Download Ceman, S, O Donnell, WT, Reed, M, Patton, S, Pohl, J and Warren, ST: Phosphorylation regulates translation state of FMRP-associated polyribosomes. Human Molecular Genetics 12:3295-3305 (2003).

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Cellular differentiation wikipedia , lookup

Extracellular matrix wikipedia , lookup

Protein moonlighting wikipedia , lookup

Cell culture wikipedia , lookup

Cytokinesis wikipedia , lookup

Cell encapsulation wikipedia , lookup

Organ-on-a-chip wikipedia , lookup

Signal transduction wikipedia , lookup

Ribosome wikipedia , lookup

Amitosis wikipedia , lookup

List of types of proteins wikipedia , lookup

Phosphorylation wikipedia , lookup

Protein phosphorylation wikipedia , lookup

Transcript
Human Molecular Genetics, 2003, Vol. 12, No. 24
DOI: 10.1093/hmg/ddg350
3295–3305
Phosphorylation influences the translation
state of FMRP-associated polyribosomes
Stephanie Ceman1,{,{, William T. O’Donnell1,{, Matt Reed2, Stephana Patton1,
Jan Pohl2 and Stephen T. Warren1,*
1
Department of Human Genetics and 2Microchemical Facility, Emory University School of Medicine,
Atlanta, GA 30322, USA
Received July 28, 2003; Revised and Accepted October 6, 2003
Fragile X mental retardation protein, FMRP, is absent in patients with fragile X syndrome, a common form of
mental retardation. FMRP is a nucleocytoplasmic RNA binding protein that is primarily associated with
polyribosomes. FMRP is believed to be a translational repressor and may regulate the translation of certain
mRNAs at the base of dendritic spines in neurons. However, little is known about the regulation of FMRP.
Using mass spectrometry and site-directed mutagenesis, we show that FMRP is phosphorylated between
residues 483 and 521, N-terminal to the RGG box, both in murine brain and in cultured cells. Primary
phosphorylation occurs on the highly conserved serine 499, which triggers hierarchical phosphorylation of
nearby serines. FMRP is phosphorylated within 2–4 h of synthesis, however, phosphorylation has no effect
on the half-life of the protein. In contrast to the Drosophila ortholog dFxr, the phosphorylation status
of mammalian FMRP does not influence its association with specific mRNAs in vivo. However, we find
unphosphorylated FMRP associated with actively translating polyribosomes while a fraction of phosphorylated FMRP is associated with apparently stalled polyribosomes. Our data suggest that the phosphorylation may regulate FMRP and that the release of FMRP-induced translational suppression may involve a
dephosphorylation signal.
INTRODUCTION
Fragile X syndrome is one of the most common forms of
inherited mental retardation, affecting 1/4000 males and 1/8000
females (reviewed in 1). As its name would suggest, individuals
with fragile X syndrome have a visible constriction at the distal
end of the X chromosome (2,3). This region was positionally
cloned and shown to contain the FMR1 gene (reviewed in 1).
Expansion of a CGG repeat in the 50 UTR causes transcriptional
silencing of FMR1 in fragile X syndrome (4,5). Thus, affected
individuals are unable to express the protein product of the
FMR1 locus, FMRP, indicating a role for FMRP in normal
cognitive function.
FMRP has RNA-binding motifs including two hnRNP
K-protein homology (KH) domains and an RGG box (6,7).
FMRP binds mRNA both in vitro as a purified recombinant
protein (8,9) and in cells as identified by co-immunoprecipitation
experiments (10). Recently the identities of the in vivo associated
mRNAs to which FMRP binds have been elucidated (11–14).
FMRP associates with the heavy-sedimenting, polyribosome
structures that contain mRNAs bound by multiple ribosomes
(15–18). This ribosome association was demonstrated as
critical to FMRP function by the severity of the fragile X
phenotype observed in a patient with a I304N mutation whose
FMR protein no longer associates with ribosomes (19,20).
These observations led to the hypothesis that FMRP modulates
the translation of its associated mRNAs. Indeed, mRNAs
found associated with FMRP by co-immunoprecipitation
studies also had altered association with polyribosomes in
the absence of FMRP (12). In addition, over-expression of
FMRP suppresses translation of mRNAs both in vitro and
in vivo (21–23), suggesting that FMRP interacts with the translational apparatus to modulate protein expression of associated
RNAs.
*To whom correspondence should be addressed at: Room 305E Whitehead Building, Department of Human Genetics, 615 Michael St, Atlanta,
GA 30322, USA. Tel: þ1 4047275979; Fax: þ1 4047273949; E-mail: [email protected]
{
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
{
Present address:
Department of Cell and Structural Biology, University of Illinois, Urbana, IL 61801, USA.
Human Molecular Genetics, Vol. 12, No. 24 # Oxford University Press 2003; all rights reserved
3296
Human Molecular Genetics, 2003, Vol. 12, No. 24
Post-translational modifications, in particular phosphorylation,
have been shown to modulate nuclear shuttling, RNA binding
and protein–protein interactions in proteins with structural features similar to FMRP (24–27 and reviewed in 28,29). Recently,
the Drosophila ortholog of FMRP, dFxr, was shown to be
phosphorylated on a highly conserved serine (30). We show
here that murine FMRP is primarily phosphorylated on this same
conserved serine residue (numbered as 499 in mouse) both in
cultured cells and in the mouse brain. In vitro phosphorylation of
purified recombinant dFxr increased its ability to associate with
homopolymers of RNA (30). However, we found that unlike
the Drosophila ortholog, the phosphorylation state of serine 499
has no effect on the ability of mammalian FMRP to associate
with RNAs known to bind FMRP in vivo. Rather, we found
evidence that phosphorylated FMRP may be associated with
stalled ribosomes suggesting that dephosphorylation may trigger
the translation of FMRP-associated messages.
RESULTS
FMRP is phosphorylated on multiple residues both
in cultured cells and in brain
To determine whether mammalian FMRP is a phosphoprotein,
we metabolically-labeled cells with [32P]orthophosphoric acid
and isolated Flag-tagged FMRP by immunoprecipitation
with an anti-Flag antibody as described previously (10). We
observed an 80 kDa phosphoprotein in the Flag-FMRPexpressing transfectant that was not present in the empty
vector cell line (Fig. 1A) and confirmed that this was FMRP by
western blotting (data not shown). To ascertain which amino
acid was the kinase substrate, we gel-purified phospho-FMRP,
performed phosphoamino acid analysis and found that FMRP
was phosphorylated primarily on serine residues (Fig. 1B). This
observation was confirmed in a number of other cultured
mammalian cell lines including Cos 7, NIH 3T3 and HeLa cells
(data not shown). To identify which of the 47 serines in FMRP
is phosphorylated, we used the mass spectrometry-based
method of precursor ion scanning where tryptic peptides are
ionized and analyzed on a triple quadrupole mass spectrometer
(31). FMRP was isolated from a large-scale purification,
digested with trypsin and an aliquot was analyzed by MALDITOF, confirming the band as FMRP (data not shown).
Precursor ion scanning of the tryptic digest reproducibly
showed phosphorylation in a single region of FMRP (amino
acids 483–521) with one, two or three phosphoresidues
(Table 1, top). The data from the precursor ion scan narrowed
the region of FMRP-phosphorylation to a 38 amino acid
peptide located between the nuclear export sequence and the
RGG box that contains seven serines shown in bold (Fig. 2A).
To ask if the above data could be generalized to the mammalian
brain, we isolated FMRP from murine brains and submitted it for
phosphoamino acid analysis by MS/MS. Three phosphopeptides
were identified by mass spectrometry and were identical to or
within the phosphopeptides identified by PIS (Table 1, bottom).
Although there were insufficient ions to identify the exact
phospho-residue by further MS/MS fragmentation, the pattern of
unphosphorylated subfragments from each of these peptides
allowed us to further narrow the region of phosphorylation.
Figure 1. Murine FMRP is phosphorylated primarily on serine. (A) An emptyvector expressing L-M(TK-) cell (VC) and a Flag-FMRP expressing transfectant (WT) were metabolically-labeled with [32P]orthophosphoric acid, immunoprecipitated with anti-Flag M2 matrix, resolved on a 7.5% SDS–PAGE and
subjected to autoradiography. (B) The band at 80 kDa was isolated and subjected to phosphoamino acid analysis. Ser, serine; thr, threonine; tyr, tyrosine.
Table 1. FMRP phosphopeptides identified by PIS and MS/MS
Residues
Sequence
(A) PIS data from transfected L-M(TK-)cells
484–506 GPGYTSGTNSEASNASETESDHR
483–506 RGPGYTSGTNSEASNASETESDHR
483–506 RGPGYTSGTNSEASNASETESDHR (2x)
484–521 GPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER
484–521 GPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER (2x)
483–521 RGPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER
483–521 RGPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER (2x)
483–521 RGPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER (3x)
(B) MS/MS from murine brain FMRP
483–521 RGPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEER
483–512 RGPGYTSGTNSEASNASETESDHRDELSDW
483–512 RGPGYTSGTNSEASNASETESDHRDELSDW (2x)
(A) Tryptic phosphopeptides of FMRP purified from L-M(TK-) cells and
detected by precursor ion scanning. (B) Phosphopeptides from murine brain
detected by tandem mass spectrometry. All species contain a single
phosphorylation site unless otherwise indicated in bold.
Thus, in mouse brain, S496, S499, T501 and S503 are possible
kinase substrates (Fig. 2A, arrows). This region of FMRP,
phosphorylated both in cultured mammalian cells and in brain,
contains serine 499, the highly conserved residue found
phosphorylated in the Drosophila ortholog dFxr (30).
To examine if serine 499 is a primary phosphorylation site,
we used site-directed mutagenesis to replace this serine with
either an alanine (Ala), which cannot be phosphorylated or an
aspartic acid (Asp), which mimics phosphorylation (32). These
stable transfectants do not over-express FMRP with each line
expressing nearly equivalent amounts of modified FMRP, in
levels consistent with endogenous FMRP levels in other cell
types. Using [32P]orthophosphoric acid label, the alaninesubstituted FMRP was virtually unphosphorylated (Fig. 2B).
However, the aspartic acid substitution partially restored
phosphorylation, even though aspartic acid itself is not a
substrate for a kinase. This observation suggests that a negative
charge at position 499 triggers phosphorylation of a second site
within the 496–503 region that flanks the primary phosphorylation site at 499. Western blot analysis shows that equal
amounts of the flag-encoded transgenes were analyzed (Fig. 2B,
lower). These data demonstrate that serine 499 is the primary
phosphorlation site and that asp substitution for this serine
is recognized by the cell as phosphoserine triggering
hierarchical phosphorylation of nearby residues.
Human Molecular Genetics, 2003, Vol. 12, No. 24
3297
Figure 2. Flag-Fmr peptide 491–529 is the primary phosphopeptide in cultured cells and in brain. (A) Schematic of the domain structure of FMRP. Peptide 483–521
was identified by PIS as the primary phoshorylated fragment in cultured cells. Serines are in bold and arrows show the four possible sites of phosphorylation in
mouse brain identified by uLC/MS/MS. The numbering indicates amino acid position. (B) Stably-transfected murine fibroblast L-M(TK-) cells expressing the
vector alone (VC), wild type Fmr1 (WT), the alanine substitution at residue 499 (Ala) or the aspartic acid substitution at 499 (Asp) were labeled with
[32P]orthophosphoric acid and immunoprecipitated with anti-Flag M2 matrix. The immunoprecipitations were then split and subjected to autoradiography (upper
panel) or to western blot analysis with the anti-FMRP antibody MAb1A3 (lower panel).
Serine 499 does not affect the half-life of FMRP
PEST sequences, which are stretches of proline (P), glutamic
acid (E), serine (S) and threonine (T), can mediate the rapid
destruction of proteins with short half-lives and can be
modulated by phosphorylation (33–37). The region of FMRP
that is phosphorylated lies within a potential PEST sequence
(www.at.embnet.org/embnet/tools/bio/PESTfind/). To establish whether or not FMRP degradation was modulated by a
PEST sequence, we determined the half-life of the wild-type
transfectant and the Fmr proteins with substitutions for serine
499 by pulse-chase analysis. We found that the half-life of
FMRP, regardless of the amino acid at position 499, is 30 h
in the L-M (TK-) cells (Fig. 3A). Thus, FMRP is a long-lived
protein and its half-life appears unchanged by phosphorylation
at serine 499 in these cells.
Comparison of FMRP at 36 h to the newly-synthesized
FMRP at the pulse-point suggests a small difference in the size
of the protein (Fig. 3A). Newly synthesized FMRP appears to
migrate slightly faster than it does at later time points.
Phosphorylation can increase the size of a protein by 79
daltons for each site (31). In addition, a small reduction in
electrophoretic mobility of phosphorylated proteins has been
previously observed (38). We determined when phosphorylation was occurring by analyzing the migration of FMRP during
shorter chase times and on a lower percentage acrylamide gel.
In Figure 3B, FMRP increased in size after 2 h of chase. We
confirmed this in an independent experiment where the pulse
(0) and 4 h chase points were treated with phosphatase (Fig. 3C).
Phosphatase treatment reduced the mobility of the 4 h FMRP
but not of the newly-synthesized FMRP. Thus, FMRP is
phosphorylated within 2–4 h after translation and this phosphorylation is still evident after 36 h.
Amino acid 499 has no effect on the association
of FMRP with RNAs in cells
Since the primary phosphorylation site in FMRP is 30 amino
acids N-terminal to the RGG box, known to bind the G-quartet
structure of associated mRNAs (11,13), we hypothesized that
phosphorylation might modulate RNA binding. Indeed, in vitro
evidence has been published indicating that Drosophila dFxr
protein exhibits heightened RNA homopolymer binding when
phosphorylated. To test whether or not phosphorylation of
mammalian FMRP influences RNA binding we chose a more
global in vivo screen using microarrays since previous approaches to this question are limited to either in vitro methodologies
or examination of artificial homopolymers or, at best, a limited
number of natural messages (9,30). We immunoprecipitated
FMRP from the VC, WT, Ala and Asp Flag-FMRP-expressing
cell lines, all containing comparable amounts of transgene
product (Fig. 4A), and analyzed the associated RNAs using
Affymetrix oligonucleotide microarrays. In two independent
experiments, we interrogated 12 473 genes, found 4779 or
39% expressed in these cultured cells and identified 214
transcripts immunoprecipitated with WT FMRP (Fig. 4B
and Supplementary Table 1 for the complete dataset). These
214 co-immunoprecipitating transcripts reflect 4.5% of the
expressed messages from the L-M(TK-) cells, which agrees
well with the nearly 4% of messages co-immunoprecipitated
with FMRP from the mouse brain (12). We evaluated the
co-immunoprecipitating transcripts from the WT, Ala and Asp
versions of FMRP utilizing Affymetrix comparison analysis
and unpaired t-tests for significance. Using these criteria, only
one transcript showed a significant difference while >99.5% of
the associated transcripts showed no significant difference
regardless of the amino acid substitution at position 499.
The sole significant deviation was for an unknown EST on
chromosome 5 (97437_f_at) that bound less well to the
Asp-substituted FMRP compared to WT. Despite this single
outlier, perhaps due to multiple testing, these data clearly
suggest that the phosphorylation status of FMRP does not
substantially modify global mRNA association.
To examine this data at the level of individual mRNAs, we
examined nine previously published FMRP RNA ligands from
mouse brain (12) that were present in the WT IP. Figure 4C
shows the intensity values for these nine genes in the VC, WT,
Ala and Asp IPs. None of these nine showed a significant
difference in the quantity of RNA between WT and Ala IPs or
between WT and Asp IPs by the criteria used above.
3298
Human Molecular Genetics, 2003, Vol. 12, No. 24
Figure 3. Pulse-chase analysis of FMRP. (A) Transfected murine fibroblast L-M cells, expressing the vector alone (VC), wild type Fmr1 (WT) or the aspartic acidsubstituted Fmr1 at position 499 (Asp) were metabolically-labeled with [35S]methionine for 30 min (pulse ¼ 0) and then chased in methionine-containing medium
for the various times shown in hours. After immunoprecipitation with the 7G1-1 antibody, the proteins were resolved on a 7.5% SDS polyacrylamide gel.
(B) Transfected murine fibroblast L-M cells were metabolically-labeled with [35S]methionine for 30 min (pulse ¼ 0), then chased in methionine-containing medium for the times shown in hours and resolved on a 6% SDS polyacrylamide gel. (C) Pulse-chase, immunoprecipitated FMRP was treated (þ) or not () with
alkaline phosphatase at the time points indicated and resolved on a SDS 6% polyacrylamide gel.
The effect of phosphorylation on
polyribosome-association
Despite the fact that serine 499 is conserved in all known
paralogs and orthologs of FMRP (30), we found no evidence
that phosphorylation of this site in mammalian FMRP
influences RNA-binding. Since FMRP is found associated
with polyribosomes (16–18,20) and likely plays a role in
translation (14,21–23), we examined the localization of the WT
and serine-substituted Fmr proteins on polyribosomes (Fig. 5).
Under steady-state conditions, there was no difference in
Flag-FMRP polysome localization between the WT, Ala and
Asp-expressing transfectants in three independent experiments
(Figs 5 and 6). By scanning densitometry, 43% (WT), 49%
(Ala) and 34% (Asp) of the total Fmr protein was found
in fractions 8–10, containing the heavy polyribosomes (not
significantly different, Figs 5, upper, and 6).
To determine if the phosphorylation status of serine 499
influences ribosome migration, we next performed ribosome
run-off experiments by treating cells with sodium azide, a nonspecific inhibitor of translation initiation that does not affect
elongation and has been extensively utilized for such analyses
(20,39,40). When translation initiation is inhibited, the ribosomes
involved in active translation will continue to move along the
RNA without a new round of ribosome assembly. This results in
the loss of heavy polysomes in the profiles as the complexes
become lighter and in the accumulation of monosomes (compare
the size of the 80 s peak between the upper and lower panels as
well as the loss of polysomes in the sodium azide-treated lower
panels of Fig. 5). The polysome fractions were probed with an
antibody to the ribosomal S6 protein to show that ribosome runoff had occurred in response to the sodium azide treatment
(compare the upper panels of Fig. 5 where S6 is found in
fractions 2–10, to the lower panels which show that following
sodium azide treatment, S6 falls back primarily to fractions 2–6).
Examination of the sodium azide-treated cells by electron
microscopy revealed a loss of polyribosomes upon treatment,
but maintenance of the cellular architecture (data not shown).
When the FMR proteins were examined in three independent
experiments, there was a significant loss of the WT and Aspsubstituted proteins from the heavy polysomes upon sodium
azide treatment. On average, there was a 44% reduction in
FMRP in fractions 8–10 in WT azide compared to WT and a
51% reduction in Asp azide compared to Asp (Fig. 6).
However, the unphosphorylated FMRP is almost completely
absent from the heavy fractions after sodium azide treatment
showing a 93% reduction in fractions 8–10 between Ala and
Ala azide (Figs 5 and 6). This result suggests unphosphorylated
FMRP runs-off more quickly than phosphorylated FMRP,
which appears resistant to run-off and may be associated with
stalled polyribosomes. Furthermore, we observed a persistence
of middle-sized polysomes in fractions 5–7 of both the WT and
Asp transfectants after sodium azide treatment that was not
present in the Ala-expressing cells. To determine if this was a
dominant effect of expressing ectopic FMRP, we examined the
polysome profiles in a run-off experiment with the vector-only
expressing cell line (VC) and found that, like Ala, there were
no persistent polysomes in fractions 5–7. Our results suggest
that the phosphorylated FMRP found in WT and Asp is
resistant to run-off in association with the apparently stalled
polysomes visible in fractions 5–7. Conversely, unphosphorylated FMRP is associated with actively translating polysomes
that readily run-off transcripts in the presence of an inhibitor of
translation initiation.
Human Molecular Genetics, 2003, Vol. 12, No. 24
3299
Figure 4. Effect of amino acid substitutions at 499 on RNA binding in vivo. (A) Western blot analysis of M2 anti-Flag IPs from cell lines expressing either
the expression vector (VC), FMRP (WT), the alanine-substituted FMRP (Ala) or the aspartic acid-substituted FMRP (Asp). (B) Heat map of the intensity values
from WT, Ala, Asp and VC IPs for the 214 transcripts found in the WT IP. Scale (shades of red proportional to the raw, unscaled Affymetrix intensity value): red
represents an intensity value >200; black represents an intensity value of 0. (C) The Affymetrix intensity values (mean þ SEM; n ¼ 2) of nine transcripts
co-immunoprecipitated with either VC, WT, Ala or Asp FMRP are shown along with the values for Fmr1. These nine transcripts were previously shown to be
ligands of FMRP in mouse brain IPs (12). No Ala or Asp value is significantly different from the WT value by Affymetrix analysis nor are there any differences
by t-test except: *WT >Asp for transcript 4, P < 0.05. Table shows the Affymetrix and GenBank identities as well as a description of each of the transcripts shown.
To rule out the possibility that the appearance of FMRP on
polysomes was due to a phenomenon other than ribosome
association, such as aggregation, we examined the mRNP size
of the different FMRP-mRNPs by treating with EDTA, known
to disrupt the ribosomes. After EDTA treatment, WT, Ala and
Asp Flag-FMRP form heavy mRNP particles of similar size,
slightly larger than the large ribosomal subunit (Fig. 7, upper).
Furthermore, treatment of the lysates prior to centrifugation
with RNase demonstrates the co-fractionation of all versions of
Flag-FMRP with the polyribosomes is RNA dependent (Fig. 7,
lower).
Phosphorylation has no effect on the subcellular
localization of FMRP
To determine whether or not the phosphorylation of FMRP
affects its subcellular localization of FMRP, we stained WT,
Ala and Asp Flag-FMRP expressing L-M(TK-) (Fig. 8).
Neither the Ala nor the Asp substitution at residue 499 had
any effect on the characteristic diffuse cytoplasmic staining of
FMRP. These data also demonstrate the lack of granules of
FMRP, further strengthening our conclusion that FMRP is not
aggregating in these cells.
DISCUSSION
Evidence has been presented suggesting FMRP is a negative
regulator of translation (21–23). FMRP isolated from brain
associates with a limited number of mRNAs (12,14) and is
found associated with ribosomes at the base of dendritic spines
(41). Taken together, these data suggest the hypothesis that
FMRP-bound mRNAs may be positioned on stalled ribosomes
awaiting a signal to resume translation in order to supply the
bolus of locally synthesized proteins required for synaptic
plasticity. In this work, we probed what that signal might be.
We show here that mammalian FMRP is phosphorylated on
a short sequence N-terminal to the RGG box with primary
phosphorylation occurring at serine 499. In pulse-chase
experiments, we find FMRP phosphorylated 2–4 h after
synthesis and that phosphorylation at position 499 does not
3300
Human Molecular Genetics, 2003, Vol. 12, No. 24
Figure 5. Unphosphorylated FMRP is associated with actively-translating polyribosomes. Stably transfected cell lines expressing vector (VC), FMRP (WT), the
alanine-substituted FMRP (Ala) or the aspartic acid-substituted FMRP (Asp) at residue 499 were treated either with cycloheximide (upper) or sodium azide (lower)
and then fractionated on a linear 15–45% sucrose gradient. The profiles are shown as absorbance at 254 nm. The positions of the 40S, 60S and 80S monosomes are
indicated by the arrows. The fractions were analyzed on 4–15% gradient gels, transferred to PVDF and probed with the anti-Flag antibody M2 (F-F) or with an
antibody to the S6 ribosomal protein (S6).
affect the half-life of FMRP. Finally, dephosphorylation of
FMRP appears to release translation inhibition as indicated
by its ability to be freely run-off ribosomes in the presence of
sodium azide.
Although phosphorylation of Drosophila dFxr was shown
in vitro to enhance binding to homopolymers of RNA (30), we
find that in vivo, phosphorylation of mammalian FMRP does
not significantly affect the amount or identities of individual
RNAs immunoprecipitated with FMRP. This difference
between Drosophila and mammalian FMRP may be due to
the fact that a single ortholog of FMR1 is present in Drosophila
while, in mammals, three paralogs exist with greater than 60%
identity (42). Thus, the Drosophila results could be true for the
mammalian FXR1 and FXR2 proteins but not for FMRP.
Secondly, the Drosophila results were performed in vitro in a
cell free approach that may or may not truly reflect the in vivo
conditions of our experiments. Third, it is possible that the
Drosophila results indeed occur with purified mammalian
FMRP, but under the physiological conditions of our study, the
RNP complex itself was examined rather than FMRP alone,
potentially masking any direct effect of phosphorylation of
FMRP alone. However, this possibility would likely be of little
physiologic consequence since FMRP appears rarely, if ever, as
a free protein in mammalian cells (20).
Serine 499 is responsible for >85% of the phosphorylation of
FMRP in cells (Fig. 2B), although both PIS and MS/MS and
our labeling experiments of the Asp-substituted FMRP identify
at least one other phosphorylated residue in FMRP. FMRP may
be phosphorylated in a hierarchical fashion (43) where
secondary phosphorylation only occurs subsequent to phosphorylation of serine 499. This possibility is supported by the
observation that an aspartic acid at 499 mimics phosphoserine
and triggers secondary phosphorylation (Fig. 2C). In pulsechase experiments, we found that FMRP was phosphorylated
2–4 h after synthesis. Since Fmr protein is insoluble upon
isoelectric focusing, 2D analysis to quantify the exact
Human Molecular Genetics, 2003, Vol. 12, No. 24
3301
sedimentation properties of FMRP—stripping it from the
ribosomes (15). Thus, deoxycholate is not typically used to
examine FMRP polyribosomes (15,18,20).
Local protein synthesis in dendrites is thought to be required
for synaptic plasticity and information storage (46) involving a
number of kinases and phosphatases (47–51). How this local
protein synthesis is regulated is poorly understood, but one
hypothesis is that selected messages are stored at the base of
dendritic spines in association with stalled ribosomes and
following the appropriate signal, these messages immediately
are translated, providing a bolus of the locally required
protein(s). The data reported above fit well into this hypothesis.
FMRP is found associated with a subset of messages (12,14), is
found at the base of dendritic spines (41), and is a translational
repressor (21,22). We suggest, based upon the experiments
above, that the FMRP associated with stalled ribosomes is
serine 499 phosphorylated and that a possible signal to trigger
translation of the associated messages may be the dephosphorylation of FMRP. Thus, the absence of FMRP may lead to
cognitive deficits by the dysregulation of the local translation of
key mRNAs at the base of dendritic spines.
Figure 6. Phosphorylated FMRP remains associated with heavy polyribosomes
after sodium azide treatment. The fraction of total FMRP western blot signal
contained in fractions 8–10 of cycloheximide and sodium azide treated cells
was determined by densitometry for WT, Ala and Asp lines (n ¼ 4, 3 and 3,
respectively). There was no significant difference between cycloheximide
treated WT, Ala and Asp cells although there was a significant difference
between the cycloheximide-treated and sodium azide-treated cells of each transfectant. *FMRP signal in cycloheximide treated cells > FMRP signal in Na
azide treated cells, P < 0.05. a WT azide > Ala azide and Asp azide > Ala
azide, P < 0.05.
percentage of phosphorylated FMRP was not possible.
Experiments to raise phospho-FMRP specific antibodies are
ongoing.
Siomi et al. (30) used CK2 to in vitro phosphorylate dFxr.
Indeed, serine 499 lies within predicted CK2 and GSK3
consensus sequences (expasy.cbr.nrc.ca/cgi-bin/scanprosite)
and we have observed that both kinases phosphorylate WT
FMRP and fail to phosphorylate the alanine-substituted FMRP
in vitro (data not shown). However, whether or not these are the
major in vivo kinases remains to be established.
To examine whether phosphorylation played a role in
translation regulation, we performed ribosome run-off experiments using sodium azide to inhibit translation initiation
(20,39,40). We were unable to use pactamycin, a specific
inhibitor of translation elongation (44), as it is no longer
available, and puromycin, a polypeptide chain terminator, that
requires in vitro NaCl concentration that disrupts the FMRPpolyribosome association (39). Although incubation with
sodium azide is pleiotropic, in our experiments it did not
change the intracellular architecture of the cells based on
electron microscopy (data not shown). Translation run-off
showed that a fraction of phosphorylated FMRP is found
associated with apparently stalled ribosomes while unphosphorylated FMRP is associated only with actively translating
ribosomes. It should be noted that a recent study suggests
FMRP does not associate with polyribosomes in brain lysates
or in synaptoneurosomes (45). However, the presence of
deoxycholate in those experiments would have altered the
MATERIALS AND METHODS
Cell lines and DNA constructs
Transfected L-M(TK-) cells were maintained and characterized
as described (10). Site-directed mutagenesis was performed on
either the Flag-Fmr1 in the RSV.gpt[5] vector or DS-Red-Fmr1
using the QuickChange XL site-directed mutagenesis kit
(Stratagene). The alanine substitution at 499 was introduced
by using the following primers: forward GCATCAAATGCTG
CTGAAACAGAATCTGACCACA GAGAC; reverse GTCTC
TGTGGTCAGATTCTGTTTCAGCAGCATTTGATGC. The
aspartic acid at 499 was introduced using the following
primers: forward GCATCAAATGCTGACGAAACAGAATC
TGACCACAGAGAC; reverse GTCTCT GTGGTCAGATTC
TGTTTCGTCAGCATTTGATGC.
Metabolic labeling
Cells 5 105–106 were plated in 60 mm tissue culture dishes.
The following day, the cells were rinsed twice in either
phosphate-free or methionine-free DMEM (GibcoBRL) and
labeled in DMEM supplemented with 5–10% dialyzed FCS
and 1 mCi/ml of [32P]orthophosphoric acid (NEN) for 10 h or
in 250 mCi/ml of [35S]methionine (Amersham) for 30 min. If
the cells were being ‘chased’, they were incubated in prewarmed complete media supplemented with 15 mg/ml of
methionine and harvested at the appropriate chase time point.
Labeled cells were washed twice in ice-cold PBS and lysed in
1 ml per dish of lysis buffer (50 mM Tris–HCl, 300 mM NaCl,
30 mM EDTA, 0.5% Triton X-100, pH 7.6) with proteaseinhibitor tablets (Roche) and phosphatase inhibitors (Sigma).
All subsequent manipulations were carried out at 4 C or on ice
as described (10). The lysates were sequentially pre-cleared for
1 h with 100 ml per sample of protein G agarose (Boehringer
Mannheim) and then for 1–2 h with an irrelevant antibody
(16-1-11N—American Type Culture Collection). The lysate
3302
Human Molecular Genetics, 2003, Vol. 12, No. 24
Figure 7. Phosphorylation has no effect on the fractionation of Flag-FMRP in the presence of EDTA or RNase. Stably transfected cells lines expressing Flag tagged
FMRP (WT), Ala-FMRP (Ala) or Asp-FMRP (Asp) were either lysed in the presence of EDTA (upper) or subjected to RNase treatment prior to centrifugation
(lower) and then fractionated on a 15–45% sucrose gradient. The fractions were analyzed by western with the anti-Flag antibody M2 (F-F).
was then immunoprecipitated for 2–3 h with 50 ml of the antiFlag M2 matrix. After immunoprecipitation, the matrix was
washed and eluted as described (10). The proteins were
resolved on either a 6 or a 7.5% SDS polyacrylamide gel and
either fixed (10% acetic acid, 30% methanol) for 20–30 min
before drying (75 C for 45 min) or transferred to nitrocellulose
(Schleicher and Schuell) or PVDF membrane (Amersham) for
subsequent autoradiography and/or western blotting.
Antibodies and western blotting
The anti-FMRP antibody, MAb1a, was obtained from Dr JeanLouis Mandel at the Institute of Genetics in llkirch, France and
the S6 antibody was obtained from Cell Signalling Technology
and used per manufacturer’s instructions. The anti-Flag M2
antibody was obtained from Sigma and used at 0.25 mg/ml.
Antibody reactivity was visualized using either an anti-mouse
HRP conjugate (KPL) or an anti-rabbit HRP conjugate
(Amersham) and developed with ECL (Amersham).
Phosphoamino acid analysis
Phosphoamino acid analysis was performed with modifications
to the method described (52). The FMRP band was cut from
the membrane and hydrolyzed in 6 M HCl at 110 C for
1 h. The samples were spotted onto TLC plates that were
electrophoresed at pH 1.9 (horizontal) and then at pH 3.5
(vertical). The plates were visualized via phosphoimager.
Large-scale purification of FMRP
Approximately 109 Flag-FMRP-expressing L-M(TK-) cells
were harvested and immunoprecipitated as described (10). The
Flag-mRNP was eluted by resuspending the matrix in 0.3 ml of
1 SDS sample buffer prepared without glycerol, B-mercaptoethanol or bromophenol and then boiled. The eluted FMRP
was purified from associated proteins by re-immunoprecipitating with the 7G1-1 antibody-coupled to protein A sepharose
(12) overnight. The matrix was washed twice and boiled in 1
sample buffer. The proteins were resolved on a 7.5% SDS
polyacrylamide gel and stained with Coomassie Brilliant blue
to visualize the purified FMRP.
FMRP was isolated from mouse brain by asphyxiating 20
adult C57Bl/6 mice with CO2, harvesting the brains and
preparing lysate as described (12). The clarified supernatant
was immunoprecipitated with an FMRP-immunoprecipitating
antibody, 6G2, which will be described elsewhere (S. Ceman,
manuscript in preparation). The immunoprecipitated material
was re-immunoprecipitated with 7G1-1 as described above.
The purified FMRP was identified by Coomassie Brilliant
Human Molecular Genetics, 2003, Vol. 12, No. 24
3303
Figure 8. Phosphorylation does not affect the intracellular localization of Flag-FMRP. WT, Ala and Asp Flag-FMRP transfected cell lines were plated on chamber
slides, stained with Mab1a anti-FMRP antibody and visualized with Alexia Flour 488 goat anti-mouse secondary.
blue staining and sent to the Harvard Microchemical facility
where the tryptic peptides were analyzed using microcapillary
reverse-phase HPLC nano-electrospray tandem mass spectrometry (uLC/MS/MS) on a Finnigan LCQ DECA quadrupole
ion trap mass spectrometer.
Precursor ion scan mass spectrometry
The FMRP band was excised, washed and digested with
sequencing grade trypsin (Promega) overnight. The nanocolumn was prepared and operated essentially as previously
described (53). Each nano-column fraction was analyzed
separately on an API 3000 triple quadrupole (PE-Sciex,
Ontario, Canada) with a nanoelectrospray source installed
(Protana, Denmark). For each fraction, a Q1 scan was collected
in both the positive and negative ion modes (data not shown).
For precursor ion scans, the instrument was set to scan for
negative ions, and the collision energy and collision gas were
optimized to efficiently produce the desired phosphate (PO3)
fragment ion in Q2. The instrument monitored Q3 for m/z–79
while Q1 scanned through m/z 400 to 2000.
Microarray analysis of FMRP-associated RNAs
L-M(TK-) cells expressing the empty expression vector (VC),
Flag-FMRP (WT), an alanine at position 499 (Ala) or an
aspartic acid at position 499 (Asp) were grown to
2 108 cells. The cells were lysed in RNAse-free lysis buffer
[as above þ 80 units of RNasin/ml (Promega)] and pre-cleared
as described above. All manipulations were carried out at 4 C.
Before immunoprecipitation, the anti-Flag M2-coupled-matrix
(Sigma) was pre-blocked with 0.12 mg/ml of BSA (NEB),
glycogen (Ambion) and tRNA (Gibco) for 1 h. The lysates were
then immunoprecipitated for 3 h with 50 ml of the pre-blocked
M2 matrix followed by 3–10 min washes. The last wash
contained 30 units of RNAse-free DNAse (Promega). The
immunoprecipitates were resuspended in 150 ml of nucleasefree water (Ambion) plus 0.1 mg of proteinase K (Sigma) and
incubated at 37 C for 15 min. The reaction was phenol/
chloroform extracted and ethanol-precipitated to isolate
associated RNAs. Immunoprecipitated RNAs and pre-cleared
inputs were prepared for genechip analysis on the MG-U74Av2
chips using standard Affymetrix protocols.
Data analysis was performed using Affymetrix Microarray
Suite 5.0 and Spotfire DecisionSite 7.0. A specific transcript
was considered to be an FMRP ligand if it met the following
criteria: (i) the transcript was ‘present’ by Affymetrix absolute
analysis algorithms in both replicates of the FMRP IP; (ii) it
was ‘increased’ in each FMRP IP compared to each VC IP
(four total comparisons); and (iii) it was ‘increased’ when
compared to the pre-cleared input. Affymetrix comparison
analyses as well as unpaired t-tests were used to compare the
WT IP to the Ala IP and to the Asp IP.
Linear sucrose gradient fractionation
Transfected murine fibroblast L-M(TK-) cells were plated at
1.25–1.39 107 cells/25 mls in T225 flasks two days before
harvesting. For analysis of the polyribosomes, the cells were
treated for 15 min with cycloheximide (100 mg/ml) as described
(20). For the run-off experiments, the cells were treated for
30 min with 20–25 mM sodium azide. Linear 15–45% sucrose
gradients containing 100 mM KCl, 20 mM Tris (pH 7.5), 5 mM
MgCl2 were prepared using a gradient maker (BioComp). Cells
were trypsinized, washed in PBS and lysed in the buffer
described above supplemented with 0.3% IGEPAL CA-630
(Sigma). In the EDTA treatment experiments, cell lysis was
performed in the presence of 30 mM EDTA, and fractionation
was performed in the presence of 5 mM EDTA. For the RNase
experiments, prior to centrifugation, lysates were treated with
300 mg/ml RNase A at 30 C for 15 min. Postnuclear supernatants were overlayed on the gradient and centrifuged for
75 min at 188 000g at 4 C. Each gradient was fractionated into
1 ml fractions by bottom displacement using a gradient
fractionator (Isco) with the ribosomal profile monitored at
OD254. Prior to SDS-PAGE analysis, 40 ml of each fraction was
denatured in 1 Laemmli buffer. Westerns were quantified
using densitometry and t-tests were performed on each
comparison to determine significance.
3304
Human Molecular Genetics, 2003, Vol. 12, No. 24
Fluorescence microscopy
WT, Ala or Asp Flag-FMRP expressing L-M(TK-) cells were
plated on chamber slides (Lab-Tek) overnight. The cells were
washed twice with PBS, and fixed in 4% paraformaldehyde for
20 min at room temperature. After two PBS washes the cells
were then permeabilized with 0.1% triton X for 5 min at room
temperature. The cells were then blocked in 10% fetal calf
serum at 37 C for 1 h. Anti-FMRP MAb1a primary antibody
was applied for 2 h at 37 C. The slides were then washed
3 5 min in PBS and subjected to secondary staining with
Alexa Fluor 488 goat anti-mouse antibody (Molecular Probes).
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG Online.
ACKNOWLEDGEMENTS
We thank Olga Stuchlik for performing the in-gel digests, Enrique
Torre for providing the DsRed-Fmr1 construct and Keith
Wilkinson for pointing out the potential PEST sequence. This
work was supported by HD41591-01 (SC), HD20521 (S.T.W.)
and HD35576 (S.T.W.). The Emory Microchemical Facility is
supported by NIH-NCRR grants 02878, 12878 and 13948.
REFERENCES
1. O’Donnell, W.T. and Warren, S.T. (2002) A decade of molecular studies
of fragile X syndrome. Annu. Rev. Neurosci., 25, 315–338.
2. Lubs, J.A. (1969) A marker X chromosome. Am. J. Hum. Genet., 21,
231–244.
3. Sutherland, G.R., Jacky, P.B., Baker, E. and Manuel, A. (1983) Heritable
fragile sites on human chromosomes. X. New folate-sensitive fragile sites:
6p23, 9p21, 9q32, 11q23. Am. J. Hum. Genet., 35, 432–437.
4. Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.-H., Kuhl, D.P.A.,
Pizutti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F. et al. (1991)
Identification of a gene (FMR-1) containing a CGG repeat coincident with a
breakpoint cluster region exhibiting length variation in fragile X syndrome.
Cell, 65, 905–914.
5. Fu, Y.-H., Kuhl, D.P., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, S.,
Verkerk, A.J.M.H., Holden, J.J.A., Fenwick, R.G., Jr, Warren, S.T. et al.
(1991) Variation of the CGG repeat at the fragile X site results in genetic
instability: resolution of the Sherman paradox. Cell, 67, 1047–1058.
6. Siomi, H., Siomi, M.C., Nussbaum, R.L. and Dreyfuss, G. (1993) The
protein product of the fragile X gene, FMR1, has characteristics of an RNA
binding protein. Cell, 74, 291–298.
7. Siomi, H., Matunis, M.J., Michael, W.M. and Dreyfuss, G. (1993) The
pre-mRNA binding K protein contains a novel evolutionarily conserved
motif. Nucl. Acids Res., 21, 1193–1198.
8. Ashley, C.T., Wilkinson, K.D., Reines, D. and Warren, S.T. (1993b) FMR1
protein: conserved RNP family domains and selective RNA binding.
Science, 262, 563–566.
9. Brown, V., Small, K., Lakkis, L., Feng, Y., Gunter, C., Wilkinson, K.D. and
Warren, S.T. (1998) Purified recombinant FMRP exhibits selective RNA
binding as an intrinsic property of the fragile X mental retardation protein.
J. Biol. Chem., 273, 15521–15527.
10. Ceman, S., Brown, V. and Warren, S.T. (1999) Isolation of an
FMRP-associated messenger ribonucleoprotein particle and identification
of nucleolin and the fragile X-related proteins as components of the
complex. Mol. Cell. Biol., 19, 7925–7932.
11. Schaeffer, C., Bardoni, B., Mandel, J.L., Ehresmann, B., Ehresmann, C.
and Moine, H. (2001) The fragile X mental retardation protein binds
specifically to its mRNA via a purine quartet motif. EMBO J, 20,
4803–4813.
12. Brown, V., Jin, P., Ceman, S., Darnell, J.C., O’Donnell, W.T.,
Tenenbaum, S.A., Jin, X., Feng, Y., Wilkinson, K., Keene, J.D. et al.
(2001) Microarray identification of FMRP-associated brain mRNAs and
altered mRNA translational profiles in fragile X syndrome. Cell, 107,
477–487.
13. Darnell, J.C., Jensen, K.B., Jin, P., Brown, V., Warren, S.T. and
Darnell, R.B. (2001) Fragile X mental retardation protein targets G quartet
mRNAs important for neuronal function. Cell, 107, 489–499.
14. Miyashiro, K., Beckel-Mitchener, A., Purk, T., Becker, K., Barret, T.,
Liu, L., Carbonetto, S., Weiler, I., Greenough, W. and Eberwine, J. (2003)
RNA cargoes associating with FMRP reveal deficits in cellular functioning
in Fmr1 null mice. Neuron, 37, 417–431.
15. Khandjian, E.W., Corbin, F., Woerly, S. and Rousseau, F. (1996) The fragile
X mental retardation protein is associated with ribosomes. Nat. Genet.,
12, 91–93.
16. Eberhart, D.E., Malter, H.E., Feng, Y. and Warren, S.T. (1996) The
fragile X mental retardation protein is a ribonucleoprotein containing
both nuclear localization and nuclear export signals. Hum. Mol. Genet.,
5, 1083–1091.
17. Tamanini, F., Meijer, N., Verheij, C., Willems, P.J., Galjaard, H.,
Oostra, B.A. and Hoogeveen, A.T. (1996) FMRP is associated to the
ribosomes via RNA. Hum. Mol. Genet., 5, 809–813.
18. Corbin, F., Bouillon, M., Fortin, A., Morin, S., Rousseau, F. and
Khandjian, E.W. (1997) The fragile X mental retardation protein is
associated with poly (A)þ mRNA in actively translating polyribosomes.
Hum. Mol. Genet., 6, 1465–1472.
19. De Boulle, K., Verkerk, A.J.M.H, Reyniers, E., Vits, L., Hendrickx, J.,
Van Roy, B., Van den Bos, F., de Graaff, E., Oostra, B.A., Willems, P.J.
(1993) A point mutation in the FMR-1 gene associated with fragile
X mental retardation. Nat. Genet. 3, 31–35.
20. Feng, Y., Absher, D., Eberhart, D.E., Brown, V., Malter, H. and Warren, S.T.
(1997) FMRP associates with polyribosomes as an mRNP, and the I304N
mutation of severe fragile X syndrome abolishes this association. Mol. Cell,
1, 109–118.
21. Laggerbauer, B., Ostareck, D., Keidel, E.M., Ostareck-Lederer, A.
and Fischer, U. (2001) Evidence that fragile X mental retardation
protein is a negative regulator of translation. Hum. Mol. Genet., 10,
329–338.
22. Li, Z., Zhang, Y., Ku, L., Wilkinson, K.D., Warren, S.T. and Feng, Y.
(2001) The fragile X mental retardation protein inhibits translation via
interacting with mRNA. Nucl. Acids Res., 29, 2276–2283.
23. Mazroui, R., Huot, M., Tremblay, S., Filion, C., Labelle, Y. and
Khandjian, E. (2002) Trapping of messenger RNA by fragile X mental
retardation protein into cytoplasmic granules induces translation repression.
Hum. Mol. Genet., 11, 3007–3017.
24. Wang, L.L., Richard, S. and Shaw, A.S. (1995) P62 association with
RNA is regulated by tyrosine phosphorylation. J. Biol. Chem.,
270, 2010–2013.
25. Idriss, H., Kumar, A., Casas-Finet, J.R., Guo, H., Damuni, Z. and
Wilson, S.H. (1994) Regulation of in vitro nucleic acid strand annealing
activity of heterogeneous nuclear ribonucleoprotein protein A1 by
reversible phosphorylation. Biochem., 33, 11382–11390.
26. Municio, M.M., Lozano, J., Sanchez, P., Moscat, J. and Diaz-Meco, M.T.
(1995) Identification of heterogeneous ribonucleoprotein A1 as a novel
substrate for protein kinase C zeta. J. Biol. Chem., 270, 15884–15891.
27. Venables, J.P., Elliott, D.J., Makarova, O.V., Makarov, E.M., Cooke, H.J.
and Eperon, I.C. (2000) RBMY, a probable human spermatogenesis factor,
and other hnRNP G proteins interact with Tra2beta and affect splicing.
Hum. Mol. Genet., 9, 685–694.
28. Spirin, A.S. (1996) Masked and Translatable Messenger
Ribonucleoproteins in Higher Eukaryotes. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
29. Jans, D.A. and Hubner, S. (1996) Regulation of protein transport to the
nucleus: central role of phosphorylation. Phys. Rev., 76, 651–682.
30. Siomi, M., Higashijima, K., Ishizuka, A. and Siomi, H. (2002) Casein
kinase II phosphorylates the fragile X mental retardation protein and
modulates its biological properties. Mol. Cell. Biol., 22, 8438–8447.
31. Carr, S., Huddleston, M.J. and Annan, R.S. (1996) Selective detection
and sequencing of phosphopeptides at the femtomole level by mass
spectrometry. Anal. Biochem., 239, 180–192.
32. Casanova, J., Breitfeld, P., Ross, S. and Mostov, K. (1990) Phosphorylation
of the polymeric immunoglobulin receptor required for its efficient
transcytosis. Science, 248, 742–745.
Human Molecular Genetics, 2003, Vol. 12, No. 24
33. Rogers, S., Wells, R. and Rechsteiner, M. (1986) Amino acid sequences
common to rapidly degraded proteins: the PEST hypothesis. Science, 234,
364–368.
34. Salmeron, A., Janzen, J., Soneji, Y., Bump, N., Kamens, J., Allen, H. and
Ley, S.C. (2001) Direct phosphorylation of NF-kappaB1 p105 by the
IkappaB kinase complex on serine 927 is essential for signal-induced
p105 proteolysis. J. Biol. Chem., 276, 22215–22222.
35. Turnell, A.S., Grand, R.J., Gorbea, C., Zhang, X., Wang, W., Mymryk, J.S.
and Gallimore, P.H. (2000) Regulation of the 26S proteasome by
adenovirus E1A. EMBO J., 19, 4759–4773.
36. Penrose, K.J. and McBride, A.A. (2000) Proteasome-mediated degradation
of the papillomavirus E2-TA protein is regulated by phosphorylation and
can modulate viral genome copy number. J. Virol., 74, 6031–6038.
37. Hericourt, F., Blanc, S., Redeker, V. and Jupin, I. (2000) Evidence for
phosphorylation and ubiquitinylation of the turnip yellow mosaic
virus RNA-dependent RNA polymerase domain expressed in
a baculovirus-insect cell system. Biochem. J., 349, 417–425.
38. Ostareck-Lederer, A., Ostareck, D., Cans, C., Neubauer, G., Bomsztyk, K.,
Superti-Furga, G. and Hentze, M. (2002) c-Src-mediated phosphorylation
of hnRNP K drives translational activation of specifically silenced mRNAs.
Mol. Cell. Biol., 22, 4535–4543.
39. Nelson, R.J., Ziegelhoffer, T., Nicolet, C., Werner-Washburne, M. and
Craig, E.A. (1992) The translation machinery and 70 kd heat shock protein
cooperate in protein synthesis. Cell, 71, 97–105.
40. Jefferies, H.B.J., Thomas, G. and Thomas, G. (1994) Elongation factor-1a
mRNA is selectively translated following mitogenic stimulation. J. Biol.
Chem., 269, 4367–4372.
41. Feng, Y., Gutekunst, C.-A., Eberhart, D.E., Yi, H., Warren, S.T. and
Hersch, S.M. (1997) Fragile X mental retardation protein:
nucleocytoplasmic shuttling and association with somatodendritic
ribosomes. J. Neurosci., 17, 1539–1547.
42. Morales, J., Hiesinger, P., Schroeder, A., Kume, K., Verstreken, P.,
Jackson, F., Nelson, D. and Hassan, B. (2002) Drosophila fragile
X protein, DFXR, regulates neuronal morphology and function in the
brain. Neuron, 34, 961–972.
3305
43. Cohen, P. and Frame, S. (2001) The renaissance of GSK3. Nat. Rev. Mol.
Cell Biol., 2, 769–776.
44. Brodersen, D.E., Clemons, W.M.J., Carter, A.P., Morgan-Warren, R.J.,
Wimberly, B.T. and Ramakrishnan, V. (2000) The structural basis for the
action of the antibiotics tetracycline, pactamycin, and hygromycin B on
the 30S ribosomal subunit. Cell, 103, 1143–1154.
45. Zalfa, F., Giorgi, M., Primerano, B., Moro, A., Di Penta, A., Reis, S.,
Oostra, B. and Bagni, C. (2003) The fragile X syndrome protein FMRP
associates with BC1 RNA and regulates the translation of specific mRNAs
at synapses. Cell, 112, 317–327.
46. Steward, O. and Schuman, E. (2001) Protein synthesis at synaptic sites on
dendrites. Annu. Rev. Neurosci., 24, 299–325.
47. Trivier, E., De Cesare, D., Jacquot, S., Pannetier, S., Zackai, E.,
Young, I., Mandel, J.L., Sassone-Corsi, P. and Hanauer, A. (1996)
Mutations in the kinase Rsk-2 associated with Coffin-Lowry syndrome.
Nature, 384, 567–570.
48. Ulloa, L., Diaz-Nido, J. and Avila, J. (1993) Depletion of casein kinase II
by antisense oligonucleotide prevents neuritogenesis in neuroblastoma
cells. EMBO J., 12, 1633–1640.
49. Kao, H., Song, H., Porton, B., Ming, G., Hoh, J., Abraham, M.,
Czernik, A., Pieribone, V., Poo, M. and Greengard, P. (2002) A protein
kinase A-dependent molecular switch in synapsins regulates neurite
outgrowth. Nat. Neurosci., 5, 431–437.
50. Winder, D. and Sweatt, J. (2001) Roles of serine/threonine phosphatases
in hippocampal synaptic plasticity. Nat. Rev. Neurosci., 2, 461–474.
51. Strack, S. (2002) Overexpression of the protein phosphatase 2A
regulatory subunit B gamma promotes neuronal differentiation by
activating the MAP kinase (MAPK) cascade. J. Biol. Chem., 277,
41525–41532.
52. van der Geer, P. and Hunter, T. (1994) Phosphopeptide mapping and
phosphoamino acid analysis by electrophoresis and chromatography on
thin-layer cellulose plates. Electrophoresis, 15, 544–554.
53. Neubauer, G. and Mann, M. (1999) Mapping phosphorylation sites of
gel-isolated proteins by nanoelectrospray tandem mass spectrometry:
potentials and limitations. Anal. Chem., 71, 235–242.