* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Mutations!
Survey
Document related concepts
History of genetic engineering wikipedia , lookup
Bioinformatics wikipedia , lookup
Biochemistry wikipedia , lookup
Protein moonlighting wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene therapy wikipedia , lookup
Point accepted mutation wikipedia , lookup
Gene expression profiling wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gene nomenclature wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Gene regulatory network wikipedia , lookup
Genetic code wikipedia , lookup
Designer baby wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Gene prediction wikipedia , lookup
Transcript
Mutations! What is a gene? Discuss, be ready to share. ◦A sequence of DNA that codes for a specific protein (or proteins) associated with a trait, characteristic, or genetic condition What do you know about mutations? Discuss, be ready to share. Gene Mutations Gene mutations: occur in a single gene, usually during mitosis or meiosis ◦ Gene mutations occur if DNA polymerase does its job incorrectly ◦ “Point” gene mutations – occur in one/few bases (3 types) ◦ 1) Insertion ◦ Adding a base/bases ◦ 2) Deletion ◦ Removing a base/bases ◦ 3) Substitution ◦ Swapping out a base/bases ◦ Point mutations can have no effect, can improve the trait, or can have a negative effect on the trait. Example mutation - hemoglobin What do you know about hemoglobin? Discuss, be ready to share. ◦ Hemoglobin carries oxygen in red blood cells (don’t need to takes notes on this!) ◦ “HBB” gene for hemoglobin on chromosome #11 (out of 23) ◦ HBB – 1600 base pairs, 3 exons ◦ mRNA with introns, promoter, TATA removed: 444 base pairs ◦ Mutant version of HBB can causes red blood cells to clump. ◦ One bad gene = some clumping of red blood cells ◦ 2 bad genes = “sickle cell anemia” ◦ http://cbm.msoe.edu/includes/swf/NewestSickleCell.swf Typical hemoglobin Transcribe and translate this portion of the HBB gene: ◦GACTGAGGACTCCTC ◦mRNA: CUGACUCCUGAGGAG ◦Leucine-Threonine-Proline-Glutamic acid-Glutamic acid Deletion and insertion mutations (using hemoglobin as an example) Transcribe and translate this portion of the mutated HBB gene: ◦ GCTGAGGACTCCTC ◦ mRNA: CACUCCUGAGGAG ◦ Arginine-Leucine-Leucine-Arginine -…and extra bases Example of a “frameshift” – all codons are “shifted” Deletion mutations (frameshift): Usually result in different primary structure major protein problems Insertion mutations (frameshift): Usually result in different primary structure major protein problems Substitution mutations (using hemoglobin as an example) Transcribe and translate this portion of the mutated HBB gene: ◦GACTGAGGACTTCTC ◦mRNA: CUGACUCCUGAAGAG ◦Leucine-Threonine-Proline-Glutamic acid-Glutamic acid ◦Substitution mutations ◦ Might not have an effect on the protein (don’t matter) ◦ Could be harmful (see next slide) ◦ Could put a stop codon in the wrong place ◦ Could code for an incorrect amino acid with big consequences Substitution mutations - 2 (using hemoglobin as an example) Transcribe and translate this portion of the mutated HBB gene: ◦GACTGAGGACACCTC ◦mRNA: CUGACUCCUGUGGAGAAGUCU ◦Leucine-Threonine-Proline-Valine-Glutamic acid ◦This single amino acid change completely changes the protein! ◦http://www.rpc.msoe.edu/cbm/resources/NewestSickleCell.swf Chromosomal mutations (in tonight’s reading) Mistakes in large portions of an entire chromosome – BIG consequences. Licorice models returned!