, Maylene Wagener, Stephen T. Warren
Howard Hughes Medical Institute and Departments of Biochemistry and Pediatrics, Emory University School of Medicine, Room 4035 Rollins
Research Center, 1510 Clifton Road, Atlanta, Georgia 30322, USA
Received: 1 December 1996 / Accepted: 12 January 1997
Abstract. Emery-Dreifuss muscular dystrophy (EMD) is an Xlinked recessive disorder associated with muscle wasting, contractures, and cardiomyopathy. The responsible emerin gene has recently been identified and found to encode a serine-rich protein
similar to lamina-associated protein 2 (LAP2), although the disease mechanism remains obscure. In order to pursue the pathophysiology of this disorder, we report here the isolation and characterization of the complete mouse emerin gene. The emerin
cDNA was isolated from murine strain BALB/c, and the emerin
gene was isolated from strain 129. The 2.9-kb mouse emerin gene
was completely sequenced and found to be composed of 6 exons
and encode a protein 73% identical to that of the human protein.
Key similarities with LAP2 were found to be conserved, including
critical LAP2 phosphorylation sites. Examination of the murine
promoter revealed three previously unrecognized cAMP response
elements (CRE) conserved between human and mouse. While
Northern analysis shows emerin to be widely expressed in the
mouse, as it is in humans, these promoter elements may indicate
cAMP responsiveness. These data provide the necessary elements
to further investigate EMD in a murine system.
ficiency and to develop a mouse model for EMD, we report here
the isolation and characterization of the complete mouse emerin
gene.
Materials and methods
Isolation of cDNA and genomic clones. A mouse skeletal muscle
lgt10 cDNA library (Clontech) was screened as described by Price et. al.
(1996). The probe used in this experiment was the human emerin cDNA
generated by RT-PCR (Bione et al. 1994). 43 cDNA clones were identified
in this screen, and the most strongly hybridizing clone, 3–1, was isolated
and sequenced. RT-PCR was performed with the GeneAmp RNA PCR kit
(Perkin Elmer). Each RT-PCR reaction contained ∼500 ng mouse RNA
isolated from mouse embryonic stem cells (Trizol Reagent, Gibco) as
template, with random hexamers supplied in the kit used for first-strand
synthesis. A full-length cDNA representing the entire coding region of
mouse emerin was generated by RT-PCR with primers R30: 58 CGGTTGGTTTCTTGGGCCCTGTCTG and 3R: 58 TCCATGAAAGCAAAGCCAGGGTG. A mouse genomic 129 P1 library was screened, with
primers R2: 58 GGGTATTGGTTTTAGAGC and 3R (Genome Systems,
Inc.). All PCR amplifications were performed in a Perkin-Elmer 9600
thermal cycler for 35 cycles (denaturation, 45 s, 95°C; annealing, 45 s,
60°C or 65°C; extension, 1 min, 72°C).
Introduction
Nucleotide sequencing. Double-stranded sequencing of plasmid subEmery-Dreifuss muscular dystrophy (EMD) is an X-linked recessive disorder characterized by progressive muscle wasting and
weakness, contractures of the elbows, Achilles tendons, and postcervical muscles, and cardiomyopathy (McKusick 1994; Hopkins
and Warren 1993). This disorder maps to human Xq28 (Consalez
et al. 1991), and the responsible gene has recently been identified
(Bione et al. 1994). A number of unique and typically null mutations have been documented within the emerin gene among patients with the classic phenotype and X-linked inheritance (Bione
et al. 1995; Nigro et al. 1995; Klauck et al. 1995).
The human emerin gene is ubiquitously expressed and encodes
a serine-rich protein that localizes to the nuclear membrane in both
skeletal muscle and heart (Nagano et al. 1996; Manilal et al. 1996).
The predicted emerin protein shows structural similarity with two
regions of the nuclear protein thymopoietin (Harris et al. 1994).
Recently, the rat homolog of b-thymopoietin has been determined
to be LAP2, an integral protein of the inner nuclear membrane
(Furukawa et al. 1995). LAP2 has been shown to bind directly to
both lamin B1 and chromosomes in a mitotic phosphorylationregulated manner (Foisner and Gerace 1993). As LAP2 is thought
to be involved in nuclear envelope assembly and/or anchoring, it is
unclear how a deficiency of emerin, which displays both structural
and cellular similarities with LAP2, leads to a form of muscular
dystrophy. In order to pursue the pathophysiology of emerin deCorrespondence to: S.T. Warren
The nucleotide sequence data reported in this paper have been submitted to
GenBank and have been assigned the accession number U79753.
clones was performed on an ABI 373A automated DNA sequencer with the
Taq DyeDeoxy Terminator Cycle Sequencing Kit (ABI) as described by
the manufacturer. Primers used to obtain the initial sequence from the ends
of the inserts were pBluescript vector primers SK and KS, and the remainder of the inserts were sequenced by primer walking. DNA and protein
sequences were analyzed with GeneWorks Version 2.3.1 software (IntelliGenetics, Inc.). Nucleotide and protein DataBanks were searched with the
Blast computer program, PROSITE was used to search for motifs, and
transcription factor binding sites were identified with the WWW Signal
Scan service.
Northern blot. A mouse multiple tissue Northern blot was purchased
from Clontech. Hybridizations were performed at 50°C according to manufacturer’s recommendations. Purified clone 3-1 cDNA insert was labeled
by random priming (Megaprime, Amersham) and used as the probe.
Results
In order to identify the mouse emerin gene, we screened a mouse
skeletal muscle cDNA library (Clontech), using the human emerin
cDNA as a probe. In this screen, one strongly hybridizing clone
(3-1) was isolated and sequenced and found to contain a sequence
homologous to both human and rat emerin cDNAs (Bione et al.
1994; unpublished data, Genbank accession number X98377).
Clone 3-1 was 1160 bp in length and had a large open reading
frame (ORF) encoding a polypeptide of 257 amino acids; however,
absence of a start codon and comparison of this sequence with both
rat and human cDNAs suggested that this clone lacked the 58-UTR
and the first 5 bp of coding sequence. To generate a full-length
338
K. Small et al.: Mouse emerin gene
Fig. 1. Nucleotide sequence of
the mouse emerin gene. The
exonic sequence is in capital
letters. Primers R30 and 3R,
used to amplify the emerin
cDNA by RT-PCR, are
indicated with arrows. ATG
start, TAA stop, and the
polyadenylation signal are in
bold and underlined.
K. Small et al.: Mouse emerin gene
339
cDNA, RT-PCR was subsequently performed on RNA isolated
from mouse embryonic stem cells with primer R30, derived from
mouse genomic sequence (described below) that had homology
with the 58 end of the rat cDNA, and primer 3R, derived from
sequence corresponding to the 38 end of cDNA clone 3-1 (Fig. 1).
Sequence analysis of this RT-PCR product revealed a 1270-bp
cDNA containing a 106-bp 58-UTR (beginning within the interval
that defines the start of transcription for both rat and human cDNAs), a single large ORF encoding a 259-amino acid polypeptide,
and a 387 bp 38-UTR. Within the coding region the mouse emerin
nucleotide sequence was 95% and 78% identical to rat and human
emerin genes, respectively. The high degree of sequence similarity
between mouse and rat emerin was also observed within the untranslated regions of these cDNAs, with 92% identity in the 58UTR and 89% identity in the 38-UTR. Mouse and human 58- and
38- UTRs were less similar, showing 43% and 40% identity, respectively. Northern blot analysis with clone 3–1 as a probe revealed an mRNA expression pattern similar to human emerin, with
an approximately 1.3-kb transcript present in all tissues analyzed,
including skeletal muscle and heart (Fig. 2).
Genomic emerin clones were also isolated by screening a
mouse 129 genomic P1 library with primers derived from clone
3-1. Southern blot hybridization with cDNA clone 3-1 as a probe
localized the emerin gene to a 4.0-kb HindIII fragment in mouse
129 genomic DNA and in P1 clones (data not shown), and this
fragment was subsequently subcloned into pBluescript (Stratagene) and sequenced (Fig. 1). In addition, X Chromosome (Chr)
localization of P1 clones was confirmed by Southern blot hybrid-
ization of a P1 DNA fragment to mouse genomic DNA that
showed the appropriate hybridization intensities in both male (that
is, 1X) and female mouse DNAs (that is, 2X; data not shown).
Mouse cDNA (of strain BALB/c) and exonic genomic sequences (of strain 129) were identical except for a single base (G
or A) in the wobble position of codon 11 that did not change the
amino acid sequence. All splice sites contained the canonical GT
and AG dinucleotides at the intron borders and matched consensus
splice site sequences to varying extents. The 3938 bp of genomic
sequence showed that the mouse emerin gene spanned approximately 2900 bp and was organized into six small exons interrupted
by five introns, similar to the structure of the 2100-bp human gene
(Fig. 3A). The difference in size between these genes is primarily
owing to the size of the 4th intron, which is 385 bp in human and
1001 bp in mouse. The coding regions of exons 1, 3, and 4 are
identical in size in both human and mouse genes. The remaining
exons differ in size by 3 bp (exons 2 and 5) or 15 bp (exon 6), and
these differences account for the gaps seen in mouse/human
emerin amino acid alignment (Fig. 4).
The 58 promoter region of the emerin gene displayed a number
of potential transcription factor binding sites (WWW Signal Scan).
When compared with the human emerin promoter region, both
genes have one CAAT box and three cAMP reponsive elements
(CRE) in the first 200 bp of 58 flanking sequence, and both genes
lack TATA boxes. Three CRE sites, with the consensus binding
sequence of TGACG, were found within the first 100 bp of emerin
58 flanking sequences, and two of these sites are separated by
exactly 17 bp in both human and mouse sequences (Fig. 3B).
The nucleotide sequence of the mouse emerin cDNA predicts
a polypeptide of 259 amino acids with a molecular weight of 29.4
kDa that is 93% and 73% identical (95% and 79% similar) to rat
and human emerin proteins, respectively (Fig. 4). Both mouse and
rat emerin proteins are slightly larger than human emerin, with
four additional amino acids at the C-terminus of the protein. Consistent with the high degree of similarity between emerin homologs, mouse emerin is serine rich and shares regions of structural similarity with thymopoietin proteins including the highly
hydrophobic putative transmembrane domain at the C-terminus
Fig. 3. (A) Comparison of human and mouse emerin genes. The mouse
gene is shown on top, and human emerin is shown below. Boxes are exons
with the start (ATG) and stop (TAA/TAG) codons for translation shown.
The numbers above and below indicate the sizes of each intron and exon,
respectively. (B) Comparison of mouse and human emerin promoter re-
gions. The 200 bp of 58 flanking sequences for both mouse and human
emerin genes are shown with the 38 end of each sequence corresponding to
a region that encompasses the start of transcription for each gene. Potential
transcription factor binding sites are also indicated: CAAT boxes are underlined, and CREs are boxed.
Fig. 2. Northern analysis
of the mouse emerin
gene. Clone 3-1 DNA
was used to probe a
multiple tissue Northern
blot (Clontech)
containing ∼2 mg each
polyA+ RNA from
various tissues.
340
K. Small et al.: Mouse emerin gene
Fig. 4. Amino acid alignment of mouse, rat, and
human emerin proteins. Identical amino acids are
boxed. The regions of similarity with
thymopoietins/LAP2 are indicated by lines, and
the hydrophobic domain is indicated by a dashed
line. Conserved potential phosphorylation sites are
also indicated: arrows, protein kinase C; asterisks,
casein kinase II, and plus signs, tyrosine kinase.
(Fig. 4). Compared with mouse thymopoietins, amino acids 3–44
of mouse emerin are 50% identical (64% similar) to amino acids
110 to 151 within the common N-terminal portion of all mouse
thymopoietin isoforms, and amino acids 222–255 are 26% identical (44% similar) to a C-terminal region, encoded by exon 10,
within the b-, g-, d-, and e-isoforms (Berger et al. 1996).
Several potential protein phosphorylation sites were also identified after a search of the Prosite Data bank. Three tyrosine kinase
phosphorylation sites as well as five sites each for protein kinase
C and casein kinase II were found to be conserved among all three
emerin homologs (Fig. 4). Furthermore, the three most N-terminal
phosphorylation sites predicted for emerin are also present in thymopoietins (Fig. 3). Two N-glycosylation and two N-myristolation
sites were also identified; however, when compared with human
emerin, these sites were not conserved.
Discussion
In this report we describe the complete sequence of the mouse
emerin gene. Nucleotide sequence analysis revealed a high degree
of similarity between mouse, rat, and human cDNAs. Exon/intron
organization as well as potential transcription factor binding sites
in the promoter regions of each gene were found to be highly
conserved between mouse and human emerin. We uncovered three
cAMP response elements (CREs) within the murine promoter and
showed these to be conserved with three previously unnoticed
CREs within the human promoter. Interestingly, an interval of 17
bp is conserved between two CREs of both species, as is the
general location of the elements relative to the start of transcription. Although we confirmed by Northern analysis that the mouse
emerin gene is widely expressed throughout the body, the potential
now exists for cyclic AMP (cAMP) modulation of emerin expression (Faisst and Meyer 1992; Borrelli et al. 1992).
Mouse emerin encodes a highly conserved, serine-rich 259amino acid protein that shows structural similarity with thymopoietin/LAP2. The rat homolog of b-thymopoietin, LAP2, is an integral nuclear membrane protein that binds directly to both lamin B1
and chromosomes in a mitotic phosphorylation-regulated manner
(Furukawa et al. 1995; Foisner and Gerace 1993). Localization
studies of LAP2 deletion mutants have provided evidence that the
hydrophobic C-terminus of LAP2 is a transmembrane-spanning
domain that localizes the hydrophilic N-terminal portion of the
protein to the nucleoplasm (Furakawa et al. 1995). Emerin is a
primarily hydrophilic protein with a hydrophobic, C-terminal domain, similar to that of LAP2. Moreover, immunofluorescence
microscopy showed that emerin also localizes to the nuclear membrane (Manilal et al. 1996; Nagano et al. 1996). Taken together,
these data suggest a similar association of LAP2 and emerin with
the nuclear membrane. The presence of several potential phosphorylation sites also supports a role for emerin as a phosphoprotein.
This is supported by both the documented phosphorylation of
LAP2 and the 34-kDa mass of human emerin protein in Western
blots, as opposed to the predicted 29-kDa protein, which could
result from emerin phosphorylation (Manilal et al. 1995; Nagano et
al. 1996). Indeed, three predicted phosphorylation sites present in
the N-terminal region of emerin are conserved and also found in
LAP2, suggesting that the N-terminal domains of these proteins
also share a common function.
Unlike dystrophin and the dystrophin-related glycoproteins,
emerin appears not to be a cytoskeletal protein (Ozawa et al.
1995). Rather, emerin is associated with the nuclear membrane and
shares attributes with LAP2, which appears to link lamin B1 and
mitotic chromosomes (Foisner and Gerace 1993). If emerin functions similarly, a novel mechanism of neuromuscular disease will
be uncovered. Toward this end, the complete murine emerin gene
sequence is described here. The conserved nature of the mouse
protein to human emerin and the precise conservation of key regions of LAP2 similarity support a LAP2-like function for emerin.
Further, the characterization of the murine promoter region of
emerin identified three CREs, suggesting the potential for cAMP
modulation of emerin expression. Moreover, the characterization
of the complete emerin gene from the mouse strain 129 will lead
to the development of a mouse emerin knock-out, a potential animal model for EMD that should greatly assist further study into
EMD and emerin function.
Acknowledgments. We thank Lisa Lakkis for review of the manuscript.
This work was supported, in part, by a grant from the Muscular Dystrophy
Association. S.T. Warren is an investigator, and K. Small is an associate of
the Howard Hughes Medical Institute.
References
Berger R, Theodor L, Shoham J, Gokkel E, Brok-Simoni F, Avraham KB,
Copeland NG, Jenkins NA, Rechavi G, Simon AJ (1996) The charac-
K. Small et al.: Mouse emerin gene
terization and localization of the mouse thymopoietin/lamina-associated
polypeptide 2 gene and its alternatively spliced products. Genome Res 6,
361–370
Bione S, Maestrini E, Rivella S, Mancini M, Regis S, Romeo G, Toniolo
D (1994) Identification of a novel X-linked gene responsible for EmeryDreifuss muscular dystrophy. Nature Genet 8, 323–327
Bione S, Small K, Aksmanovic VMA, D’Urso M, Ciccodicola A, Merlini
L, Morandi L, Kress W, Yates JRW, Warren ST, Toniolo D (1995)
Identification of new mutations in the Emery-Dreifuss muscular dystrophy gene and evidence for genetic heterogeneity of the disease. Hum
Mol Genet 4, 1859–1863
Borrelli E, Montmayeur JP, Foulkes NS, Paulo SC (1992) Signal transduction and gene control: the cAMP pathway. Crit Rev Oncog 3, 321–
338
Consalez GG, Thomas NST, Stayton C, Knight SJL, Johnson M, Hopkins
LC, Harper PS, Elsas LJ, Warren ST (1991) Assignment of EmeryDreifuss muscular diptrophy to the distal region of xq28: the results of
a collaborative study. Am J Hum Genet 48, 468–480
Faisst S, Meyer S (1992) Compilation of vertebrate-encoded transcription
factors, Nucleic Acids Res 20, 3–26
Foisner R, Gerace L (1993) Integral membrane proteins of the nuclear
envelope interact with lamins and chromosomes, and binding is modulated by mitotic phosphorylation. Cell 73, 1267–1279
Furukawa K, Pante N, Aebi U, Gerace L (1995) Cloning of a cDNA for
lamina-associated polypeptide 2 (LAP2) and identification of regions
that specify targeting to the nuclear envelope. EMBO J 14, 1626–1636
Harris CA, Andryuk PJ, Cline S, Chan HK, Natarajan A, Siekierka JJ,
Goldstein G (1994) Three distinct human thymopoietins are derived
341
from alternatively spiced mRNAs. Proc Natl Acad Sci USA 91, 6283–
6287
Hopkins LC, Warren ST (1993) In Handbook of Clinical Neurobiology, LP
Rowland, S DiMauro (eds) (Amsterdam: Elsevier Publishers) pp 145–
160
Klauck SM, Wilgenbus P, Yates JRW, Muller C, Poutska A (1995) Identification of novel mutations in three families with Emery-Dreifuss muscular dystrophy. Hum Mol Genet 4, 1853–1857
Manilal S, thi Man N, Sewry CA, Morris GE (1996) The Emery Dreifuss
muscular dystrophy protein, emerin, is a nuclear membrane protein.
Hum Mol Genet 5, 801–808
McKusick VA (1994) Mendelian Inheritance in Man (Baltimore, Md.:
Johns Hopkins University Press)
Nagano A, Ritsuko K, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi
YK, Tsukahara T, Arahata K (1996) Emerin deficiency at the nuclear
membrane in patients with Emery-Dreifuss muscular dystrophy. Nature
Genet 12, 254–259
Nigro V, Bruni P, Ciccodicola A, Politano L, Nigro G, Puliso G, Cappa V,
Covone AE, Romeo G, D’Urso M (1995). SSCP detection of novel
mutations in patients with Emery-Dreifuss muscular dystrophy: definition of a small C-terminal region required for emerin function. Hum.
Mol Genet 4, 2003–2004
Ozawa E, Yoshida M, Suzuki A, Mizuno Y, Hagiwara Y, Noguchi S
(1995) Dystrophin-associated proteins in muscular dystrophy. Hum Mol
Genet 4, 1711–1716
Price DK, Zhang F, Ashley CT, Warren ST (1996) The chicken FMR1
gene is highly conserved with a 58-untranslated repeat and encodes an
RNA-binding protein. Genomics 31, 3–12.