* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genome Anatomy - K
Cre-Lox recombination wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Protein adsorption wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene expression profiling wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Protein moonlighting wikipedia , lookup
List of types of proteins wikipedia , lookup
Gene regulatory network wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Gene expression wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Genome evolution wikipedia , lookup
General Introduction to the Genome An Outlines • • • • • • Molecular Biology Major Events DNA, RNA Protein Synthesis(Transcription & Translation) Genome Anatomy Bioinformatics Genomics Signal Processing 2 • Molecular Biology Major Events • • • • • DNA, RNA Protein Synthesis(Transcription & Translation) Genome Anatomy Bioinformatics Genomics Signal Processing 3 Molecular Biology Major Events 1865 Mendel Inheritance is controlled by unit factors 1869 1881 Johann Friedrich DNA Discovery Chromosomes are composed of DNA Molecular Biology Major Events 1881 1911 Thomas Hunt Chromosomes are composed of DNA Genes on chromosomes are the discrete units of heredity 1941 George Beadle Edward Tatum Identify that genes make proteins The Central Dogma 1 2 3 Nucleus Book shelves Book Target What is Life made of? 715 Eukaryotes vs Prokaryotes DNA 8 Prokaryotes Eukaryotes Single cell Single or multi cell No nucleus Nucleus No organelles Organelles One piece of circular DNA Chromosomes No mRNA post transcriptional modification Exons/Introns splicing 915 The Cell: Chemical Composition – 70% Water – 7% Small molecules • Salts • Amino acids (Protein) • Nucleotides (DNA, RAN) – 23% macromolecules • Proteins • Polysaccharides • Lipids 10 The Cell: The 3 Critical Molecules RNA DNA Hold Genetic information PROTEIN m-RNA r-RNA t-RNA Form enzymes Transfer Information Synthesize Protein Form body’s components • Molecular Biology Major Events • DNA, RNA • • • • Protein Synthesis(Transcription & Translation) Genome Anatomy Bioinformatics Genomics Signal Processing 12 DNA: the Nucleotide Sugar Phosphate A Nitrogenous base 13 DNA: Nitrogenous base Purines A Pyrimidines G T C 14 DNA: Polymerization reaction 5 P’ 3OH’ T A C G 5 3 A T G C A T G C DNA: hydrogn bounds T C G T No of base pairs= Genome Size HG= 3200 Mbp (Mb) A C G C A G T G C T A A C C G A T T A G T A G C C G T A SugarPhosphate Back bone DNA: Watson Crick Model 1951 DNA: Watson - Crick Model SugarPhosphate Back bone No of base pairs= Genome Size HG= 3200 Mbp (Mb) RNA versus DNA Sugar "Ribose” Phosphate Nitrogenous base G, A ,C,T Sugar” deoxyRibose” Phosphate Nitrogenous base G, A ,C,U 19 Protein structure • 1902 - Emil Hermann Fischer wins Nobel prize: showed amino acids are linked and form proteins A F G N S T D K G S A 20 Amino acid: Basic unit of protein R NH3 Amino group + C H Different side chains, COO R, determine the properties of 20 Carboxylic acid group amino acids. An amino acid 21 22 Protein structure • Primary structure • Secondary structure • Super-secondary structure • Tertiary structure • Quaternary structure Protein Structure: Predication Problem A F G NS T Protein sequence Protein 3D structure Protein Function The Central Dogma: Genes is protein’s blueprint, Genome DNA Gene Protein Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene Protein Protein Protein Protein Protein Protein Protein Protein Protein Protein Protein Protein Protein Protein • • • • • • Molecular Biology Major Events DNA, RNA Protein Synthesis(Transcription & Translation) Genome Anatomy Bioinformatics Genomics Signal Processing 26 Protein Synthesis: DNA, RNA, and the Flow of Information Replication Transcription Translation 27 Protein Synthesis: Gene Expression 28 Pre-mRNA 1 mRNA 1 Transcription Translation 2 2 3 3 Splicing Pre-mRNA Alternative Splicing mRNA 1 1 Transcription Translation 2 3 2 3 m-RNA Editing Pre-mRNA 1 mRNA 1 Transcription Translation 2 2 3 3 32 Translation Pre-mRNA Start Codon 1 S A K 3 A U G A U A A C U C A V G M 2 mRNA Stop Codon Protein Synthesis: The Genetic Code Start Stop 34 Gene Regulation 1 1 2 2 3 3 Regulatory protein Gene Regulation Regulatory protein Gene 1 We have a little knowledge about regulatory mechanisms Gene 2 Gene 1 Regulatory protein Gene 2 What a big Genome Size? • The 12 font size enables approximately 60 nucleotides of DNA sequence to be written in a line 10 cm in length. • Genome size = total number of nucleotide base pairs. – typically in millions of base pairs, or megabases [abbreviated Mb or Mbp]) 37 • Molecular Biology Major Events • DNA, RNA • Protein Synthesis(Transcription & Translation) • Genome Anatomy • Bioinformatics • Genomics Signal Processing 38 the human genome sequence would stretch for 5000 km, the distance from Montreal to London, Los Angeles to Panama, Tokyo to Calcutta, Cape Town to Addis Ababa, or Auckland to Perth The sequence would fill about 3000 books the size of book 600 pages size. 39 Genome size of organism are different 40 Genome size is not good indicator for genes number 41 • Space is saved in the genomes of less complex organisms because the genes are more closely packed together. 42 C-value paradox • Correlation between the complexity of an organism and the size of its genome was looked on as a bit of a puzzle. • 43 Genome Anatomy Human Genome Anatomy Human genome Nuclear genome Mitochondrial genome 45 Human Mitochondrial Genome Anatomy • it is much smaller than the nuclear genome(~17 kB), and it contains just 37 genes. • 13 code proteins and 24 specify non-coding RNA. • do not contain intron. • is typical of the mitochondrial genomes of other animals 46 47 Nuclear Human Genome Anatomy 62% 48 Nuclear Human Genome Anatomy: Protein Coding Genes Nuclear Human Genome Anatomy: Protein Coding Genes five exons, separated by four introns. average exons= nine exons per gene 50 Two gene segments (V28 and V29-1) 51 Nuclear Human Genome Anatomy: pseudogene Non functional genes 52 Nuclear Human Genome Anatomy: genome-wide repeat Nuclear Human Genome Anatomy: genome-wide repeat •Tandemly repeated DNA •Minisatellite DNA •Microsatellite DNA •Interspersed genome-wide repeats •SINE •LINES •LTR •DNA transposons 54 Nuclear Human Genome Anatomy: genome-wide repeat Minisatellite DNA • we are familiar with because of its association with structural features of chromosomes. • Telomeric DNA, which in humans comprises hundreds of copies of the motif 5′-TTAGGG-3′. TTAGGG TTAGGG TTAGGG ……………………….. AATCCC AATCCC AATCCC ……………………….. 55 The content of the human nuclear genome: genome-wide repeat Microsatellite DNA • microsatellites with a CA repeat, such as: make up 0.25% of the genome, 8 Mb in all. • Single base-pair repeats such as: make up another 0.15%. 56 Nuclear Human Genome Anatomy: genome-wide repeat Interspersed repeat 57 Gene Classification: Gene function • This system has the advantage that the fairly broad functional categories used in can be further subdivided to produce a hierarchy of increasingly specific functional descriptions for smaller and smaller sets of genes. • The weakness : functions have not yet been assigned to many eukaryotic genes. 58 Gene Classification: Gene function • The gene catalog couldn’t tell us why we are human? • it may still not be possible simply from genome comparisons with the chimpanzee genome to determine what makes us human 59 Gene Classification: Gene function • The major categories of protein coding genes represent the most studied areas of cell biology, which means that many of the relevant genes can be recognized because their protein products are known. • Genes whose products have not yet been identified are more likely to be involved in the less well studied areas of cellular activity. 60 Gene classification: Protein Domain • A more powerful method is to base the classification not on the functions of genes but on the structures of the proteins that they specify. • A protein molecule is constructed from a series of domains, each of which has a particular biochemical function. 61 Gene classification: Protein Domain 62 • • • • Molecular Biology Major Events DNA, RNA Protein Synthesis(Transcription & Translation) Genome Anatomy • Bioinformatics • Genomics Signal Processing 63 What is Bioinformatics? • Integration of computational and biological methods to convert biological information into general theories. aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcgg ctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatga caatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccga tgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgc ggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaag ctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatg ctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggct atgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggg aatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcgg ctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgcta agctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcgg ctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttg gaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttac cttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggg atccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgacta tgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcgg aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgca tgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgg gatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttacct tggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggct atgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatg ctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatg catgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttacct tggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgg gatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctat gctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaag ctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct catgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgaca atgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaa gctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttg ggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatga atggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgc atgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcgg ctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggcta tgctaagctcatgcgg 64 Data structures Software engineering (C, C++,PERL) Computer Science Cell structure Genome, genes DNA, RNA Biology Bioinformatics Chemistry Statistics Protein structure Molecular bounds Markof Model Neural Network 65 Bioinformatics Subareas • The subareas within bioinformatics include Genomics and Proteomics. Genome comparison evolutionary tree Microarray Analysis Gene predication Gene classification Gene regulation Protein 3D predication Protein protein interaction Protein alignment 66 • • • • • Molecular Biology Major Events DNA, RNA Protein Synthesis(Transcription & Translation) Genome Anatomy Bioinformatics • Genomics Signal Processing 67 What is GSP? Analysis Processing aatgcatgcggctatgctaatgcatgcggctatgct aagctgggatccgatgacaatgcatgcggctatgct aatgcatgcggctatgcaagctgggatccgatgact atgctaagctgggatccgatgacaatgcatgcggct atgctaatgaatggtcttgggatttaccttggaatgc taagctgggatccgatgacaatgcatgcggctatgc taatgaatggtcttgggatttaccttggaatatgcta atgcatgcggctatgctaagctgggatccgatgaca atgcatgcggctatgctaatgcatgcggctatgcaa gctgggatccgatgactatgctaagctgcggctatg ctaatgcatgcggctatgctaagctgggatccgatg acaatgcatgcggctatgctaatgcatgcggctatg caagctgggatcctgcggctatgctaatgaatggtc ttgggatttaccttggaatgctaagctgggatccgat gacaatgcatgcggctatgctaatgaatggtcttgg gatttaccttggaatatgctaatgcatgcggctatgc taagctgggaatgcatgcggctatgctaagctggg atccgatgacaatgcatgcggctatgctaatgcatg cggctatgcaagctgggatccgatgactatgctaag ctgcggctatgctaatgcatgcggctatgctaagct catgcggctatgctaagctgg Using Theory and Methods of Signal Processing To gain global understanding of Genome. GSP Labs • The Genomic Signal Processing Laboratory at Texas A&M University. • The Computational Biology Division of the Translational Genomics Research Institute in Phoenix, Arizona. To model Genomic Regulatory Mechanisms for the purposes of diagnosis and therapy. Edward R. Dougherty GSP Labs • Columbia's Genomic Information Systems Laboratory at Columbia University Dimitris Anastassiou GSP Labs • DSP Group, Department of Electrical Engineering, California Institute of Technology P. P. Vaidyanathan Mapping Character String to Numerical Sequences AAAA TTTT CCCG GGTA GCTT TCCC GGGT 0001 1101 0101 0101 1111 1111 1000 Research Area of GSP • Gene Predication • Genes Predication – Hidden Markov Models (HMM) – Fourier Transform – Wavelet Transform • Resonant Recognition Model (RRM) To identify the common hot spots of many protein molecules using Fourier transform methods. • References • http://biology.ucok.edu/bidlack/biology/notes .htm • http://www.ncbi.nlm.nih.gov/books/bv.fcgi?ri d=genomes • http://www.estrellamountain.edu/faculty/fara bee/biobk/biobooktoc.html • http://www.werathah.com/ • http://lectures.molgen.mpg.de/online_lecture s.html 74 References • http://www.biology.lsu.edu/webfac/jmoroney /BIOL3090/ 75 THANKYOU FOR YOUR ATTENATION