Download Syndecan-1 regulates αvß5 integrin activity in B82L fibroblasts

Research Article
2445
Syndecan-1 regulates ␣v␤5 integrin activity in B82L
fibroblasts
Kyle J. McQuade1,*, DeannaLee M. Beauvais2,*, Brandon J. Burbach2 and Alan C. Rapraeger1,2,3,‡
Graduate Programs in 1Cellular and Molecular Biology, 2Molecular and Cellular Pharmacology and the 3Department of Pathology and
Laboratory Medicine, University of Wisconsin-Madison, Madison, WI 53706, USA
*These authors contributed equally to this work
‡
Author for correspondence (e-mail: [email protected])
Journal of Cell Science
Accepted 7 March 2006
Journal of Cell Science 119, 2445-2456 Published by The Company of Biologists 2006
doi:10.1242/jcs.02970
Summary
B82L mouse fibroblasts respond to fibronectin or
vitronectin via a syndecan-1-mediated activation of the
␣v␤5 integrin. Cells attached to syndecan-1-specific
antibody display only filopodial extension. However, the
syndecan-anchored cells extend lamellipodia when the
antibody-substratum is supplemented with serum, or low
concentrations of adsorbed vitronectin or fibronectin, that
are not sufficient to activate the integrin when plated alone.
Integrin activation is blocked by treatment with (Arg-GlyAsp)-containing peptides and function-blocking antibodies
that target ␣v integrins, as well as by siRNA-mediated
silencing of ␤5 integrin expression. In addition, ␣v␤5mediated cell attachment and spreading on high
concentrations of vitronectin is blocked by competition
with recombinant syndecan-1 ectodomain core protein and
by downregulation of mouse syndecan-1 expression by
mouse-specific siRNA. Taking advantage of the species-
Key words: Syndecan-1, ␣v␤5 integrin, Cell adhesion, Extracellular
matrix, Vitronectin, Proteoglycan
Introduction
Extracellular matrix proteins interact with a number of cell
surface adhesion receptors, stimulating signaling cascades that
regulate gene expression, proliferation, differentiation, cell
shape and motility (Lukashev and Werb, 1998). Most matrix
proteins contain binding domains for members of the integrin
family of heterodimeric adhesion receptors in tandem with
heparin-binding domains (HBDs) that mediate interactions
with cell surface proteoglycans. Although much study has
focused on understanding the roles of integrins in transmitting
signals from the extracellular matrix to the cell interior
(Giancotti and Ruoslahti, 1999), relatively little is known about
the roles of cell surface proteoglycans in these processes.
However, several reports suggest that the proteoglycans, and
especially the syndecans, collaborate with integrins to form
adhesion signaling complexes (Beauvais et al., 2004; Beauvais
and Rapraeger, 2003; Beauvais and Rapraeger, 2004;
Couchman et al., 2001; Thodeti et al., 2003; Woods and
Couchman, 2001).
Members of the syndecan family of cell surface
proteoglycans are expressed on all adherent cells and engage
matrix proteins including fibronectin (FN), vitronectin (VN),
thrombospondin, laminin and fibrillar collagens via heparan
sulfate (HS)-glycosaminoglycan (GAG) chains attached to
the syndecan ectodomains (Couchman et al., 2001). This
engagement communicates to the cell via functional domains
within the syndecan core protein (Beauvais et al., 2004;
Beauvais and Rapraeger, 2004; Couchman, 2003; Couchman
et al., 2001; Tkachenko et al., 2005). Several studies have
characterized functional sequences within the syndecan
cytoplasmic domains. Molecules that interact with the
syndecan cytoplasmic domains include signaling molecules
such as PKC␣, phosphatidylinositol (4,5)-bisphosphate and
Src (Kinnunen et al., 1998; Oh et al., 1997a) and scaffolding
proteins, including ezrin, syntenin and CASK (Granes et al.,
2000; Grootjans et al., 1997; Hsueh et al., 1998). Other work
has demonstrated that the syndecan extracellular and
transmembrane domains also play important roles in the
regulation of cell shape (Beauvais and Rapraeger, 2003;
Kusano et al., 2004; Liu et al., 1998; McQuade and Rapraeger,
2003; Munesue et al., 2002; Park et al., 2002; Tkachenko and
Simons, 2002). The mechanisms by which these domains
regulate cell morphology are unknown, although they
presumably interact with partners that modulate cellular
signaling pathways.
One technique for testing syndecan-dependent regulation of
cell morphology is to plate cells on syndecan-specific
antibodies. This technique targets a single syndecan family
member, compared with plating cells on matrix ligands that
engage multiple families of cell surface receptors, including
specificity of the siRNA, rescue experiments in which
human syndecan-1 constructs are expressed trace the
activation site to the syndecan-1 ectodomain. Moreover,
both full-length mouse and human syndecan-1 coimmunoprecipitate with the ␤5 integrin subunit, but fail to
do so if the syndecan is displaced by competition with
soluble, recombinant syndecan-1 ectodomain. These results
suggest that the ectodomain of the syndecan-1 core protein
contains an active site that assembles into a complex with
the ␣v␤5 integrin and regulates ␣v␤5 integrin activity.
Supplementary material available online at
http://jcs.biologists.org/cgi/content/full/119/12/2445/DC1
Journal of Cell Science
2446
Journal of Cell Science 119 (12)
multiple syndecans. When transfected to express syndecan-1
(Sdc1), proteoglycan-deficient Raji cells gain the ability to
bind to Sdc1 antibody and spread on Sdc1 antibody-coated
surfaces in two phases that depend on the syndecan
transmembrane and ectodomains, respectively (Lebakken et
al., 2000; Lebakken and Rapraeger, 1996; McQuade and
Rapraeger, 2003). Colon carcinoma cells spread when plated
on antibodies specific to syndecan-2 (Sdc2) (Park et al., 2002).
When grown on serum-coated substrata, these cells exhibit a
highly spread morphology, but revert to a rounded morphology
when treated with recombinant Sdc2 ectodomain, suggesting
an important role for this region of the core protein. Similarly,
T lymphocytes extend filopodia when plated on a substratum
comprised of antibody directed against the syndecan-4
ectodomain (Yamashita et al., 1999). Thus, antibody ligation
of syndecans can trigger signaling leading to cell spreading,
although the mechanisms of signaling are not clear.
Some studies demonstrate that the cellular response to the
extracellular matrix involves engagement and cooperative
signaling between the integrins and syndecans. One of the first
descriptions of this came from fibroblasts plated on fragments
of FN. Although cells spread when plated on the cell-binding
(e.g. integrin-binding) domain of FN, which binds the ␣5␤1
integrin, they fail to form focal adhesions unless syndecan-4
(Sdc4) is also ligated by either adding the HBD-FN or Sdc4specific antibody (Saoncella et al., 1999; Woods and
Couchman, 2000; Woods et al., 1986). Engagement of Sdc4
appears to stimulate Sdc4 oligomerization, and activation of
PKC␣, a signal required for the assembly of focal contacts and
stress fibers (Oh et al., 1997a; Oh et al., 1997b; Oh et al., 1998).
Recent work indicates that this mechanism involves Sdc4
working in concert with the ␣5␤1 integrin (Mostafavi-Pour et
al., 2003). In a similar mechanism, mesenchymal cells bind the
disintegrin domain of ADAM-12 via ␤1 integrins and interact
with the cysteine-rich domain of ADAM-12 via Sdc4 (Iba et
al., 2000); cells that overexpress Sdc4 display increased levels
of activated ␤1 integrin (Thodeti et al., 2003), an activity that
requires the Sdc4 cytoplasmic domain and PKC␣.
Sdc2 also cooperates with integrins during focal adhesion
assembly. Lewis lung carcinoma cells require both ␣5␤1
integrin and a cell surface proteoglycan to form stress fibers
and focal adhesions when plated on FN. When Sdc2 expression
levels are reduced by treatment with anti-sense RNA, the
ability of these cells to form focal adhesions is impaired
(Kusano et al., 2000). Although the mechanism by which Sdc2
stimulates the formation of focal adhesion is unknown, this
suggests that Sdc2 and Sdc4 share overlapping roles and/or
cooperate in the regulation of focal adhesion formation
(Kusano et al., 2004).
Recent work from our laboratory has demonstrated a crucial
link between Sdc1 and ␣v␤3 integrin on carcinoma cells
(Beauvais et al., 2004; Beauvais and Rapraeger, 2003).
Ligation of Sdc1 via its ectodomain to either an antibody
substratum or a matrix ligand leads to activation of the ␣v␤3
integrin. Anchorage solely via the syndecan to antibody causes
the cells to spread utilizing signaling from the activated ␣v␤3
integrin despite the fact that the integrin itself is not engaged
by a ligand. On an ␣v␤3-specific matrix ligand, such as VN,
␣v␤3-dependent cell spreading and cell migration is blocked by
short-interfering RNA (siRNA) blockade of Sdc1 expression,
or by competition with recombinant Sdc1 ectodomain (S1ED).
The activity of other integrins, such as the ␣5␤1 or ␣v␤1
integrins, is not affected by these treatments. Moreover, the
siRNA blockade of endogenous human Sdc1 activity can be
reversed by expression of a glycosylphosphatidylinositollinked mouse Sdc1 ectodomain (mS1ED), albeit the
ectodomain must retain its HS chains, presumably to engage
the matrix. This suggests that this domain of the core protein
of the proteoglycan mediates its association into a cell surface
complex that regulates ␣v␤3 activity.
Here, we describe similar techniques to examine the role of
Sdc1 in adhesion signaling of mouse B82L fibroblasts. We find
that anchorage of Sdc1 by syndecan-specific antibody primes
the cells to respond to low concentrations of VN or FN,
concentrations that would otherwise fail to trigger a cellular
response. Although integrin inhibitory peptides and antibodies
demonstrate a role for an ␣v-containing integrin, the cells do
not express the ␣v␤3 integrin. Rather, they express ␣v␤5 – a
closely related but distinct family member. siRNA blockade of
␤5-subunit expression confirms that ␣v␤5 is the target of Sdc1.
Regulation of ␣v␤5 integrin activity does not require the HSGAG chains of Sdc1 – something that distinguishes Sdc1mediated regulation of the ␣v␤5 integrin from its regulation of
␣v␤3. However, interactions of the ectodomain of the core
protein of Sdc1 are required for the regulation of both integrin
heterodimers because activity is blocked by competition with
S1ED protein and by selective downregulation of Sdc1
expression by siRNA. These data extend the emerging role of
Sdc1 as a regulator of integrin activation.
Results
Sdc1 mediates spreading in B82L fibroblasts
B82L mouse fibroblasts express approximately equal amounts
of Sdc1 and Sdc4, and a lesser amount of Sdc2 (Ott and
Rapraeger, 1998). In this work, we questioned the potential
signaling activity of Sdc1 during B82L-cell adhesion and
spreading. Although Sdc1 binds to matrix ligands via its HSGAG chains, these matrix ligands are likely to bind other
syndecans and integrins, thus confusing the adhesion assay.
Therefore, the cells were plated on a nitrocellulose substratum
coated with mouse Sdc1-specific antibody mAb 281.2. Within
15-20 minutes of plating, 60-90% of the adherent cells extend
numerous filopodia up to 20 ␮m from the cell body (Fig. 1C).
This response is specific for Sdc1, because cells plated on
antibody against Sdc4, which is expressed at equivalent levels
on these cells, bind via Sdc4 but fail to spread (Fig. 1E).
The filopodial extension observed upon Sdc1 ligation is only
a partial spreading response compared with the response of
cells grown in serum. Indeed, adding 10% serum to the plating
medium induces cells adherent to mAb 281.2 to spread more
extensively (Fig. 1D). This response is specific for Sdc1,
because cells adhering to Sdc4-specific antibody (Fig. 1F) or
plated on non-specific antibody (Fig. 1B) fail to spread in
response to serum.
Sdc1 ligation enhances cell spreading on low levels of
VN and FN
Although the nitrocellulose substratum coated with antibody is
blocked with BSA, it appears that small amounts of matrix
ligand in serum are sufficiently adsorbed to the substratum to
stimulate signaling through an integrin that is activated when
Sdc1 is ligated. Indeed, when antibody-coated and blocked
Journal of Cell Science
Syndecan-1 regulates ␣v␤5 integrin
Fig. 1. Sdc1 mediates cell spreading in B82L fibroblasts. B82L cells
were plated on nitrocellulose coated with 60 ␮g/ml non-immune
mouse IgG (A,B), 60 ␮g/ml mAb 281.2 (C,D) or 200 ␮g/ml S4ED
pAb (E,F). Fetal bovine serum (FBS) (10%) was added to cells
plated in B, D and F. Cells were incubated for 2 hours then fixed with
paraformaldehyde and stained with Rhodamine-conjugated
phalloidin. Bar, 50 ␮m.
substrata are pre-incubated with serum and then washed prior
to the addition of cells, complete spreading still occurs (data
not shown), duplicating the spreading response seen in the
presence of serum (cf. Fig. 1D).
To directly test whether small amounts of VN and FN are
capable of modulating cell spreading, B82L fibroblasts were
2447
added to wells on which Sdc1 antibody was co-coated with
limiting dilutions of VN (Fig. 2) and FN (see Fig. S1 in
supplementary material). In the absence of Sdc1-specific
antibody, B82L-cell binding and spreading requires relatively
high plating concentrations of VN (5 ␮g/ml) or FN (60 ␮g/ml).
Even a twofold reduction in this amount completely abolishes
binding (data not shown). However, cells in which Sdc1 is
engaged by plating on mAb 281.2 (which normally induces
filopodial extension) will spread with a fusiform morphology
when as little as 0.2 ␮g/ml VN or 1 ␮g/ml FN, a level that by
itself is insufficient to sustain adhesion, is co-plated with the
antibody.
One possible explanation for increased sensitivity to these
matrix ligands is that the Sdc1 bound to antibody simply
tethers cells to the substratum and facilitates their interaction
with low levels of matrix ligands to which cells would normally
not adhere. To test this possibility, cells were plated on
substrata co-coated with an antibody directed against the
ectodomain of Sdc4, a syndecan that is expressed at equal
levels to Sdc1 (Ott and Rapraeger, 1998). Because of their
anchorage to the antibody, cell binding is seen either with
antibody alone or with the mixed antibody and matrix ligand
substrata (Fig. 2 and supplementary material Fig. S1).
However, the cells fail to spread on Sdc4 antibody alone or
when the antibody is supplemented with low concentrations of
VN or FN. They spread only when VN or FN reaches a
concentration that promotes adhesion and spreading on its
own, e.g. 5 ␮g/ml VN and 60 ␮g/ml FN (Fig. 2 and
supplementary material Fig. S1). This demonstrates that
anchorage to the substratum by itself is insufficient for the
matrix-dependent spreading response, and suggests that Sdc1
ligation is required to ‘activate’ B82L cells to interact with and
respond to low levels of VN and FN.
Response to VN and FN requires the ␣v␤5 integrin
The classical receptors for VN and FN are members of the
integrin family of heterodimeric adhesion receptors. Interactions
between integrins and these extracellular matrix proteins are
mediated largely by Arg-Gly-Asp (RGD)-sequences found
Fig. 2. Vitronectin induces
complete spreading of B82L
fibroblasts. B82L cells were
plated on wells co-coated with
increasing amounts of VN and
60 ␮g/ml mAb 281.2, 150
␮g/ml S4ED pAb or in the
absence of antibody. Cells were
allowed to spread 2 hours
before fixation and labeling
with Rhodamine-phalloidin.
Bar, 50 ␮m.
Journal of Cell Science
2448
Journal of Cell Science 119 (12)
within many matrix proteins. Indeed, the spreading of B82L cells
on either VN or FN alone, or on a mixed substratum with Sdc1specific antibody, is blocked by RGD-containing peptides,
including the cycloRGDfV peptide (Aumailley et al., 1991;
Brooks et al., 1996) known to specifically target ␣v-containing
integrins (see Fig. S2 in supplementary material). Similar results
(data not shown) are obtained by treating cells with mAb
H9.2B8, an antibody that blocks mouse ␣v integrin function
(Moulder et al., 1991). The ␣v␤1 and ␣v␤3 integrins are
expressed on fibroblasts and are well-known to act as VN or FN
receptors (Sanders et al., 1998). The ␣v␤5 integrin has also been
shown to be involved in fibroblast cell spreading on VN and FN
(Pasqualini et al., 1993; van Leeuwen et al., 1996), although its
recognition of FN is more controversial. Analysis of integrin
expression of the B82L cells by flow cytometry shows that they
express the ␣v integrin subunit, but relatively low amounts of the
␤1 integrin subunit and little or no ␤3 (Fig. 3A). Furthermore,
B82L fibroblasts treated with ␤1 or ␤3 integrin inhibitory
antibodies, mAb HM␤1-1 (Noto et al., 1995) or mAb 2C9.G2
(Yasuda et al., 1995), respectively, or with both antibodies
together, show no effect on adhesion or spreading on Sdc1
antibody plus VN or FN or on high concentrations of matrix
ligand alone (data not shown).
These data suggest the ␣v␤5 integrin as a candidate for Sdc1
regulation. Unfortunately, neither inhibitory antibodies to the
mouse ␤5 subunit nor antibodies amenable for use in flow
cytometry are currently available. However, Ab1926 binds the
cytoplasmic domain of the ␤5 subunit and western blot analysis
of B82L cell lysates shows expression of this integrin subunit
(Fig. 3B). To test the role of the ␣v␤5 integrin in Sdc1-regulated
cell spreading, an siRNA oligonucleotide specific for the
mouse ␤5 subunit was used to block ␣v␤5 integrin expression.
Transfection of cells with this siRNA reduces expression of
␣v-containing integrin by approximately 90%, as shown by
monitoring ␣v integrin expression by flow cytometry (Fig. 3A).
This correlates with a similar reduction in ␤5 subunit
expression upon treatment with a range of siRNA
concentrations on western blots (Fig. 3B,C). The siRNA has
no effect on expression of mouse Sdc1 or that of other integrin
␤-subunits (Fig. 3A). Finally, it is observed that cells treated
with 800 nM siRNA to block expression of ␤5 integrin fail to
respond to either VN or FN when plated on these ligands
together with Sdc1 antibody, even at high concentrations of
VN or FN that are sufficient to promote cell spreading
without Sdc1 antibody (Fig. 3D and supplementary material
Fig. S3). Cells plated on Sdc1 antibody alone, which normally
extend filopodia (Fig. 1C), continue to do so despite the
blockade of ␤5 integrin expression (inset, Fig. 3D), which
indicates that the ␣v␤5 integrin is not required for this
spreading response.
Fig. 3. siRNA blockade of ␤5subunit expression blocks
syndecan-induced cell
spreading. (A) Suspended cells
are analyzed by flowcytometry with antibodies
capable of recognizing mouse
␤1 (HM␤1-1), ␤3 (2C9.G2) or
␣v (H9.2B8) integrin subunits,
mAb 281.2 specific for mouse
Sdc1, or nonspecific IgG
control (gray fill). Cells treated
with ␤5-integrin-specific or
control siRNA are compared.
(B) Representative western
blot of lysates of cells treated
with 0, 200, 400, 600 or 800
nM ␤5-specific siRNA and
probed for expression of ␤5integrin subunit. FAK
expression levels are shown as
a loading control. (C)
Quantification (± s.e.) of
relative ␤5 integrin subunit
expression from duplicate blots
as described in (B). (D) B82L
cells were plated on wells
coated with 60 ␮g/ml mAb
281.2 and increasing amounts
of VN after treatment with ␤5integrin-specific or control
siRNA. Cells were allowed to
spread 2 hours before fixation
and labeling with Rhodaminephalloidin. Bar, 50 ␮m.
Syndecan-1 regulates ␣v␤5 integrin
(directed against the 3⬘-untranslated region) and subsequently
replaced either by expression of human Sdc1 constructs or
a mouse Sdc1 construct, comprised of GPI-linked mouse
Sdc1 ectodomain alone (GPI-mS1ED) that lacks the siRNAtargeting sequence (Fig. 4 and supplementary material Fig.
S4). Transfection with siRNA efficiently silences endogenous
mouse Sdc1 by ~98% as indicated by FACS (Fig. 4A and
Journal of Cell Science
␣v␤5-dependent cell attachment and spreading requires
the Sdc1 ectodomain but not its HS-GAG chains
The loss of Sdc1-regulated cell spreading in cells transfected
with ␤5 siRNA indicates that the ␣v␤5 integrin is the ␣v-bearing
integrin targeted by the syndecan. To test what domain(s) of
the syndecan is required for this activity, endogenous mouse
Sdc1 expression was silenced with mouse-specific siRNA
2449
Fig. 4. Downregulation of mouse Sdc1 expression by siRNA blocks
␣v␤5-dependent cell attachment and spreading on vitronectin. FACS
or immunoblot analysis for (A,F) mouse Sdc1 (mAb 281.2), (B) ␣v
integrin subunit (mAb H9.2B8), (C) mouse Sdc4 (mAb KY8.2), (D)
human Sdc1 (mAb B-B4) and (E) FcRecto-hS1 chimera (FITCconjugated hIgG) expression against isotype IgG controls (red fill) in
vector NEO (A-C), human Sdc1 (D), FcRecto-hS1 (E) and GPI-mS1ED
(F) expressing B82L cells 48 hours after transfection with either 600
nM control (Control) or mouse Sdc1-specific siRNA (siRNA). (G)
B82LNEO empty vector-transfected control cells and B82L cells
expressing human Sdc1, the FcRecto-hS1 or GPI-mS1ED chimera
were transfected with control or mouse Sdc1-specific siRNA and seeded on wells coated with either 5 ␮g/ml VN alone or a mixed substratum
of VN plus 60 ␮g/ml of antibody directed against mouse Sdc1 (281.2), human Sdc1 (B-B4) or the FcRecto-hS1 chimera (hIgG). Cells were
incubated at 37°C for 2 hours, fixed and stained with Rhodamine-conjugated phalloidin. Bar, 50 ␮m.
Journal of Cell Science
2450
Journal of Cell Science 119 (12)
supplementary material Fig. S4A) and western blot analysis
(Fig. 4F). Importantly, the mouse Sdc1 siRNA does not affect
the expression of ␣v␤5, as indicated by western blotting (data
not shown) and FACS analysis of the ␣v integrin subunit (Fig.
4B), and does not affect the expression of endogenous mouse
Sdc4 (Fig. 4C) or the ectopic human Sdc1 (Fig. 4D-E and
supplementary material Fig. S4B-C) and GPI-mS1ED (Fig.
4F) constructs. These results suggest that the siRNA is both
species and syndecan-type specific.
In contrast to parental or control siRNA-transfected cells,
B82L vector-control cells (NEO) transfected with mouse Sdc1siRNA fail to attach and spread to wells coated with either
5 ␮g/ml of VN alone (Fig. 4G, right column) or a mixed
substratum of 5 ␮g/ml of VN plus 60 ␮g/ml of mAb 281.2 (Fig.
4G, left column). The failure of these cells to even engage the
mixed substratum clearly indicates the efficient blockade of
mouse Sdc1 expression by siRNA. It is unlikely that the mouse
Sdc1-siRNA treatment has any non-specific cellular effects
since spreading on VN alone or on a mixed substratum of VN
plus Sdc1 antibody (60 ␮g/ml mAb B-B4) is specifically
rescued by the expression of full-length human Sdc1 (hS1,
Fig. 4G). Notice that B82L-hS1 cell spreading on VN alone
is indistinguishable from either parental or NEO cells.
Intriguingly, similar rescue was observed in cells expressing
human Sdc1 mutants, hS1pLeuTM and hS1⌬cyto (see Fig. S4D
in supplementary material), indicating that neither the
transmembrane nor the cytoplasmic domain of the syndecan is
required for the spreading response. This was further confirmed
with cells that express GPI-linked Sdc1 ectodomain alone (GPImS1ED, Fig. 4G). Cells expressing this chimera recover
spreading on a VN substratum, either in the presence or absence
of Sdc1 antibody. However, cells expressing the FcRecto-hS1
chimera – a construct in which the ectodomain of syndecan is
replaced by that of the human Fc␥ receptor Ia (FcRecto-hS1, Fig.
4G) – fail to recover spreading, regardless of whether the cells
are plated on VN alone or VN is supplemented with 60 ␮g/ml
of hIgG to engage the FcRecto-hS1 construct. These results
suggest that ␣v␤5 integrin activity depends on Sdc1 expression
and that the ectodomain of syndecan is both necessary and
sufficient to regulate such activity.
The regulation of ␣v␤3 integrin activity by Sdc1 on matrix
ligands has been shown to require syndecan engagement of the
matrix via its HS chains (Beauvais et al., 2004). To test the
GAG requirement for ␣v␤5 activity, cells were pretreated for 2
hours with HS-specific and chondroitin-sulfate-specific lyases
and plated in the presence of these enzymes (Fig. 5). Treated
B82L cells fail to bind HBD-FN (used as a test for the efficacy
of GAG removal) whereas untreated cells bind and rapidly
extend filopodia, assuming morphologies similar to that seen
when cells are bound to a Sdc1 antibody substratum (Fig.
5A,B). However, GAG removal has no effect on the filopodial
extension or complete cell spreading observed either on Sdc1
antibody alone (Fig. 5C-E), antibody mixed with low
concentrations of VN (Fig. 5F-H) or FN (Fig. 5H), or high
concentrations of VN (Fig. 5I-K) or FN alone (Fig. 5K).
The failure of GAG removal to affect the Sdc1-dependent
cell spreading suggests that signaling leading to spreading
relies on an interaction with the syndecan core protein. To test
this, B82L cells were plated on 5 ␮g/ml VN in the presence of
a recombinant GST fusion protein containing either the
ectodomain of mouse Sdc1 (GST-mS1ED) or human Sdc1
(GST-hS1ED; data not shown). Because the fusion protein is
Fig. 5. GAG chains are not required for filopodial
extension or complete B82L cell spreading. B82L
cells were detached using EDTA and treated in
suspension either without (A,C,F,I) or with a
combination of heparinases I and III and
chondroitin ABC lyases (B,D,G,J) for 2 hours
before plating on 200 ␮g/ml HBD-FN (A,B), 60
␮g/ml mAb 281.2 (C,D), 60 ␮g/ml plus 1 ␮g/ml
VN (F,G) or 5 ␮g/ml VN (I,J). Quantification of
treated (white bars) or untreated (gray bars) cell
extension of filopodia on 60 ␮g/ml mAb 281.2 (E)
or complete cell spreading on mAb 281.2
supplemented with 1 ␮g/ml VN or 3 ␮g/ml FN
(H) or complete cell spreading on 5 ␮g/ml VN or
60 ␮g/ml FN (K) is also shown. Bar, 50 ␮m.
Journal of Cell Science
Syndecan-1 regulates ␣v␤5 integrin
Fig. 6. B82L-cell spreading on VN is blocked by recombinant S1ED.
(A) B82L fibroblasts were plated on 5 ␮g/ml VN in the absence of
other treatment, or in the presence of 30 ␮M GST, 1-30 ␮M GSTmS1ED or 30 ␮M GST-mS4ED (inset), then fixed and stained with
Rhodamine-phalloidin for visualization. (B) Quantification of cell
adhesion in triplicate samples (± s.e.) plated either with no additions,
or concentrations of GST-mS1ED ranging from 0-30 ␮M. Bar, 50 ␮m.
derived from bacteria, it does not contain attached GAG chains.
GST-mS1ED and hS1ED display similar activity; competition
occurs at the lowest concentration tested (1 ␮M) with
increasing blockade of cell attachment and spreading over a
concentration range of 1-30 ␮M of S1ED (Fig. 6A,B). Similar
results are obtained with GST-mS1ED and B82L-hS1 cells
attached to a mixed substratum of mAb B-B4 and 1 ␮g/ml VN
(data not shown). Notice that, mS1ED is not recognized by the
human specific mAb B-B4 and thus does not compete for
human Sdc1 engagement of the antibody substratum.
Moreover, the fusion protein has no effect on the ability of
2451
Fig. 7. Co-immunoprecipitation of ␤5 integrin with Sdc1 requires the
Sdc1 ectodomain. Western blots probed with rabbit polyclonal ␤5
integrin (A,B), pan-syndecan or S1ED (C) antibody for detection of
␤5 integrin and Sdc1, respectively, in immune complexes isolated
after immunoprecipitation of full-length mouse Sdc1 (mAb 281.2),
human Sdc1 constructs (mAb B-B4) and FcRecto-hS1 chimera (mAb
10.1) from pre-cleared B82L whole-cell lysates. In S1EDcompetition experiments (A), 30 ␮M soluble GST, GST-mS1ED
(with mAb B-B4) or GST-hS1ED (with mAb 281.2) was added to
the reaction mixture. Provided as a reference is a methanol
precipitation (MeOH) of 300 ␮g of whole-cell lysate. ␤5 integrin
immunoblotting reveals a 110 kDa band, under reduced conditions,
detectable in the mouse Sdc1 and select human Sdc1 (hS1, pLTM,
⌬cyto), but not FcRecto-hS1 chimera immunoprecipitates or
immunoprecipitates isolated with antibody isotype control IgG:
mouse IgG1 (mIgG) for mAbs B-B4 and 10.1 and rat IgG2A (rIgG)
for mAb 281.2.
these cells to extend filopodia when plated on an antibody
substratum alone (data not shown). Competition with 30 ␮M
GST alone is without effect in all cases, as is competition with
identical concentrations of recombinant GST-mS4ED
indicating that competition for syndecan-regulated ␣v␤5
activity is S1ED-specific.
Further, immunoprecipitation of Sdc1 (Fig. 7C) with
monoclonal antibodies directed against endogenous mouse
Sdc1 (281.2) or ectopically expressed human Sdc1 constructs
(B-B4) reveals ␤5 integrin (Fig. 7A,B) in the immune
complexes isolated from B82L-NEO, B82L-hS1, B82LhS1pLeuTM and B82L-hS1⌬cyto cell lysates. Similar results were
obtained with an affinity-purified pan-syndecan antibody that
Journal of Cell Science
2452
Journal of Cell Science 119 (12)
recognizes the ten C-terminal amino acids of Sdc1 with the
exception of hS1⌬cyto, which lacks these amino acids (data not
shown). ␤5 integrin is not detectable in mAb B-B4 isolated
immune complexes from B82L-NEO cells that are not
expressing human Sdc1 (data not shown) nor in isotype IgG
controls (Fig. 7A,B, mIgG and rIgG). Moreover, ␤5 integrin is
not present in immune complexes isolated from B82L-NEO
cell lysates using mAb KY8.2 (Fig. 7A) – an antibody directed
against mouse Sdc4 (Yamashita et al., 1999). These results
indicate that Sdc1 and the ␤5 integrin are present in a cell
surface complex and Sdc1-specific association within this
complex is conserved between mouse and human. By contrast,
␤5 integrin is not detectable with immunoprecipitated FcRectohS1 chimera isolated by mAb 10.1 (Fig. 7B,C), human IgG or
pan-syndecan antibody (data not shown) from FcRecto-hS1expressing cells, but is associated with the endogenous mouse
Sdc1 immunoprecipitated with mAb 281.2 (Fig. 7B). This
supports the conclusion that association of the syndecan with
the ␤5 integrin depends on the Sdc1 ectodomain. To test this
more directly, the immunoprecipitations were conducted with
species-specific Sdc1 antibody in the presence of 30 ␮M GSTS1ED protein (competitive inhibitor of the integrin activation)
from the opposite species (e.g. mS1ED with human-specific BB4 and hS1ED with mouse-specific 281.2 to avoid recognition
by the antibody). This demonstrates that GST-S1ED protein
efficiently disrupts the association of the ␤5 integrin with Sdc1
(Fig. 7A, S1ED). Addition of GST alone is without effect (Fig.
7A, GST). These results suggest that the inhibition observed
in the VN cell spreading assays upon treatment with soluble
S1ED protein (Fig. 6) is due to perturbation of the association
of ␣v␤5 integrins with cell surface Sdc1 leading to a loss in
integrin activity.
Discussion
The ␣v␤5 integrin is expressed on a variety of tissues and cell
types, including endothelia, epithelia and fibroblasts (FeldingHabermann and Cheresh, 1993; Pasqualini et al., 1993). It is
closely related to the ␣v␤3 integrin (56.1 % identity and 83.5%
homology between the two integrin ␤-subunits) but is
distinguished from the ␣v␤3 by divergent sites near its ligandbinding domain and within the C-terminus of its cytoplasmic
domain (McLean et al., 1990). It has a role in matrix adhesion
to VN, FN, SPARC and bone sialoprotein (Plow et al., 2000)
and is implicated in the invasion of gliomas and metastatic
carcinoma cells (Brooks et al., 1997; Jones et al., 1997; Tonn
et al., 1998), the latter especially to bone (De et al., 2003). A
second major role is in endocytosis, including endocytosis of
VN (Memmo and McKeown-Longo, 1998; Panetti and
McKeown-Longo, 1993; Panetti et al., 1995), the engulfment
of apoptotic cells by phagocytes (Albert et al., 2000) and
participation in the internalization of shed outer rod segments
in the retinal pigmented epithelium (Finnemann, 2003a;
Finnemann, 2003b; Hall et al., 2003). A third major role is in
growth-factor-induced angiogenesis, where cooperative
signaling by the ␣v␤5 integrin and growth factors regulates
endothelial cell proliferation and survival. Angiogenesis
promoted by VEGF and TGF␣ in human umbilical-vein
endothelial cells relies on signaling together with the ␣v␤5
integrin, whereas FGF-2 and tumor necrosis factor-␣
collaborate with the ␣v␤3 integrin (Eliceiri and Cheresh, 1999;
Friedlander et al., 1995).
Several studies have demonstrated that members of the
syndecan family of cell adhesion receptors cooperate with
integrins to mediate signals that regulate cytoskeletal
rearrangements and cell shape. Work from this laboratory has
described a prominent role for Sdc1 in regulating the activity
of the ␣v␤3 integrin in MDA-MB-231 and MDA-MB-435
breast carcinoma cells (Beauvais et al., 2004; Beauvais and
Rapraeger, 2003). Although the mechanism remains unclear, a
region of the Sdc1 ectodomain appears to regulate the active
state and signaling of the integrin. Experiments presented here
describe a similar mechanism by which Sdc1 regulates the
activity of the ␣v␤5 integrin in murine B82L fibroblasts. These
cells are particularly useful for this study because they express
a limited repertoire of integrin receptors, dominated by the
␣v␤5 integrin.
Ligation of Sdc1 alone, using a substratum consisting of
syndecan-specific antibody or the HBD-FN, leads to B82L-cell
adhesion but incomplete cell spreading, e.g. the extension of
filopodia, suggesting that ligation of the syndecan alone
generates a signal. Prior work with Sdc1 expressed in Raji
lymphoid cells demonstrated that ligation of Sdc1 generates
two phases of signaling. The first results in formation of a
broad lamellipodium and depends on the Sdc1 transmembrane
domain; the second induces cell polarization, an activity that
traces to the Sdc1 ectodomain (McQuade and Rapraeger,
2003). Like the Raji cell-signaling responses, the Sdc1mediated filopodial extension seen here does not require the
Sdc1 cytoplasmic tail (data not shown) and appears to be
integrin-independent. It is not blocked by treatment of the cells
with RGD peptides, soluble S1ED protein, which perturbs a
syndecan-integrin interaction, or siRNA-targeted silencing of
integrin expression. However, providing trace amounts of VN
or FN to B82L cells already anchored to a Sdc1 antibody
reveals an integrin-related activity of the syndecan, namely,
extensive cell spreading via syndecan-regulated signaling of
the ␣v␤5 integrin. These data might help explain the apparent
link between Sdc1 and ␣v␤5-dependent turnover of VN
(Wilkins-Port et al., 2003). The regulation of integrin activity
by Sdc1 might occur either by altering integrin activation
and/or by altering integrin signaling in response to the ligand
(i.e. post-receptor occupancy events). Integrin activation or
‘priming’ (Carman and Springer, 2003) is classically defined
as adopting the conformation necessary to bind ligand, often a
response to inside-out signaling. However, the integrin can also
be regulated by lateral interactions with other membrane
proteins. Examples of receptors that regulate integrin activation
through lateral interactions include uPAR/CD87 and
IAP/CD47, which regulate ␣v␤3- and ␣v␤5-binding to VN and
adhesion-dependent signaling events, tetraspanins, and
chondroitin sulfate proteoglycan NG2, which interacts with the
␣4␤1 integrin (Dedhar, 1999; Iida et al., 1998; Iida et al., 2001;
Kugler et al., 2003; Porter and Hogg, 1998). Integrin activation
is also enhanced by its binding to matrix ligand, which
stimulates ‘outside-in’ signals necessary for cell spreading.
These include activation of FAK, Rho GTPases, PI3-kinase and
other pathways (Carman and Springer, 2003; Dedhar, 1999;
Liddington and Ginsberg, 2002).
In the B82L fibroblasts, it is envisioned that the syndecan
assembles into a cell surface signaling complex that is
necessary for ␣v␤5 integrin signaling (Fig. 8), although it is not
entirely clear what other receptors, if any, are in the complex.
2453
Journal of Cell Science
Syndecan-1 regulates ␣v␤5 integrin
Fig. 8. Model of Sdc1-regulated ␣v␤5-integrin signaling.
What are the features of this complex? One feature is that
anchorage of the syndecan to the substratum appears to lower
the threshold for integrin activation by VN or FN. Thus, if Sdc1
is engaged by antibody, then low concentrations of matrix
ligand appear sufficient to activate the integrin and lead to
signaling. The simplest explanation would be that the syndecan
simply anchors the cell to the substratum so that the integrin
can engage the limited amounts of matrix ligand. However, this
explanation appears to be ruled out by the fact that engagement
of Sdc4 with antibody, which also anchors the cells to the
substratum, does not result in ␣v␤5 integrin-dependent
signaling. Alternatively, it is possible that the specificity arises
from Sdc1 and ␣v␤5 integrin being in a complex together, such
that anchorage of Sdc1 clusters the integrin as well as bringing
it into close apposition to the matrix ligands – a contention
strongly supported by the immunoprecipitation data presented
here. As such, cells adhering via Sdc4 are presumably not
primed to bind VN and FN, because Sdc4, which possesses a
very different ectodomain (both in size and sequence) relative
to Sdc1, fails to interact with the integrin.
A second feature is that the syndecan HS chains are not
required for integrin activation, either on syndecan antibody or
on matrix ligand. The syndecan HS chains, at least on the B82L
cells, do not appear to bind VN or FN sufficiently well for the
cells to strongly adhere, and cell binding occurs only at
sufficiently high matrix concentrations for the integrin to
become engaged. Here, the high concentration of matrix ligand
can presumably bind and activate the integrin and trigger
outside-in signaling. Nonetheless, this signaling also requires
Sdc1, because the third feature of this complex is that the
Journal of Cell Science
2454
Journal of Cell Science 119 (12)
integrin-mediated cell adhesion and spreading on these matrix
ligands is blocked by recombinant S1ED and by selective
downregulation of Sdc1 expression with siRNA. Integrinmediated cell spreading on VN is rescued in mouse Sdc1siRNA transfected cells by expression of full-length human
Sdc1 or GPI-mS1ED, which contains only the Sdc1
ectodomain, but not by a Sdc1 mutant lacking its ectodomain
(FcRecto-hS1). Moreover, immunoprecipitation of the syndecan
brings down ␤5 integrin with full-length Sdc1, either mouse or
human, but not with FcRecto-hS1, despite the fact that this
chimera retains the human Sdc1 transmembrane and
cytoplasmic domains.
These features suggest that the syndecan and the integrin are
in a complex together and that interactions of the Sdc1
ectodomain within the complex, which can be disrupted by
soluble S1ED or by siRNA-mediated removal of the syndecan
from the cell surface, are necessary for ␣v␤5-integrin signaling.
Whether the interaction of the syndecan with the integrin is
direct or indirect is not yet known, but it is known that
sequences within the ␤5 ectodomain regulate integrin postligand-binding signaling events (Filardo et al., 1996). This
suggests that ␣v␤5-dependent cellular responses depend on
signals transmitted by the syndecan as a laterally associated
protein, to include the activation of PKC, which is required for
␣v␤5-dependent cell spreading and migration (Klemke et al.,
1994; Lewis et al., 1996; Yebra et al., 1995) and endocytosis
of VN (Panetti et al., 1995).
This model is similar to the regulation of the ␣v␤3 integrin
in mammary carcinoma cells (Beauvais et al., 2004), but has
two significant differences. First, activation of the ␣v␤3 integrin
by Sdc1 requires that the Sdc1 ectodomain is engaged, either
directly to antibody or via its HS chains to a matrix ligand.
Surprisingly, ligation of the syndecan alone is sufficient to
activate ␣v␤3, but activation of the integrin is specific for Sdc1,
because it cannot be recapitulated by adhesion of the cells via
Sdc4. Heparinase removal of the HS chains (unpublished data)
or expression of a Sdc1 mutant lacking HS chains prevents
␣v␤3 signaling when mammary carcinoma cells are plated on
VN. By contrast, ␣v␤5 activation in B82L cells still occurs
on VN after removal of the HS chains of syndecan with
heparinases. In this case, ligation of the syndecan is rendered
moot for the simple reason that Sdc1 is probably constitutively
associated with the ␤5 integrin and it is this association that
appears important for ␣v␤5-dependent signaling. Therefore,
regardless of whether one or both receptors engage the
substratum, engagement of one is sufficient to localize the
other into the signaling complex via an ectodomain interaction.
In the case of ␣v␤3-integrin signaling, however, engagement of
the syndecan to the substratum is probably required to bring
the syndecan and integrin together in a complex. Second,
anchorage of the Sdc1 alone to the substratum, e.g. to a Sdc1specific antibody, is sufficient to activate signaling from the
␣v␤3 integrin in mammary carcinoma cells, whereas the ␣v␤5
integrin on B82L fibroblasts does not signal upon syndecan
engagement unless the integrin is also provided with a ligand.
This suggests that the ␣v␤3 integrin in epithelial cells does not
need to perform an adhesion role per se, but transduces signals
when activated by syndecan engagement. The integrin could
contribute by directly assembling into a signaling complex
with the syndecan or could act as a downstream effector that
relays signals required to reorganize the cytoskeleton. An
opposite result is observed for the ␣v␤5 integrin in B82L cells.
Here, the syndecan does not need to perform an adhesion role,
but does need to be in a complex with the ␣v␤5 integrin in order
for the integrin to engage the matrix and transduce signals.
Association of the integrin with the syndecan via the
ectodomain may be required for the integrin to adopt an active
conformation, to localize the integrin to a particular membrane
microdomain and/or to associate with certain downstream
effectors. Although these differences may be subtle, they may
provide insight into different mechanisms by which the
syndecan regulates these two related integrins.
Materials and Methods
Cell culture and molecular biology
B82L mouse fibroblasts (provided by Paul Bertics, University of WisconsinMadison) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)
supplemented with 10% FBS, 4 mM L-glutamine and antibiotics, as previously
described (Ott and Rapraeger, 1998). Human Sdc1 cDNA was provided by Markku
Jalkanen (University of Turku, Finland) in pBGS. The coding sequence was PCR
amplified from pBGS, cloned into the KpnI and XhoI sites of pcDNA3 (Invitrogen)
and verified by sequencing. Human Sdc1 mutants in pcDNA3, including FcRectohS1 (a chimera comprised of the ectodomain of human IgG Fc␥ receptor Ia/CD64
fused to the transmembrane and cytoplasmic domains of human Sdc1), hS1⌬cyto
(lacking the 33 C-terminal amino acids) and hS1pLeuTM (transmembrane domain
replaced with leucine residues), were constructed with human-specific primers
and/or methods previously described (McQuade and Rapraeger, 2003). GPI-mS1ED
(Liu et al., 1998), a chimera comprised of the ectodomain of mouse Sdc1 fused to
the glycosylphosphatidylinositol (GPI) tail of rat glypican-1, in pcDNA3 was
generously provided by Ralph Sanderson (University of Arkansas for Medical
Sciences, Little Rock, AR). Cells were transfected with pcDNA3 alone, human Sdc1
expression constructs or GPI-mS1ED using LipofectAMINE (Invitrogen) and the
highest 10% of cells immunoreactive for mAb B-B4 (full-length hS1, hS1⌬cyto and
hS1pLeuTM), mAb 281.2 (GPI-mS1ED) and mAb 10.1 (FcRecto-hS1) were sorted by
flow cytometry. After sorting, the cells were maintained in medium containing 300
␮g/ml geneticin (Gibco BRL). Cells were passaged 1:20 every 3 days and grown
to 60-80% confluency for experiments.
Cell-spreading assays
Cell-spreading assays were performed with modification to our previous procedures
(Lebakken and Rapraeger, 1996). Briefly, ligands were applied to nitrocellulosecoated ten-well slides (Erie Scientific) and incubated for 1-2 hours at 37°C. Ligands
used in this study include the Sdc1-specific mAb 281.2 (Jalkanen et al., 1985) and
mAb B-B4 (Serotec), an affinity-purified rabbit polyclonal antibody (S4ED pAb)
generated against the mouse Sdc4 ectodomain (amino acids 1-120) fused to the Cterminus of glutathione-S-transferase (GST-mS4ED; (McFall and Rapraeger, 1998),
human plasma VN and FN and recombinant HBD-FN. A GST fusion protein
consisting of either mouse or human S1ED (mS1ED, amino acids 1-233 or hS1ED,
amino acids 1-232) was also used as a competitor in cell adhesion studies (Beauvais
and Rapraeger, 2003; McFall and Rapraeger, 1998). Slides were blocked with 1%
heat-denatured bovine serum albumin (hdBSA) for a minimum of 30 minutes at
37°C. B82L cells were detached from the substratum using 5 mM EDTA in Trisbuffered saline and resuspended in HEPES-buffered culture medium containing
0.1% hdBSA or, in appropriate experiments, 10% FBS. Cells were plated at a
density of 15,000 cells per well and allowed to attach and spread for 2 hours prior
to fixation in 4% paraformaldehyde in CMF-PBS. For fluorescence microscopy,
fixed cells were permeabilized in 0.2% Triton X-100, labeled with Rhodamineconjugated phalloidin and analyzed with a Nikon Microphot-FX microscope
(Nikon, Inc.) equipped with a cooled CCD camera and Image-Pro Plus software
(Media Cybernetics). Cells extending five or more fingerlike projections were
scored as extending filopodia, whereas cells spreading with a diameter of at least
25 ␮m and without filopodia were scored as completely spread. Spreading was
quantified from a minimum of triplicate wells and is shown as the mean ± standard
error (s.e.). For antibody and mS1ED inhibition experiments, cells were preincubated 10 minutes before plating in the presence of the inhibitor.
siRNA design and transfection
siRNAs against the mouse ␤5 integrin subunit (GenBankTM accession number
NM_010580.1, nucleotide annotation 269CAGGGCTCAACATATGCACTA289) and
mouse Sdc1 (GenBankTM accession number NM_011519.1, nucleotide annotation
1660
GAGGTCTACTTTAGACAACTT1680) were designed by Ambion, Inc. (Austin,
TX) in accordance with a Cenix BioScience algorithm. For transfection, mouse ␤5
siRNA at 200-800 nM or mouse Sdc1 siRNA at 600 nM were added to 2.5⫻105
cells plated in 35-mm wells using LipofectAMINE2000 at a ratio of 1:1 (␮g siRNA:
␮l LipofectAMINE2000) for the ␤5 siRNA or a ratio of 1:4 for the mouse Sdc1
Syndecan-1 regulates ␣v␤5 integrin
siRNA diluted in Opti-MEM I transfection medium (Invitrogen) lacking serum and
antibiotics. Control cells were transfected with a control oligonucleotide provided
by the siRNA manufacturer. At 4 hours after transfection, each well was
supplemented with 3 ml of complete growth medium; at 24 hours post-transfection
the cells were lifted in trypsin and expanded in 100-mm tissue-culture plates. Cells
were harvested 48 hours after transfection and 5⫻104 cell equivalents in Laemmli
sample buffer electrophoresed per lane under non-reducing conditions on a 7.5%
Laemmli gel, transferred to ImmobilonP (Millipore) and probed with 1:1000 rabbit
polyclonal ␤5 antibody (Ab1926, Chemicon) or 1:200 rabbit anti-FAK antibody
(FAK A-17, Santa Cruz Biologicals) followed by an AP-conjugated anti-rabbit
secondary antibody. Alternatively, cohorts were detached with EDTA, resuspended
in 100 ␮l HEPES-buffered DME supplemented with 10% FBS and subjected to
FACS analysis using anti-integrin (BDBiosciences) mAb H9.2B8 to detect ␣v,
HM␤1-1 to detect ␤1 and 2C9.G2 to detect ␤3 followed by a FITC-conjugated antiArmenian hamster secondary antibody or anti-syndecan mAbs 281.2 or KY8.2 with
an Alexa-Fluor-488-conjugated anti-rat secondary, mAb B-B4 with an Alexa-Fluor488-conjugated anti-mouse secondary IgG and FITC-conjugated human IgG (hIgG)
to detect mouse Sdc1, mouse Sdc4, human Sdc1 constructs and the FcRecto-hS1
chimera, respectively. Cells were analyzed at the University of Wisconsin
Comprehensive Cancer Center Flow Cytometry Facility using a FACSCalibur
benchtop cytometer (BDBiosciences). Cell-scatter and propidium-iodide (Sigma, 1
␮g/sample) staining profiles were used to gate live, single-cell events for data
analysis.
Journal of Cell Science
Co-immunoprecipitation assays
Antibodies used to isolate Sdc1 include an affinity-purified pan-syndecan antibody
generated in rabbit against the ten C-terminal amino acids of Sdc1 (Reiland et al.,
1996) and mAbs 281.2 (Jalkanen et al., 1985) and B-B4 (Wijdenes et al., 1996)
specific for the ectodomains of mouse and human Sdc1, respectively. Monoclonal
Ab KY8.2 (generously provided by Paul W. Kincade, Oklahoma Medical Research
Foundation) was used to isolate mouse Sdc4. Monoclonal Ab 10.1 (Santa Cruz
Biotechnology) or human IgG (Jackson ImmunoResearch), which recognize the
ectodomain of CD64/Fc␥RIa, was used to isolate the FcRecto-hS1 chimera. Cells (35⫻106/ml) were washed and then lysed in lysis buffer containing 50 mM HEPES,
150 mM NaCl, 10 mM EDTA, 1% Triton X-100, 0.25% sodium deoxycholate and
1:100 dilution of protease inhibitor cocktail set III (Calbiochem) for 20 minutes on
ice. Insoluble cell debris was removed by centrifugation at 20,000 g for 15 minutes
at 4°C. Cell lysates (2 mg protein per reaction determined by Pierce BCA Assay
per reaction) were pre-cleared using 50 ␮g/ml antibody isotype-matched IgG (rabbit
IgG for pan-syndecan, rat IgG2A for 281.2 and KY8.2 and mouse IgG1 for B-B4
and 10.1) and 100 ␮l of GammaBind Sepharose (Amersham Biosciences). Precleared lysates were then incubated at 4°C overnight with either 10 ␮g/ml of antisyndecan antibody (pan, mAbs 281.2, B-B4 or KY8.2) or 30 ␮g/ml anti-Fc␥RIa
antibody (mAb 10.1 or human IgG). For S1ED-competition experiments, 30 ␮M
soluble GST (negative control) or GST-S1ED protein was added to the pre-cleared
lysates in conjunction with anti-Sdc1 antibody. Immune complexes were
precipitated with 50 ␮l of GammaBind Sepharose, washed with lysis buffer lacking
detergents and extracted in Laemmli sample buffer. For methanol precipitates, 300
␮g of total protein was precipitated overnight at –20°C in 2.5 volumes of methanol.
Precipitates were washed once with 0.5 ml acetone (chilled to –20°C) and allowed
to dry for 15 minutes at room temperature. Soluble material was resuspended in 50
␮l of heparitinase buffer (50 mM HEPES, 50 mM NaOAc, 150 mM NaCl, 5 mM
CaCl2, pH 6.5) with 2.4⫻10-3 IU/ml heparitinase (IBEX Technologies, Inc.) and
0.1 conventional units/ml chondroitin ABC lysase (ICN Biochemicals) for 4 hours
at 37°C (with fresh enzymes added after 2 hours) to remove GAG side chains.
Samples were resolved by electrophoresis under reduced conditions on a 7.5%
Laemmli gel, transferred to ImmobilonP and probed with rabbit polyclonal ␤5
integrin (1:1000), mS1ED or pan-syndecan (1 ␮g/ml) antibody followed by an APconjugated anti-rabbit secondary. Visualization of immunoreactive bands was
performed using ECF reagent (Amersham Pharmacia) and scanned on a Storm
PhosphoImager (Molecular Dynamics).
This work was supported by NIH grants HD21881 and CA109010
to A.R. and a training grant stipend (T32 GM08688) to D.M.B. It was
aided by the core facilities of the University of Wisconsin
Comprehensive Cancer Center, supported by NIH P30-CA14520. The
authors thank Deane Mosher and Donna Pesciotta-Peters for
generously providing matrix ligands used in this study. The technical
support and purification of antibodies provided by Andrea McWhorter
is gratefully acknowledged.
References
Albert, M. L., Kim, J. I. and Birge, R. B. (2000). alphavbeta5 integrin recruits the CrkIIDock180-rac1 complex for phagocytosis of apoptotic cells. Nat. Cell Biol. 2, 899-905.
Aumailley, M., Gurrath, M., Muller, G., Calvete, J., Timpl, R. and Kessler, H. (1991).
2455
Arg-Gly-Asp constrained within cyclic pentapeptides. Strong and selective inhibitors
of cell adhesion to vitronectin and laminin fragment P1. FEBS Lett. 291, 50-54.
Beauvais, D. M. and Rapraeger, A. C. (2003). Syndecan-1-mediated cell spreading
requires signaling by alphavbeta3 integrins in human breast carcinoma cells. Exp. Cell
Res. 286, 219-232.
Beauvais, D. M. and Rapraeger, A. C. (2004). Syndecans in tumor cell adhesion and
signaling. Reprod. Biol. Endocrinol. 2, 3.
Beauvais, D. M., Burbach, B. J. and Rapraeger, A. C. (2004). The syndecan-1
ectodomain regulates alphavbeta3 integrin activity in human mammary carcinoma
cells. J. Cell Biol. 167, 171-181.
Brooks, P. C., Stromblad, S., Sanders, L. C., von Schalscha, T. L., Aimes, R. T.,
Stetler-Stevenson, W. G., Quigley, J. P. and Cheresh, D. A. (1996). Localization of
matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with
integrin alpha v beta 3. Cell 85, 683-693.
Brooks, P. C., Klemke, R. L., Schon, S., Lewis, J. M., Schwartz, M. A. and Cheresh,
D. A. (1997). Insulin-like growth factor receptor cooperates with integrin alpha v beta
5 to promote tumor cell dissemination in vivo. J. Clin. Invest. 99, 1390-1398.
Carman, C. V. and Springer, T. A. (2003). Integrin avidity regulation: are changes in
affinity and conformation underemphasized? Curr. Opin. Cell Biol. 15, 547-556.
Couchman, J. R. (2003). Syndecans: proteoglycan regulators of cell-surface
microdomains? Nat. Rev. Mol. Cell Biol. 4, 926-937.
Couchman, J. R., Chen, L. and Woods, A. (2001). Syndecans and cell adhesion. Int.
Rev. Cytol. 207, 113-150.
De, S., Chen, J., Narizhneva, N. V., Heston, W., Brainard, J., Sage, E. H. and Byzova,
T. V. (2003). Molecular pathway for cancer metastasis to bone. J. Biol. Chem. 278,
39044-39050.
Dedhar, S. (1999). Integrins and signal transduction. Curr. Opin. Hematol. 6, 37-43.
Eliceiri, B. P. and Cheresh, D. A. (1999). The role of alphav integrins during
angiogenesis: insights into potential mechanisms of action and clinical development.
J. Clin. Invest. 103, 1227-1230.
Felding-Habermann, B. and Cheresh, D. A. (1993). Vitronectin and its receptors. Curr.
Opin. Cell Biol. 5, 864-868.
Filardo, E. J., Deming, S. L. and Cheresh, D. A. (1996). Regulation of cell migration
by the integrin beta subunit ectodomain. J. Cell Sci. 109, 1615-1622.
Finnemann, S. C. (2003a). Focal adhesion kinase signaling promotes phagocytosis of
integrin-bound photoreceptors. EMBO J. 22, 4143-4154.
Finnemann, S. C. (2003b). Role of alphavbeta5 integrin in regulating phagocytosis by
the retinal pigment epithelium. Adv. Exp. Med. Biol. 533, 337-342.
Friedlander, M., Brooks, P. C., Shaffer, R. W., Kincaid, C. M., Varner, J. A. and
Cheresh, D. A. (1995). Definition of two angiogenic pathways by distinct alpha v
integrins. Science 270, 1500-1502.
Giancotti, F. G. and Ruoslahti, E. (1999). Integrin signaling. Science 285, 1028-1032.
Granes, F., Urena, J. M., Rocamora, N. and Vilaro, S. (2000). Ezrin links syndecan-2
to the cytoskeleton. J. Cell Sci. 113, 1267-1276.
Grootjans, J. J., Zimmermann, P., Reekmans, G., Smets, A., Degeest, G., Durr, J.
and David, G. (1997). Syntenin, a PDZ protein that binds syndecan cytoplasmic
domains. Proc. Natl. Acad. Sci. USA 94, 13683-13688.
Hall, M. O., Abrams, T. A. and Burgess, B. L. (2003). Integrin alphavbeta5 is not
required for the phagocytosis of photoreceptor outer segments by cultured retinal
pigment epithelial cells. Exp. Eye Res. 77, 281-286.
Hsueh, Y. P., Yang, F. C., Kharazia, V., Naisbitt, S., Cohen, A. R., Weinberg, R. J.
and Sheng, M. (1998). Direct interaction of CASK/LIN-2 and syndecan heparan
sulfate proteoglycan and their overlapping distribution in neuronal synapses. J. Cell
Biol. 142, 139-151.
Iba, K., Albrechtsen, R., Gilpin, B., Frohlich, C., Loechel, F., Zolkiewska, A.,
Ishiguro, K., Kojima, T., Liu, W., Langford, J. K. et al. (2000). The cysteine-rich
domain of human ADAM 12 supports cell adhesion through syndecans and triggers
signaling events that lead to beta1 integrin-dependent cell spreading. J. Cell Biol. 149,
1143-1156.
Iida, J., Meijne, A. M., Oegema, T. R., Jr, Yednock, T. A., Kovach, N. L., Furcht, L.
T. and McCarthy, J. B. (1998). A role of chondroitin sulfate glycosaminoglycan
binding site in alpha4beta1 integrin-mediated melanoma cell adhesion. J. Biol. Chem.
273, 5955-5962.
Iida, J., Pei, D., Kang, T., Simpson, M. A., Herlyn, M., Furcht, L. T. and McCarthy,
J. B. (2001). Melanoma chondroitin sulfate proteoglycan regulates matrix
metalloproteinase-dependent human melanoma invasion into type I collagen. J. Biol.
Chem. 276, 18786-18794.
Jalkanen, M., Nguyen, H., Rapraeger, A., Kurn, N. and Bernfield, M. (1985). Heparan
sulfate proteoglycans from mouse mammary epithelial cells: localization on the cell
surface with a monoclonal antibody. J. Cell Biol. 101, 976-984.
Jones, J., Watt, F. M. and Speight, P. M. (1997). Changes in the expression of alpha v
integrins in oral squamous cell carcinomas. J. Oral Pathol. Med. 26, 63-68.
Kinnunen, T., Kaksonen, M., Saarinen, J., Kalkkinen, N., Peng, H. B. and Rauvala,
H. (1998). Cortactin-Src kinase signaling pathway is involved in N-syndecandependent neurite outgrowth. J. Biol. Chem. 273, 10702-10708.
Klemke, R. L., Yebra, M., Bayna, E. M. and Cheresh, D. A. (1994). Receptor tyrosine
kinase signaling required for integrin alpha v beta 5-directed cell motility but not
adhesion on vitronectin. J. Cell Biol. 127, 859-866.
Kugler, M. C., Wei, Y. and Chapman, H. A. (2003). Urokinase receptor and integrin
interactions. Curr. Pharm. Des. 9, 1565-1574.
Kusano, Y., Oguri, K., Nagayasu, Y., Munesue, S., Ishihara, M., Saiki, I., Yonekura,
H., Yamamoto, H. and Okayama, M. (2000). Participation of syndecan 2 in the
induction of stress fiber formation in cooperation with integrin alpha5beta1: structural
Journal of Cell Science
2456
Journal of Cell Science 119 (12)
characteristics of heparan sulfate chains with avidity to COOH-terminal heparinbinding domain of fibronectin. Exp. Cell Res. 256, 434-444.
Kusano, Y., Yoshitomi, Y., Munesue, S., Okayama, M. and Oguri, K. (2004).
Cooperation of syndecan-2 and syndecan-4 among cell surface heparan sulfate
proteoglycans in the actin cytoskeletal organization of Lewis lung carcinoma cells. J.
Biochem. 135, 129-137.
Lebakken, C. S. and Rapraeger, A. C. (1996). Syndecan-1 mediates cell spreading in
transfected human lymphoblastoid (Raji) cells. J. Cell Biol. 132, 1209-1221.
Lebakken, C. S., McQuade, K. J. and Rapraeger, A. C. (2000). Syndecan-1 signals
independently of beta1 integrins during Raji cell spreading. Exp. Cell Res. 259, 315325.
Lewis, J. M., Cheresh, D. A. and Schwartz, M. A. (1996). Protein kinase C regulates
alpha v beta 5-dependent cytoskeletal associations and focal adhesion kinase
phosphorylation. J. Cell Biol. 134, 1323-1332.
Liddington, R. C. and Ginsberg, M. H. (2002). Integrin activation takes shape. J. Cell
Biol. 158, 833-839.
Liu, W., Litwack, E. D., Stanley, M. J., Langford, J. K., Lander, A. D. and Sanderson,
R. D. (1998). Heparan sulfate proteoglycans as adhesive and anti-invasive molecules.
Syndecans and glypican have distinct functions. J. Biol. Chem. 273, 22825-22832.
Lukashev, M. E. and Werb, Z. (1998). ECM signalling: orchestrating cell behaviour and
misbehaviour. Trends Cell Biol. 8, 437-441.
McFall, A. J. and Rapraeger, A. C. (1998). Characterization of the high affinity cellbinding domain in the cell surface proteoglycan syndecan-4. J. Biol. Chem. 273, 2827028276.
McLean, J. W., Vestal, D. J., Cheresh, D. A. and Bodary, S. C. (1990). cDNA sequence
of the human integrin beta 5 subunit. J. Biol. Chem. 265, 17126-17131.
McQuade, K. J. and Rapraeger, A. C. (2003). Syndecan-1 transmembrane and
extracellular domains have unique and distinct roles in cell spreading. J. Biol. Chem.
278, 46607-46615.
Memmo, L. M. and McKeown-Longo, P. (1998). The alphavbeta5 integrin functions as
an endocytic receptor for vitronectin. J. Cell Sci. 111, 425-433.
Mostafavi-Pour, Z., Askari, J. A., Parkinson, S. J., Parker, P. J., Ng, T. T. and
Humphries, M. J. (2003). Integrin-specific signaling pathways controlling focal
adhesion formation and cell migration. J. Cell Biol. 161, 155-167.
Moulder, K., Roberts, K., Shevach, E. M. and Coligan, J. E. (1991). The mouse
vitronectin receptor is a T cell activation antigen. J. Exp. Med. 173, 343-347.
Munesue, S., Kusano, Y., Oguri, K., Itano, N., Yoshitomi, Y., Nakanishi, H.,
Yamashina, I. and Okayama, M. (2002). The role of syndecan-2 in regulation of
actin-cytoskeletal organization of Lewis lung carcinoma-derived metastatic clones.
Biochem. J. 363, 201-209.
Noto, K., Kato, K., Okumura, K. and Yagita, H. (1995). Identification and functional
characterization of mouse CD29 with a mAb. Int. Immunol. 7, 835-842.
Oh, E. S., Woods, A. and Couchman, J. R. (1997a). Multimerization of the cytoplasmic
domain of syndecan-4 is required for its ability to activate protein kinase C. J. Biol.
Chem. 272, 11805-11811.
Oh, E. S., Woods, A. and Couchman, J. R. (1997b). Syndecan-4 proteoglycan regulates
the distribution and activity of protein kinase C. J. Biol. Chem. 272, 8133-8136.
Oh, E. S., Woods, A., Lim, S. T., Theibert, A. W. and Couchman, J. R. (1998).
Syndecan-4 proteoglycan cytoplasmic domain and phosphatidylinositol 4,5bisphosphate coordinately regulate protein kinase C activity. J. Biol. Chem. 273, 1062410629.
Ott, V. L. and Rapraeger, A. C. (1998). Tyrosine phosphorylation of syndecan-1 and -4
cytoplasmic domains in adherent B82 fibroblasts. J. Biol. Chem. 273, 35291-35298.
Panetti, T. S. and McKeown-Longo, P. J. (1993). The alpha v beta 5 integrin receptor
regulates receptor-mediated endocytosis of vitronectin. J. Biol. Chem. 268, 1149211495.
Panetti, T. S., Wilcox, S. A., Horzempa, C. and McKeown-Longo, P. J. (1995). Alpha
v beta 5 integrin receptor-mediated endocytosis of vitronectin is protein kinase Cdependent. J. Biol. Chem. 270, 18593-18597.
Park, H., Kim, Y., Lim, Y., Han, I. and Oh, E. S. (2002). Syndecan-2 mediates adhesion
and proliferation of colon carcinoma cells. J. Biol. Chem. 277, 29730-29736.
Pasqualini, R., Bodorova, J., Ye, S. and Hemler, M. E. (1993). A study of the structure,
function and distribution of beta 5 integrins using novel anti-beta 5 monoclonal
antibodies. J. Cell Sci. 105, 101-111.
Plow, E. F., Haas, T. A., Zhang, L., Loftus, J. and Smith, J. W. (2000). Ligand binding
to integrins. J. Biol. Chem. 275, 21785-21788.
Porter, J. C. and Hogg, N. (1998). Integrins take partners: cross-talk between integrins
and other membrane receptors. Trends Cell. Biol. 8, 390-396.
Reiland, J., Ott, V. L., Lebakken, C. S., Yeaman, C., McCarthy, J. and Rapraeger,
A. C. (1996). Pervanadate activation of intracellular kinases leads to tyrosine
phosphorylation and shedding of syndecan-1. Biochem. J. 319, 39-47.
Sanders, R. J., Mainiero, F. and Giancotti, F. G. (1998). The role of integrins in
tumorigenesis and metastasis. Cancer Invest. 16, 329-344.
Saoncella, S., Echtermeyer, F., Denhez, F., Nowlen, J. K., Mosher, D. F., Robinson,
S. D., Hynes, R. O. and Goetinck, P. F. (1999). Syndecan-4 signals cooperatively with
integrins in a Rho-dependent manner in the assembly of focal adhesions and actin stress
fibers. Proc. Natl. Acad. Sci. USA 96, 2805-2810.
Thodeti, C. K., Albrechtsen, R., Grauslund, M., Asmar, M., Larsson, C., Takada, Y.,
Mercurio, A. M., Couchman, J. R. and Wewer, U. M. (2003). ADAM12/syndecan4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase
Calpha and RhoA. J. Biol. Chem. 278, 9576-9584.
Tkachenko, E. and Simons, M. (2002). Clustering induces redistribution of syndecan-4
core protein into raft membrane domains. J. Biol. Chem. 277, 19946-19951.
Tkachenko, E., Rhodes, J. M. and Simons, M. (2005). Syndecans: new kids on the
signaling block. Circ. Res. 96, 488-500.
Tonn, J. C., Wunderlich, S., Kerkau, S., Klein, C. E. and Roosen, K. (1998). Invasive
behaviour of human gliomas is mediated by interindividually different integrin patterns.
Anticancer Res. 18, 2599-2605.
van Leeuwen, R. L., Yoshinaga, I. G., Akasaka, T., Dekker, S. K., Vermeer, B. J. and
Byers, H. R. (1996). Attachment, spreading and migration of melanoma cells on
vitronectin. The role of alpha V beta 3 and alpha V beta 5 integrins. Exp. Dermatol.
5, 308-315.
Wijdenes, J., Vooijs, W. C., Clement, C., Post, J., Morard, F., Vita, N., Laurent, P.,
Sun, R. X., Klein, B. and Dore, J. M. (1996). A plasmocyte selective monoclonal
antibody (B-B4) recognizes syndecan-1. Br. J. Haematol. 94, 318-323.
Wilkins-Port, C. E., Sanderson, R. D., Tominna-Sebald, E. and McKeown-Longo, P.
J. (2003). Vitronectin’s basic domain is a syndecan ligand which functions in trans to
regulate vitronectin turnover. Cell Commun. Adhes. 10, 85-103.
Woods, A. and Couchman, J. R. (2000). Integrin modulation by lateral association. J.
Biol. Chem. 275, 24233-24236.
Woods, A. and Couchman, J. R. (2001). Syndecan-4 and focal adhesion function. Curr.
Opin. Cell Biol. 13, 578-583.
Woods, A., Couchman, J. R., Johansson, S. and Hook, M. (1986). Adhesion and
cytoskeletal organisation of fibroblasts in response to fibronectin fragments. EMBO J.
5, 665-670.
Yamashita, Y., Oritani, K., Miyoshi, E. K., Wall, R., Bernfield, M. and Kincade, P.
W. (1999). Syndecan-4 is expressed by B lineage lymphocytes and can transmit a signal
for formation of dendritic processes. J. Immunol. 162, 5940-5948.
Yasuda, M., Hasunuma, Y., Adachi, H., Sekine, C., Sakanishi, T., Hashimoto, H., Ra,
C., Yagita, H. and Okumura, K. (1995). Expression and function of fibronectin
binding integrins on rat mast cells. Int. Immunol. 7, 251-258.
Yebra, M., Filardo, E. J., Bayna, E. M., Kawahara, E., Becker, J. C. and Cheresh,
D. A. (1995). Induction of carcinoma cell migration on vitronectin by NF-kappa Bdependent gene expression. Mol. Biol. Cell 6, 841-850.