Download Two Classes of sir3 Mutants Enhance the sir1

Copyright  2000 by the Genetics Society of America
Two Classes of sir3 Mutants Enhance the sir1 Mutant Mating Defect and
Abolish Telomeric Silencing in Saccharomyces cerevisiae
Elisa M. Stone,*,1 Cheryl Reifsnyder,† Mitch McVey,† Brandy Gazo† and Lorraine Pillus*,†
*Department of Biology, University of California, San Diego, California 92093-0347 and †Department of Molecular, Cellular and
Developmental Biology, University of Colorado, Boulder, Colorado 80309-0347
Manuscript received September 2, 1999
Accepted for publication January 21, 2000
ABSTRACT
Silent information regulators, or Sir proteins, play distinct roles in chromatin-mediated transcriptional
control at the silent mating-type loci, telomeres, and within the rDNA repeats of Saccharomyces cerevisiae.
An unusual collection of sir3 mutant alleles was identified in a genetic screen for enhancers of the sir1
mutant mating-defective phenotype. These sir3-eso mutants, like the sir1 mutant, exhibit little or no mating
defects alone, but the sir1 sir3-eso double mutants are essentially nonmating. All of the sir3-eso mutants
are defective in telomeric silencing. In some mutants, this phenotype is suppressed by tethering Sir1p to
telomeres; other mutants are dominant for mating and telomeric silencing defects. Additionally, several
sir3-eso mutants are nonmating in combination with the nat1 N-terminal acetyltransferase mutant. The
temperature-sensitive allele sir3-8 has an eso phenotype at permissive temperature, yet acts as a null allele
at restrictive temperature due to loss of sir3-8 protein. Sequence analysis showed that eight of the nine
sir3-eso alleles have mutations within the N-terminal region that is highly similar to the DNA replication
initiation protein Orc1p. Together, these data reveal modular domains for Sir3p and further define its
function in silencing chromatin.
T
RANSCRIPTIONAL silencing is one means by
which cells regulate gene expression. Silencing occurs when chromatin structure is modified at certain
regions of chromosomes, inactivating the genes in those
regions. Examples of silencing include the inactive
mammalian X chromosome, position effect variegation
in Drosophila, and the silent mating-type loci in fission
and budding yeasts (for reviews, see Laurenson and
Rine 1992; Weiler and Wakimoto 1995; Allshire
1996; Lyon 1999). In Saccharomyces cerevisiae, at least
three genetic loci are subject to transcriptional silencing: the silent mating-type loci, telomeres and the rDNA.
Numerous genes play a role in silencing at these loci.
SIR1, SIR2, SIR3, and SIR4 were originally identified in
mutant strains that inappropriately expressed the silent
mating-type genes, generally leading to a mating-defective phenotype (Rine and Herskowitz 1987; Laurenson and Rine 1992). SIR2, SIR3, and SIR4 also function
in silencing genes positioned near telomeres (Aparicio
et al. 1991; Vega-Palas et al. 1997; Pryde and Louis
1999). Sir2p, Sir3p, and Sir4p exist in a multiprotein
complex that interacts with site-specific DNA binding
proteins and with nucleosomes to mediate silencing
(Moretti et al. 1994; Hecht et al. 1995, 1996; Moazed
et al. 1997; Strahl-Bolsinger et al. 1997). Sir proteins
Corresponding author: Lorraine Pillus, Department of Biology, University of California, 9500 Gilman Dr., San Diego, CA 92093-0347.
E-mail: [email protected]
1
Present address: Science and Health Education Partnership, University of California, 100 Medical Center Way, Woods Bldg., San Francisco, CA 94143-0905.
Genetics 155: 509–522 ( June 2000)
are likely to be targeted to silent chromatin by Rap1p,
Abf1p, and/or origin recognition complex (ORC) proteins, which bind directly to DNA sites within silencer
sequence elements (Shore et al. 1987; Buchman et al.
1988; Sussel and Shore 1991; Bell and Stillman
1992; Foss et al. 1993; Liu et al. 1994; Loo et al. 1995).
Chromatin is thought to be silenced through the interaction of Sir proteins with the N-terminal tails of histones H3 and H4 (Hecht et al. 1995). Sir2p plays an
additional role in chromatin of the nucleolar rDNA
array (Bryk et al. 1997; Smith and Boeke 1997). However, the molecular details of how Sir protein complexes
achieve silencing remain incompletely defined.
A unique role for Sir1p in the establishment of silencing was demonstrated with the discovery that sir1 mutants exhibit a heritable yet epigenetic mating-defective
phenotype (Pillus and Rine 1989). In a population of
sir1 mutant cells, two subpopulations exist: one is mating
competent and normally silenced as in wild type, the
other is mating defective due to derepression of the
silent mating-type loci. Although sir1 mutants do not
have a defect in the maintenance of silencing, it appears
that silencing is not established efficiently in the subpopulation that is transcriptionally derepressed. How Sir1p
functions in silencing is unclear, but mechanistic clues
come from experiments in which Sir1p is tethered to
regions of DNA lacking silencer sequences. When Sir1p
is fused to the DNA binding domain of Gal4p, the fusion
protein can be targeted to Gal4p-binding sites engineered near reporter genes to result in transcriptional
silencing (Chien et al. 1993; Fox et al. 1997). Moreover, Sir1p can be shown to interact physically with the
510
E. M. Stone et al.
DNA replication initiation subunit Orc1p (Triolo and
Sternglanz 1996). A central 17-amino-acid domain of
Sir1p appears to direct it to silencers and is required
for the interaction with Orc1p (Gardner et al. 1999).
Sir1p is not known to participate directly with ORC in
DNA replication, however, so the mechanistic significance of the Sir1p-Orc1p interaction is not yet understood.
Sir3p is a key component of silent chromatin (reviewed in Stone and Pillus 1998). It is an integral
subunit of the multiprotein complex that functions at
the silent mating-type loci and at telomeres. The sir3
null mutant is nonmating and defective in telomeric
silencing (Rine and Herskowitz 1987; Aparicio et al.
1991). Indeed, Sir3p is a limiting factor in telomeric
silent chromatin (Renauld et al. 1993) and when tethered to DNA appears to recruit other proteins to achieve
silencing (Lustig et al. 1996). Several sir3 mutants were
previously identified that suppress silencing defects of
mutants in the histone H4 N terminus or the Rap1p C
terminus (Johnson et al. 1990; Liu and Lustig 1996),
providing genetic evidence for Sir3p-histone and Sir3pRap1p interactions. A recent study revealed that an
N-terminal fragment consisting of approximately half
of the Sir3p protein (Gotta et al. 1998) is sufficient for
enhanced telomeric silencing previously seen with SIR3
overexpression (Renauld et al. 1993). Additionally,
three broad domains were identified to have different
properties in nucleating telomeric silencing by assaying
the ability of tethered Sir3p fusion proteins to silence
in conjunction with a rap1 telomere-defective mutant
(Park et al. 1998). When an N-terminal region and a
C-terminal region of Sir3p are expressed simultaneously, partial complementation of the sir3 null mutant
mating defect is observed, suggesting that the two halves
can function independently (Le et al. 1997; Gotta et
al. 1998). From these studies and the work described
in this article, a picture of distinct functional domains
for Sir3p emerges.
In a genetic screen for enhancers of the sir one mutant
mating defect (Reifsnyder et al. 1996), we uncovered
a collection of mutants including those termed the sir3eso mutants to emphasize their distinct phenotypes described here. A genetic interaction between SIR1 and
SIR3 had previously been noted, in that overexpression
of SIR1 can suppress the mating defect associated with
certain sir3 alleles (Stone et al. 1991). The sir3-eso mutants provide additional evidence for specific SIR1-SIR3
genetic interactions. Analysis of sir3-eso mutations revealed that the N-terminal domain of Sir3p is critical
for silencing the HM silent mating-type loci and telomeres in the absence of SIR1. From sequence and phenotypic classification, the N-terminal region of Sir3p
that is highly similar to the DNA replication initiation
protein Orc1p is highlighted, suggesting a functional
link between Sir1p, Sir3p, and Orc1p.
MATERIALS AND METHODS
Yeast strains, growth conditions, and transformation: Genotypes of yeast strains used in this study are listed in Table 1.
Yeast extract/peptone/dextrose (YPD) rich medium, supplemented synthetic medium lacking the appropriate nutrient
for plasmid selection, and minimal medium were prepared
as described (Sherman 1991). 5-Fluoroorotic acid (5-FOA)
plates were prepared by adding 5-FOA to a final concentration of 0.1% (Sikorski and Boeke 1991) to supplemented
synthetic medium. Transformations into various yeast strains
were performed with lithium acetate as described (Schiestl
and Gietz 1989). pLP1202 was used to delete HML in
LPY4441. In JRY4603 and JRY4623, the SIR3 or SIR1 open
reading frames, respectively, were deleted by standard methods (Baudin et al. 1993). Crosses were performed with descendants of AMR7 and RS862 to make LPY1132; LPY4441,
JRY4603, and EY957 to make LPY2709; AMR27 and YDS631
to make LPY3237; RS862 and YDS631 to make LPY3238 and
LPY3620; JRY4623 and LPY3620 to make LPY3320 and
LPY3321; and RS862 and YDS634 to make LPY4417.
eso mutant screen: A total of 259,000 colonies from 35 independent cultures of AMR27 transformed with SIR1 plasmid
pJR910 (also known as strain LPY94) and 80,000 colonies from
8 independent cultures of JRY3010 with pJR910 (also known
as LPY122) were mutagenized and plated on supplemented
synthetic medium (Reifsnyder et al. 1996). Resulting colonies
were then screened at 30⬚ for mutants that mated when the
SIR1 plasmid was present but that did not mate without the
plasmid. Genetic linkage analysis and plasmid complementation tests were performed to determine if the eso mutants were
in previously identified silencing genes SIR2, SIR3, SIR4, NAT1,
and ARD1 (Reifsnyder 1996). Twenty-nine mutants in six
complementation groups were uncovered. These included 1
allele of sas2 (Reifsnyder et al. 1996), 5 alleles of sir2 (S.
Garcia and L. Pillus, unpublished results), 13 alleles of sir3,
3 alleles of sir4, 2 alleles of ard1, and 5 alleles of nat1. Eight
of the sir3-eso alleles were rescued by gap repair as described
below. As preliminary mating analysis did not distinguish novel
phenotypes of the 5 alleles that were not rescued (data not
shown), we continued detailed analysis for only those 8 that
were. The sir3-eso allele designations in the original mutant
strains prior to gap repair and sequencing are as follows:
LPY221, 1.6.o; LPY222, 2.9.a; LPY225, 3.25.a; LPY238, 6.1.b;
LPY275, 10.16.a; LPY521, 2o; LPY669, H9b; LPY683, 3.i.j; and
JRY188, sir3-8.
Plasmids: pJR910 (also known as pLP17) contains SIR1 on
a CEN-URA3 plasmid. pLP27 (Stone and Pillus 1996) was
used to complement sir3 mutants in above crosses where appropriate. pJR273 contains SIR3 as a 4.5-kb Sal I fragment in
the CEN-URA3 plasmid pSEYC58 (Emr et al. 1986). pRS313
and pRS315 are CEN-based low-copy plasmids with HIS3 or
LEU2 markers, respectively (Sikorski and Heiter 1989).
YEp351 is a LEU2, 2␮ plasmid (Hill et al. 1986). pLP143 was
constructed by inserting the Sal I HindIII 5⬘ SIR3 fragment,
containing an NdeI site engineered by site-directed mutagenesis at codons ⫺1/⫹1, into pKS⫹ Bluescript (Stratagene, La
Jolla, CA) and subsequently inserting the HindIII 3⬘ SIR3 fragment from pJR273; thus pLP143 contains SIR3 as a Sal I fragment flanked by a nonstandard polylinker. An ApaI-BamHI
fragment that contains the Sal I fragment was then inserted
into pRS313 to make pLP187, or into pRS315 to make pLP190.
pLP189 was made in parallel with pLP187, except that it additionally contains the A2T mutation at codon 2 made by sitedirected mutagenesis. pLP465 and pLP468 were created by
gap repair of pJR273, containing sir3-eso mutants R92K and
T135I, respectively. The Sal I fragments of pLP465 and pLP468
were subcloned into pRS313 to make pLP1048 and pLP946,
sir3 Mutants Enhance sir1 Phenotype
511
TABLE 1
Yeast strains
Strain
W303-1a
W303-1b
AMR7
AMR27
RS862
YDS631
YDS634
JRY188
JRY3010
JRY4603
JRY4623
381G
EY957
LPY78
LPY142
LPY221
LPY222
LPY225
LPY238
LPY275
LPY521
LPY669
LPY683
LPY1132
LPY2709
LPY3237
LPY3238
LPY3320
LPY3321
LPY3620
LPY4417
LPY4441
Genotype
Source
MATa ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-1 can1-100
W303-1a MAT␣
W303-1a nat1-3::URA3
W303-1a sir1::LEU2
W303-1a sir3::TRP1
W303-1b adh4::URA3-(C1-3A)n
W303-1b adh4::URA3-4xUASG - (C1-3A)n
MAT␣ his4am leu2 rme1 sir3-8 trp1am ura3-52
AMR27 MAT␣
W303-1b sir3::HIS3 ADE2 lys2
W303-1b sir1::TRP1 ADE2 lys2
MATa SUP4-3 cry1 his4-580 trp1 ade2-1 tyr1 lys2
W303-1a bar1
MAT␣ his4
MATa his4
AMR27 sir3-R30K
AMR27 sir3-T135I
AMR27 sir3-E140K
AMR27 sir3-R92K
AMR27 sir3-L96F
AMR27 sir3-E140K
AMR27 sir3-S813F
AMR27 sir3-L208S
W303-1b nat1-3::URA3 sir3::TRP1
EY957 hml ⌬::TRP1 sir3::HIS3
W303-1b sir1::LEU2 adh4::URA3-(C1-3A)n
W303-1b sir3::TRP1 adh4::URA3-(C1-3A)n
W303-1a sir1::TRP1 sir3::TRP1 adh4::URA3-(C1-3A)n
W303-1b sir1::TRP1 sir3::TRP1 adh4::URA3-(C1-3A)n
W303-1a sir3::TRP1 adh4::URA3-(C1-3A)n
W303-1b adh4::URA3-4xUASG - (C1-3A) sir3::TRP1
W303-1a hml ⌬::TRP1
respectively. pLP1131, pLP464, pLP675, pLP469, pLP473, and
pLP472 were created by gap repair of pLP187, containing sir3eso mutants R30K, L96F, sir3-8(E131K), E140K, L208S, and
S813F, respectively. The wild-type SIR3 gene was cloned from
strains W303-1a and 381G by gap repair of pLP187 to make
pLP1130 and pL1133, respectively. pLP304 is the wild-type
SIR3 gene in YEp351 (Stone and Pillus 1996); pLP535,
pLP1190, pLP828, pLP681, pLP791, pLP516, pLP526,
pLP534, and pLP586 contain the sir3-eso mutations as Sal I
fragments in YEp351, made from the corresponding CENHIS3 plasmids, in the following order: A2T, R30K, R92K, L96F,
sir3-8E131K, E140K, L208S, and S813F. A BamHI digest was
performed to direct integration of pLP1202, an hml⌬::TRP1
construct. The following constructs were previously reported
(Bell et al. 1995): pSIR3.12 (referred to here as ORC1N-SIR3C,
containing the first 231 amino acids of Orc1p fused to the
final 677 amino acids of Sir3p), pSIR3.15 (SIR3C, deleting
the N-terminal 241 amino acids of Sir3p), pSPB1.34 (SIR3NORC1C, containing the first 235 amino acids of Sir3p fused
to the final 679 amino acids of Orc1p), pSPB1.36 (ORC1-SIR3ORC1, substituting amino acids 457–680 of Orc1p with amino
acids 557–779 of Sir3p), pSIR3.13 (SIR3-ORC1-SIR3, substituting amino acids 505–834 of Sir3p with amino acids 405–738
of Orc1p), and pSPB1.43 (ORC1C, deleting the N-terminal
235 amino acids of Orc1p).
Gap repair and DNA sequencing: The sir3-eso mutant alleles
R. Rothstein
R. Rothstein
Stone et al. (1991)
Stone et al. (1991)
Stone et al. (1991)
Chien et al. (1993)
Chien et al. (1993)
J. Rine
J. Rine
J. Rine
J. Rine
Hartwell (1980)
E. Elion
P. Schatz
P. Schatz
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
were rescued from their chromosomal locations by standard
methods of gap repair (Rothstein 1991). The gap-repaired
plasmids that rescued the sir3-eso mutants were made by introducing pJR273, digested with BamHI and ClaI, into strains
LPY238 and LPY222 for pLP465 and pLP468, respectively; and
from pLP187, digested with ClaI and StuI, into strains LPY275
and JRY188 for pLP464 and pLP675, or with StuI and NruI,
into LPY669, LPY683, and LPY225 for pLP472, pLP473, and
pLP676, or with StyI into LPY521 for pLP469, or with HpaI
into W303-1a, LPY221, and 381G for pLP1130, pLP1131, and
pLP1133. Because modestly increased gene dosage of the sir3eso mutants appeared to be sufficient to restore mating in the
strains from which gap repair was done, several plasmids were
rescued from each strain and transformed into appropriate
sir3 single and sir1 sir3 double null mutants to identify those
with an eso phenotype. During the process of sequencing we
discovered that the sir3-eso mutations often lay outside of the
gapped regions, an observation that has been previously described (Rothstein 1991). Therefore the entire open reading
frame was sequenced for each mutant allele. Because pLP676
and pLP469 were identical, we chose to use only one, pLP469,
in further analysis. Additionally, sequencing pLP1130 and
pLP1131 revealed that the wild-type SIR3 alleles from strains
W303-1a and 381G (the parental strain used in the genetic
screen that yielded the sir3-8 mutant; Hartwell 1980) contain the identical sequence to that reported in the Saccharo-
512
E. M. Stone et al.
myces Genome Database (open reading frame YLR442C;
http://genome-www.stanford.edu/Saccharomyces/). Note that
these sequences differ at several positions from the original
SIR3 sequence reported (Shore et al. 1984).
Sequencing was performed using an Applied Biosystems
(Foster City, CA) automated facility. The oligonucleotides
used for sequencing were
SIR3-10:
5⬘GAGACTGCATGTGTACATAGGC3⬘
SIR3-12:
5⬘GCAGCCCTTTCATCACCTTCC3⬘
SIR3-131: 5⬘TAACTGCTGAGCTATCAGAGAT3⬘
SIR3-14:
5⬘CAGAGGAAATACCAATAAACTC3⬘
SIR3-15:
5⬘TTTAGACCGGTTTGCACCAG3⬘
SIR3-16:
5⬘AGAAAATATGGTTCGCCATTTC3⬘.
Immunoblot analysis: Preparation of protein extracts, SDSPAGE electrophoresis, and immunoblotting for Sir3p detection were performed as described (Stone and Pillus 1996).
High-copy 2␮ plasmids were used to facilitate detection of
Sir3p from wild-type and mutant strains. For all parameters
tested previously, results with high-copy plasmids and endogenous genes were identical (Stone and Pillus 1996).
Quantitative mating and telomeric silencing assays: For
quantitative mating assays, cells were grown to midlogarithmic
phase in a supplemented synthetic medium for plasmid selection. They were then diluted appropriately to obtain ⵑ100–
300 colonies per plate and plated on the same medium to
quantitate total number of cells. At the same time, appropriate
dilutions for testing mating were mixed with MATa or MAT␣
mating-type testers LPY142 or LPY78, respectively, and plated
onto minimal medium for diploid selection to quantitate the
number of mating-competent cells. The mating efficiency is
defined as the number of cells that mated per total number
of cells. At least two experiments were performed for each
strain, for which mean values were determined and the range
of each of those values was indicated.
For monitoring telomeric silencing from a URA3 reporter
gene (Aparicio et al. 1991), cells were grown to saturation
for 2–3 days at room temperature in a supplemented synthetic
medium for plasmid selection. These cultures were then
plated in serial fivefold dilutions onto the same medium either
lacking or containing 5-FOA, and plates were incubated at
room temperature until colony growth was visible. Colonies
resistant to 5-FOA are silenced for URA3.
RESULTS
A genetic screen identifies enhancers of the sir1 mutant mating-defective phenotype: The SIR1 gene functions in establishing stable and heritable patterns of
gene expression at the silent mating-type HM loci (Pillus and Rine 1989). The sir1 null mutant exhibits a
partial mating-defective phenotype due to an epigenetic
phenomenon in which the silent mating-type genes in
some cells of the population are completely derepressed
yet in other cells the HM genes are fully repressed (Pillus and Rine 1989). To identify genes that contribute
to silencing in the population of transcriptionally repressed sir1 mutant cells, we performed a genetic screen
for enhancers of the sir one mutant mating phenotype
(eso) mutants (Reifsnyder et al. 1996). Mutants were
identified that were completely mating defective in the
absence of SIR1, but mating competent in its presence.
This was done by replica-plating mutagenized sir1 mutant cells on two media, either selecting for or against
a SIR1 plasmid, then testing for mating in the presence
or absence of the plasmid (Reifsnyder et al. 1996). By
looking for mutants that were mating defective only
in the absence of SIR1, we sought to avoid isolating
previously characterized mutants that were completely
silencing defective.
Six complementation groups were found to affect
mating in sir1 mutant cells. One of the eso mutants was
in SAS2, a gene that encodes a member of a conserved
family of acetyltransferases (Reifsnyder et al. 1996).
Five other complementation groups contained mutant
alleles of genes known to be involved in silencing: ARD1,
NAT1, SIR2 (S. Garcia and L. Pillus, unpublished
results), SIR3, and SIR4 (see materials and methods
for details). Alleles of ARD1 and NAT1 were predicted to
arise from the eso screen, as null mutants were previously
shown to be mating defective in combination with sir1
mutants (Whiteway et al. 1987; Stone et al. 1991).
This report focuses on characterization of the sir3-eso
mutants.
Eight sir3-eso mutant alleles were rescued on plasmids
by gap repair (see materials and methods). In addition to these eight alleles from the eso screen, two other
independently isolated sir3 mutants were found to have
an eso phenotype and thus were included in our analysis.
One mutant, called A2T, was a site-directed mutant in
which the alanine residue at codon 2 was changed to
threonine for a separate study (E. M. Stone and L.
Pillus, unpublished data). The other was the sir3-8
allele, previously described to be temperature sensitive
for mating (Hartwell 1980; Rine and Herskowitz
1987). The sir3-8 allele was recovered on a plasmid by
gap repair and, similar to the behavior of sir3-8 at its
chromosomal locus, sir3 null mutant strains bearing the
sir3-8 plasmid were temperature sensitive for mating.
Transformants containing the sir3-8 plasmid were completely mating defective at the restrictive temperature
of 37⬚ (data not shown) but fully mating competent at
the permissive temperature of 23⬚ in a SIR1 sir3⌬ strain.
The plasmid was tested for its ability to complement
the mating-defective phenotype of a sir1⌬ sir3⌬ double
mutant at the permissive temperature and was found
to be unable to fully complement the mating defect
(see below). Therefore sir3-8 was classified as an eso
mutant. Other previously identified sir3 alleles, however,
were not eso mutants. The SIR3R1 and SIR3R3 alleles,
originally recovered as suppressors of the mating defect
of histone H4 N-terminal mutants (Johnson et al. 1990),
did not enhance the mating defect of the sir1 mutant (T.
Lewis and L. Pillus, unpublished results). Moreover,
SIR3L31 (and SIR3N205, identical to SIR3R3), isolated as
suppressors of the telomeric silencing defect of rap1
C-terminal mutants (Liu and Lustig 1996), did not
exhibit an eso phenotype (data not shown). Thus the
sir3-eso mutants are distinguished by their SIR1-specific
phenotype.
Altered residues in sir3-eso mutant alleles cluster at
the N terminus: The entire SIR3 open reading frame
sir3 Mutants Enhance sir1 Phenotype
513
TABLE 2
The sir3-eso mutations
Allele name
sir3-A2T
sir3-R30K
sir3-R92K
sir3-L96F
sir3-8(E131K)
sir3-T135I
sir3-E140K
sir3-L208S
sir3-S813F
Codon mutated
2:
30:
92:
96:
131:
135:
140:
208:
813:
GCT → ACT
AGA → AAA
AGA → AAA
CTC → TTC
GAG → AAG
ACT → ATT
GAG → AAG
TTG → TCG
TCT → TTT
was sequenced for each gap-repaired allele to identify
the changes that conferred the eso phenotype. Only 1
bp was found to be mutated for each allele. The alleles
were thus renamed to reflect the nature of the mutations
(Table 2). One mutation, leading to the E140K substitution, was independently isolated twice, but all others
were distinct. Therefore, a total of nine different altered
residues were identified in the collection of sir3-eso mutants. Interestingly, eight of these nine substitutions
clustered at the N terminus of Sir3p. This is the 214amino-acid region most similar to Orc1p (50% identical,
63% similar; Bell et al. 1995). Seven of the mutated
residues that mapped to this region were identical in
wild-type Sir3p and Orc1p, and one was conserved (L96
in Sir3p; V96 in Orc1p). The remaining allele, S813F,
was found in a larger region encoding the C terminus
that is also conserved in Sir3p and Orc1p, although not
as extensively as is the N-terminal region. Five sir3-eso
mutations led to changes in conserved residues in the
recently defined BAH domain (bromo-adjacent homology, at Sir3p N-terminal amino acids 48–189; Callebaut et al. 1999). The BAH module is widely conserved
among diverse proteins, including Sir3p and Orc1p,
DNA methyltransferases, and DNA replication proteins;
it has been suggested to be important for protein-protein interactions in processes that link methylation, replication, and transcriptional regulation. Thus, mutations that lead to changes in conserved residues within
an N-terminal domain of Sir3p resulted in the eso phenotype and may serve to define a functionally significant
domain.
The protein encoded by the sir3-8 mutant is thermolabile: Because changes in Sir3 protein levels might
account for silencing defects seen in sir3-eso mutants,
immunoblot analysis was performed to determine if
steady-state levels of Sir3 mutant proteins were similar
to those of wild-type Sir3p. Immunoblot analysis of
whole-cell protein extracts, using a polyclonal Sir3p antiserum, demonstrated that Sir3p levels and electrophoretic mobility were comparable to wild type for all of
the sir3-eso mutants (data not shown). The mobility of
sir3-eso mutant proteins was also evaluated during the
Amino acid substitution
Alanine → threonine
Arginine → lysine
Arginine → lysine
Leucine → phenylalanine
Glutamic acid → lysine
Threonine → isoleucine
Glutamic acid → lysine
Leucine → serine
Serine → phenylalanine
pheromone and starvation responses, previously shown
to result in Sir3p hyperphosphorylation and associated
mitogen-activated protein (MAP) kinase pathway modulation of silencing (Stone and Pillus 1996). None of
the alleles examined appeared defective in pheromoneor starvation-induced Sir3p hyperphosphorylation (data
not shown). However, when protein was examined from
a sir3-8 mutant culture grown at the restrictive temperature of 37⬚, little to no protein was detected (Figure 1).
When grown at the permissive temperature of 23⬚, sir3-8
mutant protein migrates normally (compare first and
third lanes, Figure 1), but it disappears when shifted
for 3 hr or more to 37⬚ (final lane on right, Figure 1).
When grown for as many as 16 generations after shifting
to the restrictive temperature, sir3-8p remains undetectable (data not shown).
SIR1 overexpression was previously shown to partially
suppress the mating defect of sir3-8 mutant cells (Stone
et al. 1991). This suppression appears not to result from
stabilization of sir3-8p, however, as the mutant protein
levels are not restored by SIR1 overexpression (data not
shown). Our results identifying sir3-8p as a thermolabile
protein, together with previous data demonstrating that
Figure 1.—The sir3-8 protein is thermolabile at the restrictive temperature. Immunoblot of whole-cell lysates was probed
with an anti-Sir3p antiserum. Transformants of sir3 null mutant strain LPY2709 contained wild-type SIR3 plasmid pLP304
or sir3-8 mutant plasmid pLP791. Cultures were grown at 23⬚,
and one-half of each culture was shifted to 37⬚ for 3 hr before
harvesting. Note that the temperature shift causes a change
in Sir3p mobility (compare lanes 1 and 2) due to hyperphosphorylation as previously described (Stone and Pillus 1996).
514
E. M. Stone et al.
the sir3-8 mutant is completely mating defective at 37⬚
(Hartwell 1980; Rine and Herskowitz 1987), support the interpretation that sir3-8 behaves as a conditional null allele.
Two classes of sir3-eso alleles exhibit different matingdefective phenotypes: To quantitate sir3-eso mutant mating phenotypes, each sir3-eso allele was introduced into
appropriate strains on a centromeric plasmid expected
to be present in approximately one or two copies per
transformed cell. Plasmids were used in quantitative
experiments to ensure that the strain backgrounds were
isogenic. The mutants behaved similarly when present
on plasmids or at their endogenous chromosomal locus
(data not shown). The sir3-eso plasmids were tested for
their ability to complement the chromosomal null sir3
mutant, and mating phenotypes were compared for
wild-type SIR1 and sir1 mutant strains in MAT␣ and
MATa backgrounds. Because the sir3-8(E131K) mutant
is temperature sensitive for mating, all assays were performed at the permissive temperature of 23⬚. Strains
carrying the other alleles exhibited no defect at 37⬚ and
behaved similarly at 23⬚ and 30⬚.
Quantitative mating assays revealed that strains carrying the sir3-eso plasmids were severely mating defective
in a MAT␣ sir1 sir3 background but had little or no
mating defect in a MAT␣ SIR1 sir3 background (Table
3). Thus, the sir3-eso mutants clearly did not represent
null or complete loss-of-function alleles. For seven of the
sir3-eso plasmids, transformants in the sir1 sir3 mutant
background mated with 10⫺5–10⫺6 efficiency or less, similar to the vector control transformant lacking wild-type
SIR3 altogether. The two remaining sir3-eso mutants,
sir3-A2T and sir3-8(E131K), were partially mating impaired in sir1 sir3 strains. These results are in contrast
to the sir1 mutant carrying a wild-type SIR3 plasmid,
which exhibited only a mild decrease in mating compared to the SIR1 strain (Table 3). Thus, all of the
sir3-eso mutants significantly enhance the sir1 mutant
mating-defective phenotype in the MAT␣ background.
Quantitative mating analysis revealed that all nine
sir3-eso mutants also showed severely decreased mating
efficiency in a MATa sir1 sir3 strain (Table 4). Interestingly, a subset of strains carrying the sir3-eso alleles exhibited a mating defect in the presence of SIR1 in the
MATa sir3 background. Two strains bearing different
alleles, sir3-T135I and sir3-E-140K, mated 100-fold less
efficiently than wild-type SIR3 strains. A third mutant,
sir3-L208S, was completely nonmating in a MATa strain.
It should be noted that this allele would not have been
recovered in the eso screen in the MATa background,
although it clearly fits the definition of an eso mutant
when present in a MAT␣ strain. Because none of these
mutants was mating defective in the MAT␣ strain (Table
3) and because sir3-T135I, sir3-E140K, and sir3-L208S
cluster near one another within the region encoding
the N terminus of Sir3p, they define a MATa-specific
class of alleles that may identify an N-terminal functional
subdomain important for silencing HML␣ but not
HMRa in a wild-type SIR1 strain background (see discussion).
We determined whether the sir3-eso alleles were dominant or recessive by quantitative mating assays in a
MAT␣ sir1 strain that was wild type for SIR3. The MAT␣
background was used to avoid the MATa-specific effects
of some of the alleles noted above. This analysis revealed
that three of the alleles, sir3-T135I, sir3-E140K, and sir3L208S, had partially dominant phenotypes, exhibiting
a decreased mating efficiency of 10⫺3 (Table 3). These
TABLE 3
The sir3-eso phenotype is characterized by a mating defect in the sir1 mutant background
Strain:
Relevant genotype:
Mating efficiencya
LPY3238
MAT␣ sir3⌬
LPY3321
MAT␣ sir1⌬ sir3⌬
LPY3237
MAT␣ sir1⌬
SIR3 allele b
SIR3
sir3-A2T
sir3-R30K
sir3-R92K
sir3-L96F
sir3-8(E131K)
sir3-T135I
sir3-E140K
sir3-L208S
sir3-S813F
Vector only
7 ⫻ 10⫺1 ⫾ 0.7 (1)
7 ⫻ 10⫺1 ⫾ 0.6 (1)
8 ⫻ 10⫺1 ⫾ 0 (1)
9 ⫻ 10⫺1 ⫾ 0.8 (1)
9 ⫻ 10⫺1 ⫾ 0.4 (1)
7 ⫻ 10⫺1 ⫾ 0.2 (1)
5 ⫻ 10⫺1 ⫾ 0.3 (1)
7 ⫻ 10⫺1 ⫾ 0.7 (1)
3 ⫻ 10⫺1 ⫾ 0.8 (10⫺1)
1 ⫻ 10⫺1 ⫾ 0.2 (10⫺1)
1 ⫻ 10⫺5 ⫾ 0.4 (10⫺5)
2
4
2
1
3
4
ⱕ2
4
ⱕ3
7
4
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
10⫺1
10⫺4
10⫺5
10⫺5
10⫺5
10⫺3
10⫺6
10⫺6
10⫺6
10⫺6
10⫺6
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
0.3 (10⫺1)
4 (10⫺3)
0.9 (10⫺5)
0.7 (10⫺5)
0.4 (10⫺5)
4 (10⫺2)
0.5 (10⫺6)
0.4 (10⫺5)
1 (10⫺6)
3 (10⫺5)
1 (10⫺5)
2
4
4
2
4
2
3
2
3
3
2
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
10⫺1
10⫺2
10⫺2
10⫺2
10⫺2
10⫺1
10⫺3
10⫺3
10⫺3
10⫺2
10⫺1
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
0.1 (10⫺1)
2 (10⫺1)
2 (10⫺1)
0.6 (10⫺2)
0 (10⫺1)
0.5 (10⫺1)
0.3 (10⫺3)
0.8 (10⫺3)
2 (10⫺3)
0.9 (10⫺2)
0 (10⫺1)
a
Mating efficiency is expressed as a mean of two experimental values, with the range indicated. In parentheses,
each efficiency is presented relative to this wild-type plasmid control, rounded to the nearest exponent.
b
Plasmids used were pLP187, pLP189, pLP1131, pLP1048, pLP464, pLP675, pLP946, pLP469, pLP473,
pLP472, and pRS313, in descending order.
sir3 Mutants Enhance sir1 Phenotype
515
TABLE 4
A subset of sir3-eso mutants exhibits MATa-specific mating defects
Mating efficiencya
Strain:
Relevant genotype:
LPY3620
MATa sir3⌬
LPY3320
MATa sir1⌬ sir3⌬
SIR3 allele b
SIR3
sir3-A2T
sir3-R30K
sir3-R92K
sir3-L96F
sir3-8(E131K)
sir3-T135I
sir3-E140K
sir3-L208S
sir3-S813F
ORC1N-SIR3C
Vector only
2
3
2
7
2
2
2
4
6
3
8
3
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
10⫺1
10⫺1
10⫺1
10⫺2
10⫺1
10⫺1
10⫺3
10⫺3
10⫺6
10⫺2
10⫺2
10⫺5
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
0.5 (1)
1 (1)
0.8 (1)
0.5 (10⫺1)
0.5 (1)
0.2 (1)
0.4 (10⫺2)
2 (10⫺2)
2 (10⫺5)
0.5 (10⫺1)
3 (10⫺1)
0.4 (10⫺4)
3
6
ⱕ3
ⱕ5
ⱕ3
2
ⱕ3
4
ⱕ3
ⱕ3
2
ⱕ3
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
10⫺2
10⫺6
10⫺6
10⫺6
10⫺6
10⫺5
10⫺6
10⫺6
10⫺6
10⫺6
10⫺2
10⫺6
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
2 (10⫺1)
3 (10⫺5)
0.7 (10⫺5)
1 (10⫺5)
0.5 (10⫺5)
1 (10⫺4)
0.6 (10⫺5)
0.1 (10⫺5)
0.3 (10⫺5)
0.1 (10⫺5)
0.3 (10⫺1)
0.2 (10⫺5)
a
Mating efficiency is expressed as a mean of two experimental values, with the range indicated. In parentheses,
each efficiency is presented relative to this wild-type plasmid control, rounded to the nearest exponent.
b
Plasmids used were pLP187, pLP189, pLP1131, pLP1048, pLP464, pLP675, pLP946, pLP469, pLP473,
pLP472, pSIR3.12, and pRS313, in descending order.
three alleles also constitute the class with MATa-specific
mating-defective phenotypes. We grouped these alleles,
calling those that are primarily recessive class I and those
three alleles that exhibit MATa-specific and dominant
eso mating defects class II. None of the sir3-eso mutants
had dominant mating defects in a wild-type SIR1 mutant
background, as wild-type MATa and MAT␣ strains carrying plasmids containing the sir3-eso alleles mated with
normal efficiency (data not shown).
To determine if sir3-eso mutants, like sir1 mutants,
inherit alternate states of HM locus gene expression,
consistent with a role in establishing silencing, we performed pedigree analysis on several cell lineages (Pillus and Rine 1989). Two sir3-eso mutants, R30K and
S813F, exhibited lineages in which cells transcriptionally
silenced at the HM locus gave rise to transcriptionally
active cells in subsequent generations (data not shown).
Thus, these two alleles appear to be defective in maintenance of silent chromatin, and an establishment defect
is not a general property of sir3-eso mutants.
Sir3p has been hypothesized to dimerize (Moretti
et al. 1994), and partial trans-complementation between
an N-terminal coding region and C-terminal coding region of SIR3 has been observed (Le et al. 1997; Gotta
et al. 1998). Therefore heterodimer formation between
different sir3-eso mutant proteins might lead to interallelic complementation. When MATa sir1 or MAT␣ sir1
strains bearing the alleles sir3-R30K, sir3-R92K, sir3L208S, and sir3-S813F at their endogenous chromosomal locus were transformed with the entire panel of
sir3-eso plasmids, mating ability was not restored (data
not shown). The failure of different sir3-eso mutants to
function in interallelic complementation may reflect a
requirement for Sir1p in heterodimer formation, or
may be due to the inability of sir3-eso heterodimers to
achieve an appropriate tertiary structure.
Mating defects are observed in a subset of nat1 sir3eso double mutants: NAT1 and ARD1 encode subunits
of an N-terminal acetyltransferase (Mullen et al. 1989;
Park and Szostak 1992). Null nat1 and ard1 single and
double mutants have identical phenotypes, including
a partial mating defect in a MATa strain background
(Mullen et al. 1989) and synergistic loss of mating in
the absence of SIR1 (Whiteway et al. 1987; Stone et
al. 1991). Thus nat1 mutants have an eso phenotype in
both MATa and MAT␣ strains since they enhance the
sir1 mating defect and in fact were identified in the eso
screen described here (see materials and methods).
Because both sir3-eso mutants and nat1 mutants enhance
the mating defect of sir1 mutants, we asked if sir3-eso
mutants enhance the nat1 mating defect in a wild-type
SIR1 background. The sir3-eso plasmids were introduced
into a MAT␣ nat1 sir3 strain, as MAT␣ nat1 mutants and
MAT␣ sir3-eso mutants are completely mating competent, in contrast to either of these mutants in a MATa
background.
Quantitative mating data revealed that some but not
all of the sir3-eso alleles have more severe phenotypes
in combination with nat1 mutants (Table 5). Strains
with the sir3-T135I and sir3-L208S alleles exhibited an
ⵑ100-fold decreased mating efficiency and are found
among the class II mutants with MATa-specific and dominant mating defects. The third class II mutant, sir3E140K, did not exhibit worsened mating in the nat1
mutant. Moreover, two additional sir3-eso mutants, sir38(E131K) and sir3-S813F, were completely mating defec-
516
E. M. Stone et al.
TABLE 5
Synergistic interactions occur between sir3-eso
alleles and the nat1 mutant
Strain:
Relevant genotype:
LPY1132
MAT␣ nat1⌬ sir3⌬
SIR3 alleleb
Mating efficiencya
SIR3
sir3-A2T
sir3-R30K
sir3-R92K
sir3-L96F
sir3-8(E131K)
sir3-T135I
sir3-E140K
sir3-L208S
sir3-S813F
Vector only
2
2
5
3
3
2
8
3
6
2
4
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
⫻
10⫺1
10⫺1
10⫺2
10⫺2
10⫺2
10⫺5
10⫺3
10⫺2
10⫺3
10⫺5
10⫺5
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
⫾
0.9 (1)
1 (1)
3 (10⫺1)
2 (10⫺1)
2 (10⫺1)
0 (10⫺4)
6 (10⫺2)
2 (10⫺1)
5 (10⫺2)
0.8 (10⫺4)
0.1 (10⫺4)
a
Mating efficiency is expressed as a mean of two experimental values, with the range indicated. In parentheses, each efficiency is presented relative to this wild-type plasmid control,
rounded to the nearest exponent.
b
Plasmids used were pLP187, pLP189, pLP1131, pLP1048,
pLP464, pLP675, pLP946, pLP469, pLP473, pLP472, and
pRS313, in descending order.
tive in the absence of NAT1. The remaining mutants
had little or no effect on mating efficiency in combination with nat1 mutants. In addition, mating defects were
tested in sir3-eso sas2 double mutants. SAS2 is also a
member of a gene family with acetyltransferase activity
and, like sir3-eso mutants, the sas2 mutant is severely
mating defective only in the absence of SIR1 (Reifsnyder et al. 1996). Mating efficiency for all sir3-eso sas2
double mutants was comparable to that of the single
mutants (data not shown), suggesting a specific interaction between the NAT1 and SIR3 genes.
sir3-eso mutants are defective in telomeric silencing:
In addition to its requirement for silencing at the HM
loci, SIR3 is essential for telomeric silencing. The URA3
reporter gene placed proximal to telomeric sequences is
transcriptionally repressed, and this telomeric silencing,
observed as sensitivity to 5-FOA, is abolished in a sir3
null mutant (Aparicio et al. 1991). Resistance to 5-FOA
is a measure for silencing of the telomere-positioned
URA3 gene, because cells expressing URA3 are sensitive
to 5-FOA and only silenced cells are resistant and able
to form colonies. We tested whether sir3-eso mutants
functioned in telomeric silencing by plating a dilution
series of transformants on growth medium selecting for
plasmid maintenance (-his) and on 5-FOA-containing
medium to monitor silencing and maintain selection
for the plasmid (5-FOA-his). Control transformants of
a sir3⌬ mutant strain showed no growth with vector only
and good growth with a wild-type SIR3 plasmid (Figure
2A). Transformants containing the sir3-eso plasmids
were completely defective for eight of the sir3-eso mu-
Figure 2.—sir3-eso mutants exhibit telomeric silencing defects. Serial fivefold dilutions were plated on supplemented
synthetic medium selecting for plasmid maintenance to monitor growth (-his, left) or the same medium containing 5-FOA
to monitor silencing of the telomere-proximal URA3 reporter
gene (right). Transformants of sir3 mutant strain LPY3238 for
complementation test (A), or of SIR3 wild-type strain YDS631
for dominance test (B), contained the following CEN-based
plasmids ordered from top to bottom: vector control pRS313;
SIR3 wild-type control pLP187; and sir3-eso alleles pLP189,
pLP1131, pLP1048, pLP464, pLP675, pLP946, pLP469, pLP473, and pLP472.
tants, and the sir3-8(E131K) mutant exhibited a partial
defect in telomeric silencing. The telomeric silencing
phenotype was apparent in the presence of SIR1, and
additional telomeric defects were not detected in a sir1
mutant background (data not shown). Therefore the
sir3-eso mutants are unable to function in telomeric silencing.
Because several sir3-eso mutants exhibited dominant
effects in silencing at the HM loci, the panel of mutants
was also examined for dominant effects on telomeric
silencing. Plasmids bearing each mutant allele were
transformed into a telomeric reporter strain that was
wild type for SIR3 and tested for silencing as above. Four
mutants showed a striking loss of telomeric silencing in
the presence of wild-type SIR3 (Figure 2B). Three of
these dominant mutants, sir3-T135I, sir3-E140K, and
sir3-L208S, are class II mutants, which exhibit a dominant mating-defective phenotype in the absence of SIR1,
whereas one, sir3-R92K, is a class I mutant, among those
that are recessive for the eso mating defect. The mutants
with dominant telomeric silencing defects presumably
sir3 Mutants Enhance sir1 Phenotype
form nonfunctional complexes with other silencing proteins, thereby interfering with wild-type SIR3 silencing
at telomeres.
The Orc1p N terminus functionally replaces that of
Sir3p in mating-type silencing in the absence of Sir1p,
but not in telomeric silencing: Given the high degree
of sequence similarity between the N termini of Sir3p
and Orc1p, a chimeric protein between the first 231
amino acids of Orc1p and the Sir3p C-terminal 677
amino acids was created and tested for silencing function (Bell et al. 1995). This ORC1N-SIR3C construct is
capable of substituting for Sir3p in mating-type silencing
(Bell et al. 1995). Because the sir3-eso mutations affected
Orc1p-conserved residues, we hypothesized that the N
terminus of Orc1p might also functionally replace the
Sir3p N terminus in the absence of Sir1p. Indeed, the
Orc1N-Sir3Cp chimera was mating proficient in both
MATa and MAT␣ sir1 mutant backgrounds (Table 4
and data not shown). The Orc1N-Sir3Cp chimera was
also tested for complementation of the sir3 mutant telomeric silencing defect. In contrast to its efficient mating,
the Orc1N-Sir3Cp chimera was defective in telomeric
silencing (Figure 3A), exhibiting only partial function
reflected by its intermediate growth on 5-FOA-containing medium. The Orc1N-Sir3Cp telomeric silencing
defect was comparable in both sir1 mutant and SIR1
Figure 3.—The Orc1p N terminus cannot substitute for
that of Sir3p in telomeric silencing. Serial fivefold dilutions
were plated on supplemented synthetic medium for plasmid
selection to monitor growth (-leu, left) or the same medium
containing 5-FOA to monitor silencing of the telomere-proximal URA3 reporter gene (right). Transformants of sir3 null
mutant strain LPY3238 for complementation test (A), or of
SIR3 wild-type strain YDS631 for dominance test (B), contained the following plasmids: vector control pRS315; SIR3
wild-type control pLP190; and ORC1N-SIR3C (pSIR3.12),
SIR3C (pSIR3.15), SIR3N-ORC1C (pSPB1.34), ORC1-SIR3ORC1 (pSPB1.36), SIR3-ORC1-SIR3 (pSIR3.13), or ORC1C
(pSPB1.43) (Bell et al. 1995). Original plasmid designations
are noted in parentheses.
517
wild-type strain backgrounds (data not shown). Moreover, the Orc1N-Sir3Cp chimera appeared to be partially dominant, inhibiting telomeric silencing in SIR3
strains (Figure 3B). Thus, the N terminus of Sir3p is
distinguished from that of Orc1p by its function at the
telomere, perhaps through interactions with telomerespecific silencing proteins.
To further dissect the effect of SIR3 and ORC1 sequences on telomeric silencing in sir3 mutant and SIR3
wild-type strain backgrounds, the remaining chimeric
and deletion constructs in the series reported by Bell
et al. (1995) were examined. The additional constructs
tested were a SIR3N-ORC1C chimera, which is the reciprocal chimera to the ORC1N-SIR3C noted above; two
sandwich chimeras in which internal ORC1 and SIR3
regions were swapped to make ORC1-SIR3-ORC1 and
SIR3-ORC1-SIR3; and N-terminal deletions to result in
SIR3C and ORC1C. None of the constructs supported
telomeric silencing in the sir3 mutant strain (Figure
3A), consistent with their inability to promote matingtype silencing (Bell et al. 1995). However, partial dominance was observed with the SIR3C and SIR3-ORC1-SIR3
constructs (Figure 3B), in addition to the ORC1N-SIR3C
chimera described above. None of the other constructs
exhibited dominant effects on telomeric silencing. As
the C terminus of Sir3p was unable to complement the
sir3 mutant, the partial telomeric silencing seen for the
Orc1N-Sir3Cp chimera must be due to a low level of
function of the Orc1p N-terminal region. In contrast,
the partial dominance of Orc1N-Sir3Cp, Sir3Cp, and
Sir3-Orc1-Sir3p may be due to Sir3p sequences common
to all three constructs, which might sequester other
silencing proteins into nonfunctional complexes.
Tethered Sir1p suppresses the telomeric silencing defect of sir3-eso mutants: SIR1 does not appear to function
in silencing telomeric reporter genes in standard assays,
although it may play a modest role at native telomeres
(Aparicio et al. 1991; Pryde and Louis 1999). However,
strong silencing is achieved by tethering Sir1p directly to
telomeric sequences via the Gal4p DNA binding domain
(GBD; Chien et al. 1993). Because silencing at the HM
loci occurs only in the presence of SIR1 in sir3-eso mutant
strains, we asked if the telomeric silencing defect of the
sir3-eso mutants could be suppressed by tethering Sir1p
to the telomere. A sir3 null mutant strain with the GAL4upstream activating sequence positioned near a telomeric reporter gene was transformed with either the
GBD control vector or GBD-SIR1 plasmid and the sir3-eso
genes or appropriate controls on high-copy 2␮ plasmids.
The sir3-eso mutants exhibited telomeric silencing defects even when present at elevated dosage on 2␮ plasmids, as observed in control transformants containing
GBD alone (Figure 4A). However, partially restored telomeric silencing was observed for several of the mutants
when they were overexpressed, particularly sir3-A2T and
sir3-8 (compare Figures 2A and 4A). Significantly, when
Sir1p was directed to telomeres with the GBD-SIR1 plas-
518
E. M. Stone et al.
DISCUSSION
Figure 4.—Tethered Sir1p suppresses sir3-eso mutant telomeric silencing defects. Serial fivefold dilutions were plated on
supplemented synthetic medium to monitor growth, selecting
simultaneously for maintenance of two plasmids (-his -leu,
left), or the same medium containing 5-FOA to monitor silencing of a telomere-proximal URA3 reporter gene that contained
GAL4 binding sites for tethering (right). Transformants of
sir3 mutant strain LPY4417 containing control GBD plasmid
pMA424 (A), or pKL5 Sir1p tethering plasmid GBD-SIR1 (B),
as well as the following 2␮ plasmids carrying sir3-eso mutants
and controls, are ordered from top to bottom: pLP304, pLP535, pLP1190, pLP828, pLP681, pLP791, pLP516, pLP526,
pLP534, pLP586, and YEp351.
mid, six of the sir3-eso mutants exhibited near or complete restoration of telomeric silencing (Figure 4B). In
contrast, GBD-SIR1 did not suppress the telomeric silencing defect of any of the Class II sir3-eso mutants that
were dominant for mating-type silencing defects, T135I,
E140K, and L208S. A control experiment, in which GBDSIR1 and the sir3-eso plasmids were coexpressed in an
isogenic strain without tethering sites, showed that SIR1
overexpression itself did not suppress the sir3-eso telomeric silencing defect (data not shown). Together,
these data suggest that sir3-eso mutant telomeric silencing phenotypes, like the mating-defective phenotypes,
can also be made dependent on Sir1p function. SIR1mediated suppression may occur in one of several ways.
For example, suppression may occur via protein-protein
interactions of tethered Sir1p and sir3-eso mutant proteins or by the ability of Sir1p to independently establish
silencing at telomeres when tethered, thereby compensating for sir3-eso mutant defects.
In a genetic screen for enhancers of the sir1 mutant
silencing defect, we identified a collection of sir3 mutant
alleles. Unlike the sir3 null mutant, which is completely
mating defective in the presence of SIR1, the mating
defects of these sir3-eso mutants are seen primarily in the
absence of SIR1. Some of the mutants exhibit dominant
effects; all of the sir3-eso alleles are defective in telomeric
silencing. Mutated residues cluster in an N-terminal region that exhibits a high degree of sequence similarity
with the N terminus of the DNA replication initiator
Orc1p. The clustering of the mutations in the sir3-eso
mutants thus identifies a domain of Sir3p that contributes to silencing in the absence of SIR1. The sir3-eso
mutants also provide clues for the role of this shared
domain in Orc1p and Sir3p and further evidence for a
functional relationship between Sir1p and Sir3p.
sir3-eso mutants define functional domains in the Sir3
protein: The phenotypic profile of the sir3-eso mutants
provides insight into the emerging picture of different
functional domains within Sir3p (for review, see Stone
and Pillus 1998). Sir3p can be viewed as consisting of
two large domains (Figure 5): an N-terminal region with
a high degree of similarity to Orc1p and an extended
C-terminal region of the protein that can associate with
other silencing proteins, including Sir2p, Sir4p, Rap1p,
and the histones. Eight of the nine sir3-eso mutants identified cluster within the N-terminal domain (Figure 5),
disrupting Sir3p silencing function at both HM loci in
the absence of SIR1. Two predominant classes of sir3eso alleles were uncovered: (1) those that are recessive
for the eso phenotype and (2) those that are dominant
and also MATa specific (i.e., affecting HML␣ silencing)
in wild-type SIR1 strains. The class II mutants cluster in
the N-terminal region between amino acid residues 135
and 208. In SIR1 strains, both class I and II mutants
function normally at HMR, but the class II mutants are
defective at HML. Thus, the class II domain may be
required for interaction with a silencing factor only at
HML. The function of the N-terminal subdomain may
be supplied by a redundant mechanism at HMR, consistent with the redundancy observed within the HMRE
silencer (see, for example, Brand et al. 1985).
All of the sir3-eso alleles are defective in telomeric
silencing. This phenotype is seen even in SIR1 strains,
consistent with previous suggestions that Sir1p does not
play a major role in silencing telomeric reporter genes
(Aparicio et al. 1991). However, Sir1p is known to promote silencing when tethered to telomeric sequences
(Chien et al. 1993), and we showed that tethered Sir1p
suppresses telomeric silencing defects of the class I sir3eso mutants. Thus Sir1p function can compensate for
the sir3-eso mutant silencing defect at the HM loci and
when tethered at the telomeres. Therefore, Sir1p may
directly recruit Sir3p and when tethered may substitute
for a telomeric factor that can no longer interact nor-
sir3 Mutants Enhance sir1 Phenotype
519
Figure 5.—Sir3p domains
confer specific silencing functions. Nine different sir3-eso
alleles defining two distinct
classes of mutants were identified in this study as indicated.
Eight of these cluster in the
N-terminal region previously
noted to be highly similar to
Orc1p (in dark green, amino
acids 1–214; Bell et al. 1995).
The sir3-8(E131K) allele is distinguished in that it is temperature sensitive for mating. The
C-terminal two-thirds of the
protein has been implicated in
a number of physical interactions with other proteins, including Rap1p, Sir4p, and histones H3 and H4 (light green;
for review, see Stone and Pillus 1998). Sir2p associates indirectly with Sir3p through a mutual Sir4p interaction (Moazed et
al. 1997; Strahl-Bolsinger et al. 1997). Asterisks indicate three previously identified suppressors of mutations in histone H4
or Rap1p ( Johnson et al. 1990; Liu and Lustig 1996): SIR3 L31 (S31L), SIR3R1 (W86R), and SIR3R3/SIR3 N205 (D205N), respectively,
none of which exhibit an eso mutant phenotype. The sir3-eso mutants R92K, L96F, E131K, T135I, and E140K disrupt conserved
residues within the BAH domain found in DNA methyltransferases and other proteins with replication and chromatin functions,
including both Sir3p and Orc1p (Callebaut et al. 1999).
mally with Sir3p in the sir3-eso mutants. The telomeric
silencing defect exhibited by the Orc1p-Sir3p chimera
is consistent with there being a specific role for the
Sir3p N terminus at telomeres, and this function might
involve interaction with a silencing factor that is either
redundant (with Sir1p, for example) or unnecessary at
the HM loci. Orc1p itself may play a role at telomeres
since mutations in two other ORC subunits, ORC2 and
ORC5, cause telomeric silencing defects (Fox et al.
1997).
The class II sir3-eso mutants are characterized by dominant effects on mating and telomeric silencing phenotypes, yet these mutant proteins must have some productive interactions with other silencing proteins, because
they all function in silencing under some circumstances.
However, these dominant mutants must interfere with
the function of factors with which they interact in other
situations. For example, dominant mating defects are
observed in the absence of SIR1, but not in its presence,
suggesting an inability to disrupt the silencing function
that is performed by SIR1 at the HM loci. Moreover, as
tethered Sir1p does not suppress the class II alleles, it
must not be able to function with those sir3-eso proteins
at the telomeres. Interestingly, one of the class I mutants
(R92K) is dominant for telomeric silencing but behaves
like the other members of its class in that it is suppressed
by tethered Sir1p.
Several sir3-eso mutants enhance the nat1 mutant mating defect. Interestingly, Sir3p is a potential substrate
of Nat1p/Ard1p N-terminal acetyltransferase activity,
indicated by its alanine residue at codon 2 (Sherman
et al. 1993). However, the nat1 mutant phenotype does
not appear to result from the absence of N-terminal
acetylation on Sir3p, and so presumably acetylation of
some other silencing protein by Nat1p must be required
for normal silencing (E. M. Stone and L. Pillus, unpublished data). Because nat1 mutants, like sir3-eso mutants, act as enhancers of the sir1 mating-defective phenotype (this study and Stone et al. 1991), the observed
nat1 sir3-eso interactions imply that Nat1p, Sir1p, and
Sir3p provide interdependent means through which silencing may be achieved.
The temperature-sensitive mating phenotype of the
sir3-8(E131K) mutant is unique among sir3 mutants
(Hartwell 1980; Rine and Herskowitz 1987). We
determined that the sir3-8 allele has the additional phenotype of enhancing the sir1 mutant phenotype at permissive temperatures. Additionally, we discovered that
sir3-8 encodes a thermolabile protein, thereby explaining the nature of this well-known mutant in molecular terms and allowing more detailed interpretations
of earlier experiments using this allele (Miller and
Nasmyth 1984; Holmes and Broach 1996). For example, to evaluate the contribution of cell cycle control,
silencing was abolished by raising sir3-8 mutant cells to
the restrictive temperature. Then, cells were arrested at
G1 and released at permissive temperature. Silencing
was restored only during S-phase, demonstrating that
establishment of silencing required DNA replication or
some other S-phase event. In contrast, shifting sir3-8
mutants from permissive to restrictive temperature revealed that maintenance of silencing can be destroyed
throughout the cell cycle (Miller and Nasmyth 1984).
Previously, the loss of silencing in the sir3-8 mutant at
the restrictive temperature could be explained in at
least two ways: inappropriate protein folding of sir3-8p
520
E. M. Stone et al.
within an intact multiprotein complex might disrupt its
function, vs. protein instability might result in loss of
function of sir3-8p within the complex or disassembly
of the complex itself. We now favor the latter hypothesis,
since the sir3-8 mutant behaves as a conditional null
allele.
We hypothesize that different interaction surfaces of
the Sir3p molecule are disrupted by the different classes
of sir3-eso mutations. These mutants will be valuable for
extending analysis of different domains of the Sir3p
molecule as detailed structural information becomes
available.
How might Sir1p, Sir3p, and Orc1p functions be
linked? Silencing is a heritable regulatory state, resulting
from separable establishment and maintenance functions (Pillus and Rine 1989; reviewed in Rivier and
Rine 1992). Sir1p functions in establishing silencing but
has no apparent role in its maintenance. In contrast,
other Sir proteins, including Sir3p, have clear roles in
maintenance. In addition to Sir1p function in establishment, there is presumably some additional mechanism
for establishing silencing since a subpopulation of sir1
mutant cells initiates and propagates the silenced state
(Pillus and Rine 1989). Candidate proteins for this
function include those that promote telomeric silencing
when tethered to engineered sites for ectopic DNA binding proteins, such as Sir3p, Sir4p, and Rap1p (Buck
and Shore 1995; Lustig et al. 1996; Marcand et al.
1996). One goal of the screen for eso mutants was to
find other genes that function in a manner similar to
SIR1. Because sir3-eso mutant alleles were identified in
the screen, they were tested for establishment defects.
Pedigree analysis suggested that although sir3-eso mutants are weakly defective in the maintenance of silencing, they are unlikely to have an establishment defect
in a SIR1 wild-type background. The gene(s) responsible
for establishment in the silencing-competent subpopulation of sir1 mutant cells have not yet been unambiguously identified, but may include RAP1, or other genes
uncovered in the eso mutant screen like SIR2 or SIR4,
or other as yet uncharacterized genes.
Several possibilities exist to explain the eso phenotype
of the sir3 alleles. The weak sir3-eso maintenance defect,
in combination with the sir1 establishment defect, may
lead to complete derepression of the silent mating-type
loci. Alternatively, SIR1 may have an unsuspected role
in maintenance of silencing that is normally redundant
with that of SIR3, leading to the failure to maintain
silent chromatin only in the sir1 sir3-eso double mutants.
Another possibility is that SIR3 may indeed function
in establishing silencing, not constitutively, but in the
absence of SIR1. This would be analogous to the situation seen for MAP kinase pathway genes in which KSS1
substitutes for FUS3 only in a fus3 null mutant (Madhani
et al. 1997). Finally, there may not be any other protein
that functions similarly to Sir1p, but instead SIR1-independent establishment may occur by default at a low
frequency (for example, other Sir proteins may occasionally find their way to silencers in the absence of
potential recruitment by Sir1p). The molecular definition of Sir1p function and the mechanism of establishing silencing thus remain to be resolved. It is possible
that Sir1p’s function is distinct from the nucleation role
revealed by tethering and mutant studies in which Sir3p,
Sir4p, or Rap1p have been implicated in recruiting silencing factors to silent loci (Sussell et al. 1993; Lustig
et al. 1996; Marcand et al. 1996).
Genetic interactions between SIR1 and SIR3 raise the
possibility that the two proteins may physically associate
with one another. Our studies demonstrate that sir3-eso
mutants can enhance the sir1 mutant mating defect and
that the telomeric silencing defect of the sir3-eso mutants
can be suppressed by tethered Sir1p. Furthermore, SIR1
overexpression suppresses the mating defects of certain
sir3 mutant alleles (Stone et al. 1991). Additionally,
Sir1p physically interacts with the N terminus of Orc1
(Triolo and Sternglanz 1996), and Orc1p and Sir3p
share significant sequence similarity at their N termini
(Bell et al. 1995). It is plausible that Sir1p interacts with
the N terminus of Sir3p. However, physical interactions
between Sir1p and Sir3p have yet to be observed in
either two-hybrid analysis (Triolo and Sternglanz
1996) or coimmunoprecipitation experiments (E. M.
Stone and L. Pillus, unpublished data). A transient
interaction between Sir1p and Sir3p, perhaps occurring
only at a specific point in the cell cycle, might be responsible for the establishment of silencing. If Sir1p does
not interact with the Sir3p N terminus, perhaps another
domain of the Sir3p molecule actively inhibits a potential Sir1p-Sir3p interaction.
The high degree of similarity between the Sir3p and
Orc1p N termini suggests a shared function between
these domains that may be imagined in several ways.
For example, Sir3p may in some instances substitute
for Orc1p in the traditional ORC, thereby creating an
alternative complex with modified or inhibitory function in DNA replication. Conversely, Orc1p may substitute for Sir3p in a subset of the multiprotein complexes
containing the other silencing proteins; such a model
would then predict that Orc1p is capable of performing
some function independent of the other Orc subunits.
The proposal that ORC may play a role independent
of DNA replication is supported by the observation that
silencing and DNA replication functions of ORC are
separable, although they are still SIR dependent (Fox
et al. 1995; Dillin and Rine 1997). An additional possibility is that Sir2p, Sir3p, Sir4p, Rap1p, and histones may
coexist with Sir1p and Orc1p in the same multiprotein
complex. It is noteworthy that the N-terminal regions
of both Sir3p and Orc1p contain the recently identified
BAH domain, which is also found in DNA methyltransferases and other proteins thought to act in transcriptional control. The BAH domain is proposed to direct
these proteins to their sites of action within chromatin
sir3 Mutants Enhance sir1 Phenotype
(Callebaut et al. 1999). Because five of the sir3-eso
mutations are within the BAH domain, their further
analysis may lead to greater understanding of the role
of this domain in chromatin structure and function.
We thank A. Clarke, S. Garcia, J. Heilig, S. Jacobson, J. Lowell, R.
Sternglanz, and R. West for critically reading the manuscript; S. Loo
for his contribution in an initial phase of the eso mutant screen; L.
Hartwell, J. Rine, and R. Sternglanz for plasmids and strains; and Y.
Han for sequencing assistance. This work was initiated with funding
from the National Science Foundation (NSF) and continued with
support from the National Institutes of Health. M.M. received support
from a Summer Fellowship from the Cancer Center at the University
of Colorado Health Sciences Center, and B.G. received support from
an REU supplement from NSF.
LITERATURE CITED
Allshire, R. C., 1996 Transcriptional silencing in fission yeast: a
manifestation of higher order chromosome structure and functions, pp. 443–466 in Epigenetic Mechanisms of Gene Regulation,
edited by V. E. Russo, R. A. Martienssen and A. D. Riggs. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Aparicio, O. M., B. L. Billington and D. E. Gottschling, 1991
Modifiers of position effect are shared between telomeric and
silent mating-type loci in S. cerevisiae. Cell 66: 1279–1287.
Baudin, A., O. Ozier-Kalogeropoulos, A. Denouel, F. LaCroute
and C. Cullen, 1993 A simple and efficient method for direct
gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 14:
3329–3330.
Bell, S. P., and B. Stillman, 1992 ATP-dependent recognition of
eukaryotic origins of DNA replication by a multiprotein complex.
Nature 357: 128–134.
Bell, S. P., J. Mitchell, J. Leber, R. Kobayashi and B. Stillman,
1995 The multidomain structure of Orc1p reveals similarity to
regulators of DNA replication and transcriptional silencing. Cell
83: 563–568.
Brand, A. H., L. Breeden, J. Abraham, R. Sternglanz and K. Nasmyth, 1985 Characterization of a “silencer” in yeast: a DNA
sequence with properties opposite to those of a transcriptional
enhancer. Cell 41: 41–48.
Bryk, M., M. Banerjee, M. Murphy, K. E. Knudsen, D. J. Garfinkel
et al., 1997 Transcriptional silencing of Ty1 elements in the
RDN1 locus of yeast. Genes Dev. 11: 255–269.
Buchman, A. R., W. J. Kimmerly, J. Rine and R. D. Kornberg, 1988
Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae. Mol. Cell. Biol.
8: 210–225.
Buck, S. W., and D. Shore, 1995 Action of a RAP1 carboxy-terminal
silencing domain reveals an underlying competition between
HMR and telomeres in yeast. Genes Dev. 9: 370–384.
Callebaut, I., J.-C. Courvalin and J.-P. Mornon, 1999 The BAH
(bromo-adjacent homology) domain: a link between DNA methylation, replication and transcriptional regulation. FEBS Lett.
446: 189–193.
Chien, C.-T., S. Buck, R. Sternglanz and D. Shore, 1993 Targeting
of SIR1 protein establishes transcriptional silencing at HM loci
and telomeres in yeast. Cell 75: 531–541.
Dillin, A., and J. Rine, 1997 Separable functions of ORC5 in replication initiation and silencing in Saccharomyces cerevisiae. Genetics
147: 1053–1062.
Emr, S. D., A. Vassarotti, J. Garrett, B. L. Geller, M. Takeda et
al., 1986 The amino terminus of the yeast F1 ATPase B-subunit
functions as a mitochondrial import signal. J. Cell Biol. 102:
523–533.
Foss, M., F. J. McNally, P. Laurenson and J. Rine, 1993 Origin
recognition complex (ORC) in transcriptional silencing and DNA
replication in S. cerevisiae. Science 262: 1838–1844.
Fox, C. A., S. Loo, A. Dillin and J. Rine, 1995 The origin recognition complex has essential functions in transcriptional silencing
and chromosomal replication. Genes Dev. 9: 911–924.
521
Fox, C. A., A. E. Ehrenhofer-Murray, S. Loo and J. Rine, 1997 The
origin recognition complex, SIR1, and the S phase requirement
for silencing. Science 276: 1547–1551.
Gardner, K. A., J. Rine and C. A. Fox, 1999 A region of the Sir1
protein dedicated to recognition of a silencer and required for
interaction with the Orc1 protein in Saccharomyces cerevisiae. Genetics 151: 31–44.
Gotta, M., F. Palladino and S. M. Gasser, 1998 Functional characterization of the N terminus of Sir3p. Mol. Cell. Biol. 18: 6110–
6120.
Hartwell, L. H., 1980 Mutants of S. cerevisiae unresponsive to cell
division control by polypeptide mating hormones. J. Cell Biol.
85: 811–822.
Hecht, A., T. Laroche, S. Strahl-Bolsinger, S. M. Gasser and M.
Grunstein, 1995 Histone H3 and H4 N-termini interact with
SIR3 and SIR4 proteins: a molecular model for the formation of
heterochromatin in yeast. Cell 80: 583–592.
Hecht, A., S. Strahl-Bolsinger and M. Grunstein, 1996 Spreading of transcriptional repressor SIR3 from telomeric heterochromatin. Nature 383: 92–96.
Hill, J. E., A. M. Myers, T. J. Koerner and A. Tzagaloff, 1986
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast 2: 163–167.
Holmes, S. G., and J. R. Broach, 1996 Silencers are required for
inheritance of the repressed state in yeast. Genes Dev. 10: 1021–
1032.
Johnson, L. M., P. S. Kayne, E. S. Kahn and M. Grunstein, 1990
Genetic evidence for an interaction between SIR3 and histone
H4 in the repression of the silent mating loci in Saccharomyces
cerevisiae. Proc. Natl. Acad. Sci. USA 87: 6286–6290.
Laurenson, P., and J. Rine, 1992 Silencers, silencing, and heritable
transcriptional states. Microbiol. Rev. 56: 543–560.
Le, S., C. Davis, J. B. Konopka and R. Sternglanz, 1997 Two
new S-phase-specific genes from Saccharomyces cerevisiae. Yeast 13:
1029–1042.
Liu, C., X. Mao and A. J. Lustig, 1994 Mutational analysis defines
a C-terminal tail domain of RAP1 essential for telomeric silencing
in Saccharomyces cerevisiae. Genetics 138: 1025–1040.
Liu, C., and A. J. Lustig, 1996 Genetic analysis of Rap1p/Sir3p
interactions in telomeric and HML silencing in Saccharomyces cerevisiae. Genetics 143: 81–93.
Loo, S., C. A. Fox, J. Rine, R. Kobayashi, B. Stillman and S. P.
Bell, 1995 The origin recognition complex in silencing cell
cycle progression and DNA replication. Mol. Biol. Cell 6: 741–756.
Lustig, A. J., C. Liu, C. Zhang and J. P. Hanish, 1996 Tethered
Sir3p nucleates silencing at telomeres and internal loci in Saccharomyces cerevisiae. Mol. Cell. Biol. 16: 2483–2495.
Lyon, M. F., 1999 X-chromosome inactivation. Curr. Biol. 9: R235–
R237.
Madhani, H. D., C. A. Styles and G. R. Fink, 1997 MAP kinases
with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91: 673–684.
Marcand, S., S. W. Buck, P. Moretti, E. Gilson and D. Shore,
1996 Silencing of genes at nontelomeric sites in yeast is controlled by sequestration of silencing factors at telomeres by Rap1
protein. Genes Dev. 10: 1297–1309.
Miller, A. M., and K. A. Nasmyth, 1984 Role of DNA replication
in the repression of silent mating type loci in yeast. Nature 312:
247–251.
Moazed, D., A. Kistler, A. Axelrod, J. Rine and A. D. Johnson,
1997 Silent information regulator protein complexes in Saccharomyces cerevisiae : a SIR2/SIR4 complex and evidence for a regulatory domain in SIR4 that inhibits its interaction with SIR3. Proc.
Natl. Acad. Sci. USA 94: 2186–2191.
Moretti, P., K. Freeman, L. Coodle and D. Shore, 1994 Evidence
that a complex of SIR proteins interacts with the silencer and
telomere-binding protein RAP1. Genes Dev. 8: 2257–2269.
Mullen, J. R., P. S. Kayne, R. P. Moerschell, S. Tsunasawa, M.
Gribskov et al., 1989 Identification and characterization of
genes and mutants for an N-terminal acetyltransferase from yeast.
EMBO J. 8: 2067–2075.
Park, E.-C., and J. W. Szostak, 1992 ARD1 and NAT1 proteins
form a complex that has N-terminal acetyltransferase activity.
EMBO J. 11: 2087–2093.
Park, Y., J. Hanish and A. J. Lustig, 1998 Sir3p domains involved
522
E. M. Stone et al.
in the initiation of telomeric silencing in Saccharomyces cerevisiae.
Genetics 150: 977–986.
Pillus, L., and J. Rine, 1989 Epigenetic inheritance of transcriptional states in S. cerevisiae. Cell 59: 637–647.
Pryde, F. E., and E. J. Louis, 1999 Limitations of silencing at native
yeast telomeres. EMBO J. 18: 2538–2550.
Reifsnyder, C., J. Lowell, A. Clarke and L. Pillus, 1996 Yeast
SAS silencing genes and human genes associated with AML and
HIV-1 Tat interactions are homologous with acetyltransferases.
Nat. Genet. 14: 42–49.
Reifsnyder, C. M., 1996 Enhancers of the sir1 mutant phenotype:
analysis of sir3 and sas silencing mutations in Saccharomyces cerevisiae. Ph.D. Thesis, University of Colorado, Boulder, CO.
Renauld, H., O. M. Aparicio, P. D. Zierath, B. L. Billington, S. K.
Chhablani et al., 1993 Silent domains are assembled continuously from the telomere and are defined by promoter distance
and strength, and by SIR3 dosage. Genes Dev. 7: 1133–1145.
Rine, J., and I. Herskowitz, 1987 Four genes responsible for a
position effect on expression from HML and HMR in Saccharomyces cerevisiae. Genetics 116: 9–22.
Rivier, D., and J. Rine, 1992 Silencing: the establishment and inheritance of stable, repressed transcription states. Curr. Opin. Genet.
Dev. 2: 286–292.
Rothstein, R., 1991 Targeting, disruption, replacement, and allele
rescue: integrative DNA transformation in yeast. Methods Enzymol. 194: 281–301.
Schiestl, R. H., and R. D. Gietz, 1989 High efficiency transformation of intact yeast cells using single stranded nucleic acids as
carrier. Curr. Genet. 16: 339–346.
Sherman, F., 1991 Getting started with yeast. Methods Enzymol.
194: 3–21.
Sherman, F., R. P. Moerschell, S. Tsunasawa, R. Sternglanz and
M. E. Dumont, 1993 Co- and post-translational processes and
mitochondrial import of yeast cytochrome c, pp. 117–141 in Translational Regulation of Gene Expression II, edited by J. Ilan. Plenum
Press, New York.
Shore, D., M. Squire and K. A. Nasmyth, 1984 Characterization
of two genes required for the position-effect control of yeast
mating-type genes. EMBO J. 3: 2817–2823.
Shore, D., D. J. Stillman, A. H. Brand and K. A. Nasmyth, 1987
Identification of silencer binding proteins from yeast, possible
roles in SIR control and DNA replication. EMBO J. 6: 461–467.
Sikorski, R. S., and J. D. Boeke, 1991 In vitro mutagenesis and
plasmid shuffling: from a cloned gene to mutant yeast. Methods
Enzymol. 194: 3–21.
Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors and
yeast host strains designed for efficient manipulation of DNA in
Saccharomyces cerevisiae. Genetics 122: 19–27.
Smith, J. S., and J. D. Boeke, 1997 An unusual form of transcriptional silencing in yeast ribosomal DNA. Genes Dev. 11: 241–254.
Stone, E. M., and L. Pillus, 1996 Activation of an MAP kinase
cascade leads to Sir3p hyperphosphorylation and strengthens
transcriptional silencing. J. Cell Biol. 135: 571–583.
Stone, E. M., and L. Pillus, 1998 Silent chromatin in yeast: an
orchestrated medley featuring Sir3p. Bioessays 20: 30–40.
Stone, E. M., M. J. Swanson, A. M. Romeo, J. B. Hicks and R.
Sternglanz, 1991 The SIR1 gene of Saccharomyces cerevisiae and
its role as an extragenic suppressor of several mating-defective
mutants. Mol. Cell. Biol. 11: 2253–2262.
Strahl-Bolsinger, S., A. Hecht, K. Luo and M. Grunstein, 1997
SIR2 and SIR4 interactions differ in core and extended telomeric
heterochromatin in yeast. Genes Dev. 11: 83–93.
Sussel, L., and D. Shore, 1991 Separation of transcriptional activation and silencing functions of RAP1: isolation of viable mutants
affecting both silencing and telomere length. Proc. Natl. Acad.
Sci. USA 88: 7749–7753.
Sussel, L., D. Vannier and D. Shore, 1993 Epigenetic switching
of transcriptional states: cis- and trans-acting factors affecting establishment of silencing at the HMR locus in Saccharomyces cerevisiae. Mol. Cell. Biol. 13: 3919–3928.
Triolo, T., and R. Sternglanz, 1996 Role of interactions between
the origin recognition complex and SIR1 in transcriptional silencing. Nature 381: 251–253.
Vega-Palas, M., S. Venditti and E. DiMauro, 1997 Telomeric
transcriptional silencing in a natural context. Nat. Genet. 15:
232–233.
Weiler, K. S., and B. T. Wakimoto, 1995 Heterochromatin and
gene expression in Drosophila. Annu. Rev. Genet. 29: 577–605.
Whiteway, M., R. Freedman, S. V. Arsdell, J. W. Szostak and J.
Thorner, 1987 The yeast ARD1 gene product is required for
repression of cryptic mating-type information at the HML locus.
Mol. Cell. Biol. 7: 3713–3722.
Communicating editor: F. Winston