* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Subway - iPlant Pods
Survey
Document related concepts
Ridge (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genomic imprinting wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene desert wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Gene regulatory network wikipedia , lookup
Gene expression wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Gene expression profiling wikipedia , lookup
Community fingerprinting wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genomic library wikipedia , lookup
Molecular evolution wikipedia , lookup
Transcript
Manifestations of a Code Genes, genomes, bioinformatics and cyberspace – and the promise they hold for biology education The iPlant Collaborative Vision Enable life science researchers and educators to use and extend cyberinfrastructure www.iPlantCollaborative.org What is a genome? A GENOME is all of a living thing’s genetic material. The genetic material is DNA (DeoxyriboNucleic Acid) DNA, a double helical molecule, is made up of four nucleotide “letters”: A-G-- T-- C-- Slide: JGI, 2009 What is sequencing? Just as computer software is rendered in long strings of 0s and 1s, the GENOME or “software” of life is represented by a string of the four nucleotides, A, G, C, and T. To understand the software of either - a computer or a living organism - we must know the order, or sequence, of these informative bits. Slide: JGI, 2009 Economics of Scale ¢1 2.0 ¢0.57 ¢0.46 1.0 ¢0.50 ¢0.35 Cost: Cents per base Sequence production (Billions of bases/month) 3.0 ¢0.19 ¢0.08 > ¢0.05 0 0 1989 1991 1993 Human Genome launched 1995 1997 1999 Slide: JGI, 2009 2001 2003 Human Genome completed 2005 2007 Important Dates in Genomics •1986 DOE announces Human Genome Initiative-$5.3 million to develop technology. •1990 DOE & NIH present their HGP plan to Congress. 1997 Escherichia coli genome published •1997 Yeast genome published •2000 Fruit fly (Drosophila) genome published. •2000 Working draft of the human genome announced. •2000 Thale cress (Arabidopsis) genome published (2x). •2002 Rice genome published (2x). •2003 Human genome published. •2006 First tree genome published in Science. •2007 First metagenomics study published Another angle Slide: Stein, 2010 Coming into the Genome Age For the first time in the history of science students can work with the same data and tools that are used by researchers. Learning by posing and answering question. Students generate new knowledge. Workshop Objectives Illustrate the evolving concept of “gene.” Conceptualize a “big picture” of complex, dynamic genomes. Guide students to address real problems through modern genome science. Use educational and research interfaces for bioinformatics. Work with “real” genome sequences gathered by students – in the lab or online. Exciting? >mouse_ear_cress_1080 GAAATAATCAATGGAATATGTAGAGGTCTCCTGTACCTTCACAGAGATTCTAGGCTGAGAGCAGTGCATATAGATATCTTT CGTACTCATCTGCTTTTTCTGGTCTCCATCACAAAAGCCAACTAGGTAATCATATCAATCTCTCTTTACCGTTTACTCGAC CTTTTCCAATCAGGTGCT TCTGGTGTGTCTACTACTATCAGTTTTAGGTCTTTGTATACCTGATCTTATCTGCTACTG AGGCTTGTAAAAGTGATTAAAACTGTGACATTTACTCTAAGAGAAGTAACCTGTTTGATGCATTTCCCTAATATACCGGTG TGGAAAAGTGTAGGTATCTGTACTCAGCTGAAATGGTGGACGATTTTGAAGAAGATGAACTCTCATTGACTGAAAGCGGGT TGAAGAGTGAAGATGGCGTTATTATCGAGATGAATGTCTCCTGGATGCTTTTATTATCATGTTTGGGAATTTACCAAGGGA GAGGTATCAGAATCTATCTTAGAAGGTTACATTTAGCTCAAGCTTGCATCAACATCTTTACTTAGAGCTCTACGGGTTTTA GTGTGTTTGAAGTTTCTTAACTCCTAGTATAATTAGAATCTTCTGCAGCAGACTTTAGAGTTTTGGGATGTAGAGCTAACC AGAGTCGGTTTGTTTAAACTAGAATCTTTTTATGTAGCAGACTTGTTCAGTACCTGAATACCAGTTTTAAATTACCGTCAG ATGTTGATCTTGTTGGTAATAATGGAGAAACGGAAGAATAATTAGACGAAACAAACTCTTTAAGAACGTATCTTTCAGTTT TCCATCACAAATTTTCTTACAAGCTACAAAAATCGAACTATATATAACTGAACCGAATTTAAACCGGAGGGAGGGTTTGAC TTTGGTCAATCACATTTCCAATGATACCGTCGTTTGGTTTGGGGAAGCCTCGTCGTACAAATACGACGTCGTTTAAGGAAA GCCCTCCTTAACCCCAGTTATAAGCTCAAAGTTGTACTTGACCTTTTTAAAGAAGCACGAAACGAAAAACCCTAAAATTCC CAAGCAGAGAAAGAGAGACAGAGCAAGTACAGATTTCAACTAGCTCAAGATGATCATCCCTGTTCGTTGCTTTACTTGTGG AAAGGTTGATATTTTCCCCTTCGCTTTGGTCTTATTTAGGGTTTTACTCCGTCTTTATAGGGTTTTAGTTACTCCAAATTT GGCTAAGAAGAGATCTTTACTCTCTGTATTTGACACGAATGTTTTTAATCGGTTGGATACATGTTGGGTCGATTAGAGAAA TAAAGTATTGAGCTTTACTAAGCTTTCACCTTGTGATTGGTTTAGGTGATTGGAAACAAATGGGATCAGTATCTTGATCTT CTCCAGCTCGACTACACTGAAGGGTAAGCTTACAATGATTCTCACTTCTTGCTGCTCTAATCATCATACTTTGTGTCAAAA AGAGAGTAATTGCTTTGCGTTTTAGAGAAATTAGCCCAGATTTCGTATTGGGTCTGTGAAGTTTCATATTAGCTAACACAC TTCTCTAATTGATAACAGAAGCTATAAAATAGATTTGCTGATGAAGGAGTTAGCTTTTTATAATCTTCTGTGTTTGTGTTT TACTGTCTGTGTCATTGGAAGAGACTATGTCCTGCCTATATAATCTCTATGTGCCTATCTAGATTTTCTATACAATTGATA TTTGATAGAAGTAGAAAGTAAGACTTAAGGTCTTTTGATTAGACTTGTGCCCATCTACATGATTCTTATTGGACTAATCAT TCTTTGTGTGAAAATAGAATACTTTGTCTGAACATGAGAGAATGGTTCATAATACGTGTGAAGTATGGGATTAGTTCAACA ATTTCGCTATTGGAGAAGCAAACCAAGGGTTAATCGTTTATAGGGTTAAGCTAATGCTCTGCTCTTTATATGTTATTGGAA CAGACTATTGTTGTGCCTATCTTGTTTAGTTGTAGATTCTATCTCGACTGTTATAAGTATGACTGAAGGCTTGATGACTTA TGATTCTCTTTACACCTGTAGAAGGATTTAAGCTTGGTGTCTAGATATTCAATCTGTGTTGGTTTTGTCTTTCTTTTGGCT This better? Annotation workflow Generate mathematical evidence Find Gene Families Browse in context Get DNA sequence Build gene models Gather biological evidence Analyze large data amounts Walk or… Early concept (2009) DNA Subway 2014 Molecular biology and bioinformatics concepts RepeatMasker • Eukaryotic genomes contain large amounts of repetitive DNA. • Transposons can be located anywhere. • Transposons can mutate like any other DNA sequence. FGenesH Gene Predictor • Protein-coding information begins with start, followed by codons, ends in stop. • Codons in mRNA (AUG, UAA,…) have sequence equivalents in DNA (ATG, TAA,…). • Most eukaryotic introns have “canonical splice sites,” GT---AG (mRNA: GU---AG). • Gene prediction programs search for patterns to predict genes and their structure. • Different gene prediction programs may predict different genes and/or structures. Multiple Gene Predictors • The protein coding sequence of a mRNA is flanked by untranslated regions (UTRs). • UTRs hold regulatory information. BLAST Searches • Gene or protein homologs share similarities due to common ancestry. • Biological evidence is needed to curate gene models predicted by computers. • mRNA transcripts and protein sequence data provide “hard” evidence for genes. What is a gene? • Can we define a gene? • Has the definition of a gene changed? • How can we find genes? Views • Genes as “independent hereditary units (1866), Mendel • Genes as “beads on strings” (1926), Morgan • One gene, one enzyme (1941), Beadle & Tatum • DNA is molecule of heredity (), Avery • DNA > RNA > Protein (1953), Crick, Watson, Wilkins More Views • • • • Transposons (1940s-50s), McClintock Reverse transcription (1970), Temin & Baltimore Split genes (1977), Roberts & Sharp RNA interference (1998), Fire and Mello Sequence & course material repository http://gfx.dnalc.org/files/evidence Don’t open items, save them to your computer!! • • • • • • • Annotation (sequences & evidence) Manuals (DNA, Subway, Apollo, JalView) Presentations (.ppt files) Prospecting (sequences) Readings (Bioinformatics tools, splicing, etc.) Worksheets (Word docs, handouts, etc.) BCR-ABL (temporary; not course-related)