* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Document
List of types of proteins wikipedia , lookup
Cell nucleus wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Lesson 15: Protein Synthesis and Gene Regulation Central Dogma From Gene to Protein Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA Remember… Bases match together A pairs with T A : T C pairs with G C : G weak bonds between bases join 2 strands can separate easily What do we know? DNA DNA is the genetic information Proteins proteins run living organisms enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins DNA is the instructions for making proteins What else do we know? DNA DNA is in the nucleus want to keep it there = protected “locked in the vault” Proteins made by a “protein factory” in cytoplasm ribosomes Need to get gene (DNA) information from nucleus to cytoplasm need a messenger! need a copy of DNA mRNA nucleus DNA • deoxyribose sugar • nitrogen bases – G, C, A, T • T = thymine –T:A –C:G • double stranded RNA • ribose sugar • nitrogen bases – G, C, A, U • U = uracil –U:A –C:G • single stranded From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm The problem with DNA… DNA (double helix) is too big to go through the pores in the nuclear envelope. RNA (single helix) is small. DNA gives its information to mRNA (messenger RNA) to carry out of the nucleus. TOO BIG! Just right. TRANSCRIPTION • Making mRNA from DNA • DNA strand is the template (pattern) – match bases • U:A • G:C • Enzyme – RNA polymerase mRNA TRANSCRIPTION Making mRNA from DNA T G G T A C A G C T A G T C A T CG T A C CG T U U U U U T G G T A C A G C T A G T C A T CG T A C CG T TRANSCRIPTION • Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T TRANSCRIPTION • Use RNA polymerase • Match free floating RNA bases to DNA bases on one of the DNA strands AG A G C U A G G U U C A C G A U A C RNA A C C polymerase G A U T G G T A C A G C T A G T C A T CG T A C CG T U C TRANSCRIPTION U instead of T is matched to A DNA T A C G C A T T T A C G T A G C G G l I I I I I I I I I I I I I I I I I mRNA A U G C G U A A A U G C A U C G C C What do we know NOW? DNA instructions remain in nucleus mRNA A C C A U G U C G A U C A GU A GC A U G GC A has the instructions for building proteins from DNA Proteins built as chains of amino acids What reads RNA? need a mRNA reader! ribosome Flash: Central Dogma Transcription From gene to protein cytoplasm Transcription CELL Protein Trait aa aa DNA Translation aa aa aa mRNA aa aa nucleus ribosome A C C A U G U C G A U C A GU A GC A U GGC A mRNA leaves nucleus through nuclear pores Ribosomes synthesize amino acids to make a protein using instructions on mRNA What do we ALSO know now? mRNA ribosome A C C A U G U C G A U C A G U A G C A U GaG C A has the instructions for building proteins from DNA a a Proteins built as chains of amino acids What reads mRNA? ribosome a a a a What brings the right amino acid to attach to the protein chain? need an amino acid transporter! a a a a a a a From gene to protein cytoplasm Transcription CELL Protein Trait aa aa DNA Translation mRNA nucleus aa aa aa aa ribosome A C C A U G U C G A U C A GU A GC A U GGC A tRNA aa tRNA carries the correct amino acid (based on the mRNAcode) to the ribosome. How does tRNA know which amino acid to bring? • When mRNA leaves nucleus it has a blueprint of DNA’s instructions. • mRNA goes to ribosomes in cytoplasm • Ribosomes read the blueprint on mRNA. mRNA ribosome A C C A U G U C G A U C A GU A GC A U G GC A aa aa aa aa aa aa aa aa Using the blueprints… DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG Codon = set of 3 bases mRNA ribosome AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC UAC Amino acid ? Anticodon = set of 3 bases Met Arg Val Asn Cys Ala Ala AUGcode is UNIVERSAL! The • Since all living organisms… – use the same DNA – use the same code book – read their genes the same way The mRNA code • For ALL life! – Uses only 4 bases for ALL life. (strongest support for a common origin for all life) • Code is redundant – several codons for each amino acid – mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA DNA tRNA Ser Pro Met Ala Leu tRNA Val A different view of PROTEIN SYNTHESIS DNA transcription amino acids mRNA Can you tell the story? ribosome protein tRNA translation Gene Regulation…Keeping Control! Every species has its own number of chromosomes in each cell. Notice: More is not always better... Sometimes it’s just more. Organism Number of Chromosomes Cat 32 Chimpanzee 48 Dog 78 Cow 60 Human 46 Horse 64 Pea plant 14 Corn plant 20 Mosquito 6 Honeybee 32 Sugarcane 80 Sand dollar 62 Remember…a section on a chromosome that codes for a specific trait is called a GENE. And… There are lots and lots of genes on each chromosome! The job of a gene is to control the production of proteins. Not every gene is expressed at the same time. Gene Regulation = what controls when a gene is turned on or turned off (expressed). In bacteria, genes are in groups called Operons. Example: E. coli that’s in our digestive system helps us break down milk. Each Operon codes for a specific protein. Has to have a CAP to start. Are You Lactose Intolerant? Here’s how we metabolize milk… Lac operon Can NOT have a Repressor. Some questions ask you to INFER the meaning of a term. If you cannot recall its meaning try to figure out how the word is used outside of science. Example: Regulation