Download Document

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Synthetic biology wikipedia , lookup

RNA-Seq wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Replisome wikipedia , lookup

Expanded genetic code wikipedia , lookup

Community fingerprinting wikipedia , lookup

Genome evolution wikipedia , lookup

List of types of proteins wikipedia , lookup

DNA vaccination wikipedia , lookup

Gene expression wikipedia , lookup

Molecular cloning wikipedia , lookup

Silencer (genetics) wikipedia , lookup

DNA supercoil wikipedia , lookup

Genetic code wikipedia , lookup

Gene wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Endogenous retrovirus wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Biochemistry wikipedia , lookup

Point mutation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Molecular evolution wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Transcript
Molecular Biology Background
Schematic view of DNA organization in a cell
Genes and Genomes
• A Gene is the fundamental physical and functional unit of
heredity. A gene is an ordered sequence of nucleotides located in
a particular position on a particular chromosome that encodes a
specific functional product (i.e., a protein or RNA molecule).
• A Genome is all the genetic material (DNA) in the
chromosomes of a particular organism; its size is generally
given as its total number of base pairs.
DNA Structure
• Four nucleotides: adenine (A), cytosine
(C), guanine (G), and thymine (T)
• Bindings:
– A with T (weaker), C with G (stronger)
• Forms a double helix – each strand is
linked via sugar-phosphate bonds
(strong), strands are linked via hydrogen
bonds (weak)
• Genome is the part of DNA that
encodes proteins:
– …AACTCGCATCGAACTCTAAGTC…
genetics.gsk.com/ graphics/dna-big.gif
Comparisons between DNA and single stranded RNA with the
diagram of the bases showing.
The chemical structure of DNA
Why is genomics interesting for the
signal processing person?
Because there are sequences there!
OK, what sort of sequences?
1. Sequences from an alphabet of size
four:
…ATTCGAAGATTTCAACGGGAAAA…
DNA
2. Sequences from an alphabet of size
twenty:
AACWYDEFGHIKLMNPQRSTVAPPQR
Size-4 alphabet:
A, C, T, G: bases (also called or nucleotides)
DNA sequences (genomes) are made of these.
Genes are parts of DNA, and are 4-letter
sequences.
Adenine
Guanine
Thymine
or Uracil (in RNA)
DNA: deoxyribonucleic acid
Cytosine
Central Dogma of Molecular Biology
• Flow of information in a cell
• Recent development of high-throughput technologies that
study the above flow
– requires interdisciplinary effort
– dealing with a huge amount of information
Details of the information flow
• Replication of DNA
– {A,C,G,T} to {A, C, G,T}
• Transcription of DNA to mRNA
– {A,C,G,T} to {A, C, G,U}
• Translation of mRNA to proteins
– {A,C,G,U} to {20 aminoacids}
http://www-stat.stanford.edu/~susan/courses/s166/central.gif
Genes can be turned on and off
The twenty natural amino
acids
(B,J,O,U,X,Z missing)
11 essential amino acids.
Animals cannot make the
eleven
indicated amino acids.
They need to eat them;
Milk provides all of these.
Grains and beans together
provide all of these.
Protein Example
Fibroblast growth factor proteins
Basic bovine
length 146
Acidic bovine
length 140
Example of a Protein: Hemoglobin (oxy, human)
http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm
Sequence of amino acids. Folds into beautiful 3D shapes.
Necessary for function.
Example of a protein (an enzyme)
http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm
The mapping from amino acids to codons is
many-to-one
Computational Gene-Finding