* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA - TeacherWeb
Cell nucleus wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Protein moonlighting wikipedia , lookup
Protein (nutrient) wikipedia , lookup
List of types of proteins wikipedia , lookup
Protein structure prediction wikipedia , lookup
Proteolysis wikipedia , lookup
Gene expression wikipedia , lookup
Epitranscriptome wikipedia , lookup
PROTEIN SYNTHESIS From DNA to RNA to Proteins Genes • Sections of DNA that controls making of physical traits/proteins Types of RNA • Messenger(mRNA)-carries protein making instructions from DNA. • Ribosomal RNA (rRNA)- Part of the ribosome-Makes proteins. • Transfer RNA (tRNA)- transfers amino acids (building blocks of proteins) to the ribosome to make a protein. DNA vs. RNA (differences) • DNA • RNA – Sugar (Deoxyribose) – Sugar (Ribose) – Phosphate Group – Phosphate group – Nitogenous Bases – Nitrogenous Bases –A •A – T=Thymine • U=Uracil(Not “T”) –G •G –C •C • _Double Stranded • Single Stranded • Longer • Shorter Protein Synthesis Overview • 2 Main Processes – Transcription-_DNA_ copied into mRNA (nucleus) – Translation-mRNA made into proteins_ ________ (ribosomes in cytoplasm) Amino acid Protein Transcription! DNA Ribosome mRNA Translation!!!! tRNA • http://www.youtube.com/watch?v =ztPkv7wc3yU • Transcription video Transcription • 1. DNA is unzipped (by RNA polymerase-enzyme) at a gene. “Promoter” initiates copying. • 2. ONE strand of the DNA template is transcribed (copied) into mRNA using complimentary base pairing. • 3. RNA polymerase reaches “termination Signal”/end of gene. Stops copying. Simulation • http://www.phschool.com/atscho ol/phbio/active_art/protein_synth esis/index.html Transcribe the following DNA strands. • ATTCGACG • UAAGCUGC • TTACCAGC • AAUGGUCG • TTAAAACG • AAUUUUGC Codon • 3 consecutive nitrogen bases on mRNA that specify 1 particular amino acid. FLOW OF GENETIC INFO Genetic TraitBlue eyes B A C Translation Video • http://www.youtube.com/watch?v =B6O6uRb1D38&feature=related Translation -- The decoding of mRNA into a protein Nuclear envelope Amino acid tRNA Polypeptide chain Cell membrane Transcription/translation video • http://www.youtube.com/watch?v =NJxobgkPEAo Translation Decode mRNA to Proteins Steps of Translation • 1. The mRNA strand is broken into codons – (Codon- 3 bases that code for an amino acids.) Translation • 2.Ribosome reads the codons and translates them into amino acids. • How?? – Uses the Genetic Code –Match the first letter on the left –Match the second letter on the top – Match the third letter on the right –Ex: codon AUG – Amino Acid: Methionine • What amino acid goes with the following codons: • • • • • • UGGGAAACAUAGAGCCAG- Example Translate and write polypeptide (amino acid) chain • DNA- AGGCGGAGGCGG • mRNA-UCCGCCUCCGCC • Amino Acid-Ser-ala-ser-ala DNA STRAND (Transcribe, translate, amino acid) CCATAGCACGTTACAACGTGAAGGTAA • 3. rRNA sends for the tRNA to bring the correct amino acids. • 4.The tRNA anticodons match up with the mRNA codons – Ex: mRNA CUG -codon – t RNA GAC -anticodon brings the amino acid methionine attached to it. • 5.Amino acids are attached to each other making a protein, until a STOP codon is reached Translation continued • 6. Disassembly- Ribosome complex falls apart. Polypeptide chain (protein) is released. • DNA: ACA TTG TAG CAT • mRNA: • AminoAcids: • DNA: TTT TAC TGG CGC GTA • mRNA: • AminoAcids: Protein shape video-honors only • http://www.youtube.com/watch?v =lijQ3a8yUYQ FLOW OF GENETIC INFO Protein Paths (Protein Synthesis) (p.83) • 1. Nucleus- DNA copied to RNA • 2. Ribosomes- RNA attaches to ribosomes (on ER) for protein synthesis. • 3. Protein leaves ER and goes to Golgi Apparatus • 4. Proteins modified/packaged in Golgi • 5. Vesicles release proteins out of cell through cell membrane A B C D Which is the correct path of protein synthesis??? Protein Paths (Protein Synthesis) (p.83) • 1. Nucleus- DNA copied to RNA • 2. Ribosomes/Rough ER- Synthesize Proteins (send to Golgi) • 3. Golgi Apparatusmodifies/packages/sends proteins • 4. Cell Membrane- carries proteins from Golgi (in vesicles) to be released from cell Path of Proteins-