* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Expression of Efflux Transporters in Human Ocular Tissues
Signal transduction wikipedia , lookup
5-Hydroxyeicosatetraenoic acid wikipedia , lookup
Cell encapsulation wikipedia , lookup
Cell culture wikipedia , lookup
Extracellular matrix wikipedia , lookup
Cellular differentiation wikipedia , lookup
Tissue engineering wikipedia , lookup
1521-009X/41/11/1934–1948$25.00 DRUG METABOLISM AND DISPOSITION Copyright ª 2013 by The American Society for Pharmacology and Experimental Therapeutics http://dx.doi.org/10.1124/dmd.113.052704 Drug Metab Dispos 41:1934–1948, November 2013 Expression of Efflux Transporters in Human Ocular Tissues Peng Chen, Hao Chen,1 Xinjie Zang, Min Chen, Haoran Jiang, Shasha Han, and Xianggen Wu State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory of Ophthalmology, Shandong Eye Institute, Shandong Academy of Medical Sciences, Qingdao, People’s Republic of China Received May 24, 2013; accepted August 26, 2013 ABSTRACT transporters in mRNA and protein levels in ocular tissues. At the protein level, MRP1-7, MDR1, and LRP were expressed in the corneal epithelium; MRP1-7, MDR1, LRP, and BCRP were expressed in the conjunctival epithelium; MRP1-2, MRP6-7, MDR1, and LRP were expressed in the ICB; MRP1-3, MRP6-7, MDR1, and LRP were expressed in the retina; MRP1-3, MRP6-7, MDR1, and LRP were expressed in the HCEC; and MRP7, MDR1, LRP, and BCRP were expressed in the ARPE-19. This quantitative and systematic study of efflux transporters in normal ocular tissues and cell lines provides evidence of cross-ocular tissue transporter expression differences, implying that efflux transporter expression variability should be taken into consideration for better understanding of ocular pharmacokinetic and pharmacodynamic data. Introduction Toit et al., 2011; Pahuja et al., 2012; Tartara et al., 2012). Additional factors preventing drugs from reaching the target site of the anterior chamber involve drug elimination through aqueous humor outflow and entering the uveal blood circulation via the BAB (Gaudana et al., 2010). Systemic administration is one possible route for delivery of drugs to the back of the eye; however, retinal transfer of drugs from the circulating blood is strictly regulated by two blood-ocular barrier systems: the BAB and the BRB (Gaudana et al., 2010). The multidrug resistance (MDR) phenotype, a major type of cell resistance toward xenobiotics, remains the main cause of failure in cancer chemotherapy (Wu et al., 2011). The MDR phenomenon is associated with a decrease in intracellular xenobiotics/drug accumulation by efflux transporters, such as multidrug resistance 1 (MDR1)– P-glycoprotein, multidrug resistance–associated proteins (MRPs), breast cancer-resistance protein (BCRP, also known as ABCG2), and lung-resistance protein (LRP). These proteins have been subsequently detected in normal tissues of kidney, intestine, adrenal gland, liver, blood-brain barrier, and cells of the immune system. The presence of these proteins in the apical membranes of normal tissues, such as renal tubular cells and intestinal absorptive cells, can interfere with drug availability, metabolism, and toxicity, because they reduce intestinal absorption and increase renal secretion of a wide range of drugs and metabolites, which are substrates for these membrane transporters (Bodo et al., 2003; Delou et al., 2009). Many transporters have been discovered in tissues of the liver, kidney, and intestine (Obligacion et al., 2006; Klaassen and Lu, 2008; Delou et al., 2009; Klaassen and Aleksunes, 2010). Among them, efflux transporters and influx transporters are related to drug delivery The eye is a complex organ with sophisticated anatomic and physiologic structures (Sasaki et al., 1999; Edelhauser et al., 2010; Ulbrich and Lamprecht, 2010). These structures include various ocular barriers, such as corneal epithelium, the blood-aqueous barrier (BAB), and the blood-retina barrier (BRB), which govern the entry and exit of nutrients and xenobiotics into and out of ocular tissues in the anterior and posterior parts of the eye, making it a challenge to deliver drugs effectively into ocular tissues (Mannermaa et al., 2006; Zhang et al., 2008; Mitra, 2009). Topically applied drugs may be rapidly eliminated from the precorneal area (Wu et al., 2010). The cornea, a major pathway for eye drops or eye ointments to enter the eye, is also an important barrier to drug penetration (Ghate and Edelhauser, 2006; du This work was supported by the National Natural Science Foundation of China [Project Nos. 81000369 and 81271036]; the Young and Middle-Aged Scientists Research Awards Fund of Shangdong Province, China [Project No. BS2009SV053]; and the Science and Technology Foundation of Qingdao, Shandong Province, China [Project No. 13-1-4-177-jch]. This manuscript was previously presented: Chen P, Chen H, Zang X, Chen M, Jiang H, Han S, Wu X (2013) Expression of Efflux Transporters in Human Ocular Tissues. International Symposium on Ocular Pharmacology and Pharmaceutics; 2013 Mar 7–10; Paris, France. None of the authors has a proprietary or commercial interest in any of the mentioned drugs or companies. 1 Current affiliation: Department of Microbiology, Key Laboratory of Medicine and Biotechnology of Qingdao, Qingdao University Medical College. dx.doi.org/10.1124/dmd.113.052704. ABBREVIATIONS: ARPE-19, human retinal pigment epithelial cell line; BAB, blood-aqueous barrier; BCRP, breast cancer–resistance protein; BRB, blood-retina barrier; CE, cornea epithelium; HCE, human corneal epithelial; HCEC, human corneal epithelial cell line; ICB, iris-ciliary body; LRP, lung resistance protein; MDR, multidrug resistance; MDR1, multidrug resistance 1; MRP1-7, multidrug resistance-associated protein 1-7; PCR, polymerase chain reaction; RC, retina-choroid; RPE, retinal pigment epithelial; TBST, Tris-buffered saline Tween-20. 1934 Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 To investigate the expression profiles of efflux transporters in human ocular tissues, quantitative real-time polymerase chain reaction, Western blotting, and immunohistochemistry were used to obtain the relative mRNA and protein expressions of various efflux transporters in human ocular tissues. The cornea, conjunctiva, irisciliary body (ICB), retina and choroid, human corneal epithelial cell line (HCEC), and human retinal pigment epithelial cell line (ARPE19) were examined for the expressions of multidrug resistance– associated proteins 1–7 (MRP1–7), multidrug resistance 1 (MDR1) P-glycoprotein, lung resistance protein (LRP), and breast cancer– resistance protein (BCRP). The expression sites and patterns of efflux transporters were significantly different in ocular tissues, HCEC, and ARPE-19, as well as the expression profiles of efflux Efflux Transporters in Human Ocular Tissues (Gaudana et al., 2010; Su et al., 2011). The role of efflux transporters has been investigated more intensively than that of influx transporters, due to the defense mechanism of efflux transporters against penetration of xenobiotics (Eechoute et al., 2011). Prominent efflux transporters identified in tissues belong to the ATP binding cassette superfamily, including MDR1, MRPs, and BCRP (Giacomini et al., 2010). LRP is not an ATP binding cassette transporter but a major vault protein (Bouhamyia et al., 2007). As it is thought to drive drugs away from the nucleus, LRP has also been reported as an efflux transporter (Leonard et al., 2003; Bouhamyia et al., 2007), although there are discrepancies about its MDR functions (Mossink et al., 2002). Efflux transporters lower bioavailability by effluxing the molecules out of the cell membrane and cytoplasm, and they are important determinants of drug accumulation in target organs or cells and of overall drug uptake, distribution, and excretion. Moreover, some 1935 efflux transporters have been discovered in ocular tissues, such as the cornea and retina (Kajikawa et al., 1999; Kennedy and Mangini, 2002; Becker et al., 2007; Vellonen et al., 2010). Similar to the liver, kidney, and intestine tissues, the expression and function of efflux transporters at various layers of ocular epithelial and endothelial cells may significantly influence ocular drug efficacy by means of absorption, distribution, and elimination (Dey et al., 2004; Hariharan et al., 2009). However, knowledge about these efflux transporters in ocular tissues is very limited, despite the potentially important role they may play in ocular drug disposition. The data of expression and function available only involve lower species and cell lines, and some even remain controversial. Expression and location profiles are important prefactors to functional protein research (Dallas et al., 2006). With some differences in the results, expression profiles of efflux transporters in human corneas have been evaluated (Becker et al., 2007; Zhang et al., 2008; Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 1. mRNA expression levels of efflux transporters in human ocular tissues. The data are expressed as the mean 6 S.D. a: PCE-conjunctiva,0.05, b: PCE-ICB,0.05, c: PCE-RC,0.05, d: Pconjunctiva-ICB,0.05, e: Pconjunctiva-RC,0.05, f: PICB-RC,0.05. (n = 6 for CE, ICB, and RC; n = 4 for conjunctiva). As MRP3 in ICB and RC, and MRP4 in CE had no expression, the statistical analysis was not performed here. 1936 Chen et al. Vellonen et al., 2010). However, there have been few reports on the expression pattern of efflux transporters in the other human ocular drug-absorption barrier tissues, such as conjunctiva, iris-ciliary body (ICB), and retina-choroid (RC). In the present study, we characterized the expression and location profiles of 10 major efflux transporters in ocular tissues. In addition, the expression profiles of human corneal epithelial cells (HCEC) and human retinal pigment epithelial cells (ARPE-19), two cell lines commonly used as in vitro models for corneal and retinal drug absorption studies, respectively, were investigated and compared. Materials and Methods TABLE 1 Patient demographic information Tissues Donor No. Age (yrs) Gender Eye Endothelial Cell Density (/mm2) Cornea, Conjunctiva, Iris-Ciliary Body, and Retina-Choroid 1 18 Male 2 38 Male 3 15 Female 4 29 Female 5 29 Female 6 45 Female 1 15 Male 2 19 Male 3 27 Male 4 16 Female 5 18 Female 6 25 Female OD OS OD OS OD OS OD OS OD OS OD OS OD OS OD OS OD OS OD OS OD OS OD OS 2197 2341 2550 2470 3250 3180 2790 2830 2790 2830 2570 2390 2812 2963 2759 2688 2518 2637 3022 3087 2975 2891 2367 2470 Cornea Epithelium Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Human Ocular Tissues. The human ocular tissues from donors with no history of eye disease were provided by the Eye Bank of Shandong, International Federation of Eye and Tissue Banks (Qingdao, China). The eye globes, enucleated within 10 hours of death, were immediately dissected, and the conjunctiva, ICB, and RC were collected. Patient data are summarized in Table 1. Human corneal epithelium (CE) tissues were obtained from patients who underwent photorefractive keratectomy surgery for correction of refractive errors at Qingdao Eye Hospital, Shandong Eye Institute (Qingdao, China). Written informed consent for photorefractive keratectomy and CE to be used in this research was obtained from each patient. Patients with manifested ocular pathology or topical ocular drug therapy were excluded. The CE was scraped off before photoablation. Each tissue was snap-frozen in liquid nitrogen and stored at 280°C for protein and RNA analysis. Normal human corneas that were left after corneal transplantation surgery and were not suitable for further clinical application were provided by Qingdao Eye Hospital, as well as the conjunctiva, ICB, and retina used for immunohistochemical analysis. All tissues were from donors free of ocular disease and other systemic complications. This study was approved by the Ethical Review Committee of Shandong Eye Institute, and the handling of donor tissues was consistent with the tenets of the Declaration of Helsinki regarding the protection of donor confidentiality. Cell Culture. Simian virus 40–immortalized HCECs were kindly provided by Prof. Choun-Ki Joo (School of Medicine, the Catholic University of Korea, Seoul, Korea). The cells were cultured in Dulbecco’s modified Eagle’s medium/F-12 (1:1) media, 5% fetal bovine serum (Gibco-BRL, Grand Island, NY), 5 mg/ml insulin (Sigma, St. Louis, MO), 0.1 ng/ml cholera toxin (EMD Biosciences, San Diego, CA), 10 ng/ml human epidermal growth factor (R&D Systems, Minneapolis, MN), and 0.5% dimethyl sulfoxide (Sigma) in a humidified 5% CO2 incubator at 37°C. ARPE-19 (ATCC, catalog no. CRL-2302) cells were cultured in 1:1 of Dulbecco’s modified Eagle’s medium/nutrient mixture F12 (Invitrogen, Carlsbad, CA), containing 10% fetal bovine serum (Invitrogen). The cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air. The culture medium was changed every 3 days. Construction of Plasmid and Standard Curves. The target DNA fragments of corresponding genes obtained by chemical synthesis were ligated into the pMD19-T vector (Takara, Dalian, China) at 16°C overnight. The ligation mixtures were transformed into competent Escherichia coli DH5a cells. After being confirmed by polymerase chain reaction (PCR) and sequencing, the positive clones were designated as recombinant plasmid pMD19-MRP1, pMD19MRP2, pMD19-MRP3, pMD19-MRP4, pMD19-MRP5, pMD19-MRP6, pMD19MRP7, pMD19-MDR1, pMD19-LRP, and pMD19-BCRP. The correct recombinant plasmids were extracted as standard plasmids for fluorescence quantitative polymerase chain reaction (PCR) using a plasmid extraction kit (Tiangen Corp, Beijing, China). A Smartspec3000 spectrophotometer (Bio-Rad Corp, Hercules, CA) was used to determine the concentration of recombinant plasmids by measuring the absorbance at 260 nm, and purity was confirmed using a 260/280 nm ratio. The plasmid copy number was calculated using the following formula: molecules ml21 = (A 6.022 1023) (660 B)-1, where A is the plasmid concentration (g ml21), B is the plasmid length containing the cloned sequence, 6.022 1023 is the Avogadro’s number, and 660 is the average molecular weight of one base pair. The recombinant plasmids were serially diluted 10-fold in ddH2O, from 1021 to 1027. Each dilution was tested in triplicate and used as an amplification template to construct standard curves by plotting the plasmid copy number logarithm against the Ct values under optimum conditions. Sequence detection system software (7500 System; Applied Biosystems, Singapore) was used to create the standard curves and calculate the correlation coefficients. Positive control (standard plasmid without dilution) and negative control experiments were conducted in parallel for quality control. Quantitative Detection of Samples. Quantitative real-time PCR was performed according to previous descriptions with minor modification (Perini et al., 2011). Total RNA was isolated from each tissue according to the manufacturer’s protocol (NucleoSpin RNA II System; Macherey-Nagel, Düren, Germany) and subjected to reverse transcription at 42°C for 60 minutes in a 40-ml reaction mixture using a first-strand cDNA synthesis kit (Takara). The 1937 Efflux Transporters in Human Ocular Tissues TABLE 2 Sequences of oligonucleotide primers and probes used for fluorescence quantitative PCR Gene Name Primer Sequences (F) Primer Sequences (R) Probe Sequences MRP1 MRP2 MRP3 MRP4 MRP5 MRP6 MRP7 MDR1 BCRP LRP GACCATGAATGTGCAGAAGG CCTCACAAACTGCCTCTTCA ACAACCTCATCCAGGCTACC GGAACTGTTTGATGCACACC CAGGTGGTGGAGTTTGACAC TTCTCCTCTACGCTGGGTTT GCTTATCTCTTGGGCAGAGG TCCTTCATCTATGGTTGGCA GTTGTGATGGGCACTCTGAC GACGTCATCACCATCGAAAC GGATCTTCGTCTTCCTCAGC AGCCCAATGGAAGCAATATC GGTTGGCTGGAGAATCAAAT TGATGACAAACATGGCACAG GGCATAGAATCGGGAACTGT ACAGACGAGTAGCTGGCTGA GTGGCCTCATCGATACACAG TAGCGATCTTCCCAGAACCT CCCTGTTAATCCGTTCGTTT TCAAAGTGCCAGTTGTAGGC CTTGTGTGCCTAGCCCGGGC AATCTGACCACCGGCAGCCTC CTGACCATCGCACACCGGCT TTTGCCGTCCGTCTGGATGC CCATCGGTCCTTCTGTCCAACG CCAAGCGTCTCAGCTGGCATG TGGCCAGGGCTCTCCTCACA CCCATCATTGCAATAGCAGGAGTTGT TCAGCAGCTCTTCGGCTTGCA CATGCCAGGCTGCAACTGCA were conducted at 25°C, and three washes with 10 ml TBST were performed between each step. The membranes were then developed with SuperSignal West Femto Maximum Sensitivity substrate (Pierce Biotechnology, Rockford, IL) and exposed to X-ray film (Kodak, Rochester, NY). The immunoreactive bands were quantified using National Institutes of Health Image 1.62 Software (National Institutes of Health, Bethesda, MD). All the experiments in this study were performed three times, and the results were reproducible. For each sample, the levels of proteins of interest were normalized to that of GAPDH. Primary antibodies included antibodies against MRP1,MRP2, MRP3, MRP4, MRP6, MRP7, BCRP, MDR1, and LRP (Santa Cruz Biotechnology, Santa Cruz, CA); anti-MRP5 antibodies (Abcam, Cambridge, MA); and anti-GAPDH antibody (Kangchen, Shanghai, China). Immunohistochemistry and Immunocytochemical Staining. Each tissue was fixed in 10% buffered formalin and embedded in paraffin for immunohistochemical analysis. Paraffin sections, 4 mm in thickness, were deparaffinized, rehydrated, and stained with antibodies, using routine protocols. The antibody information is shown in Table 3. 3,39-Diaminobenzidine and 3amino-9-ethylcarbazole, originally introduced for the localization of horseradish peroxidase, have been widely used for staining in immunohistochemistry. The cornea and conjunctiva were stained with 3,39-diaminobenzidine, which can form a brown precipitate upon oxidation, while the ICB and RC were stained with 3-amino-9-ethylcarbazole, which can form a red precipitate upon oxidation. Cells were plated in a glass culture dish (Biousing Biotech Co., Wuxi, China) at a density of approximately 4.0 104 cells/35-mm dish in complete medium and grown to subconfluence. The medium was removed, and the cells were fixed in 4% paraformaldehyde in phosphate-buffered saline for 15 TABLE 3 Antibody information Product Name Catalog Number Subtype Immunogen MRP1 (MRPm6) MRP2 (M2III-5) sc-59606 sc-59611 Mouse IgG1 Mouse IgG2b MRP3 (H-150) sc-20767 Rabbit IgG MRP4 (H-280) sc-20768 Rabbit IgG MRP5 ab77369 Goat IgG MRP6 (H-70) sc-25505 Rabbit IgG MRP7 (H-300): sc-67241 Rabbit IgG MDR1 (JSB-1) sc-59593 Mouse IgG1 C-terminus of human origin A fusion protein of MRP2 of rat origin Amino acids 241–390 of MRP3 of human origin N-terminus of MRP4 of human origin N-terminus of MRP5 of human origin Amino acids 1–70 of MRP6 of human origin Amino acids 331–630 mapping within an internal region of MRP7 of human origin MDR of hamster origin LRP (1014) BCRP (B-25) sc-23916 sc-130933 Mouse IgG1 Rabbit IgG LRP purified from MCF7 cells Synthetic BCRP peptide of human origin Dilution (immunohistochemistry/ immunofluorescence) Dilution (Western blotting) Human Human and rat 1:50 1:50 1:200 1:200 Human, mouse, and rat Human 1:200 1:500 1:200 1:500 Human, mouse, and rat Mouse, rat, and human Mouse, rat, and human 1:200 1:500 1:200 1:500 1:200 1:500 Mouse, rat, human, and hamster Human Mouse, rat, and human 1:50 1:200 1:200 1:200 1:500 1:500 Reacts with Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 reagents (Tiangen) and sequence detection system were used in fluorescence quantitative PCR as recommended by the manufacturer. The primers and oligonucleotide probes used are listed in Table 2. Cycling conditions were as follows: 10 minutes at 95°C, followed by 40 cycles of amplification for 15 seconds at 95°C and 1 minute at 60°C. The expected fragment length was 150– 300 bp. Quantification data were analyzed by the Sequence Detection System software. The log-linear portion of the fluorescence versus cycle plot was extended to determine a fractional cycle number at which a threshold fluorescence was obtained (threshold cycle), and this number was used as a reference for each analyzed gene. The cDNA samples were amplified in parallel with plasmid standards in each run, and their Ct values were plotted together with the standard curves, from which the target gene mRNA copy numbers were determined. Western Blotting and Antibodies. Western blotting was performed as previously described (Chen et al., 2012), and the antibody information is listed in Table 3. The total protein was prepared from each tissue using radio immunoprecipitation assay buffer (50 mmol/l Tris, 150mmol/l NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, sodium orthovanadate, and sodium fluoride, pH 7.4; Galen, Beijing, China) and quantified. The protein (50 mg in 15 ml loading buffer) was resolved in 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gel before being transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA). The blots were blocked in 5% nonfat dry milk dissolved in Tris-buffered saline Tween-20 (TBST; 20 mmol/l Tris, pH 7.5, 0.5 mmol/l NaCl, 0.05% Tween-20) for 1 hour and then incubated with the primary antibody in TBST for 1 hour, followed by incubation with horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences, Uppsala, Sweden) for 1 hour. All incubations 1938 Chen et al. minutes, followed by three phosphate-buffered saline washes. The fixed cells were incubated with 0.2% Triton-100 in phosphate-buffered saline for 5 minutes, blocked in 5% bovine serum albumin, and incubated with primary antibodies for 30 minutes, followed by incubation with corresponding fluorescence-conjugated secondary antibodies for 1 hour. Images were obtained using an Eclipse TE2000-U confocal laser-scanning microscope (Nikon, Tokyo, Japan). Data Analysis. Data are presented as mean 6 S.D. Difference comparison of measurement data among groups was determined with single factor variance analysis, and comparisons between two groups were performed with the least significant difference t test (Fig. 1). The differences among groups were analyzed using Student’s t test (Fig. 2). SPSS 11.5 software (SPSS Inc., Chicago, IL) was used, and P , 0.05 was considered significant. Results mRNA Expression in Human Ocular Tissues, HCEC, and ARPE-19. The rank order of MRP1 expression was RC.ICB.CE. conjunctiva; MRP2 was RC.ICB.conjunctiva.CE; MRP3 was conjunctiva.CE, and it was absent in RC and ICB; MRP4 was ICB. conjunctiva.RC, and it was absent in CE; MRP5 was RC.ICB. CE.conjunctiva; MRP7 was RC.CE.conjunctiva.ICB; MDR1 and BCRP were ICB.RC . conjunctiva.CE; and LRP was CE.ICB. conjunctiva.RC. MRP6 was absent in all the ocular tissues (Fig. 1). The mRNA expression of MDR1 in HCEC was absent, while that of other efflux transporters in the HCEC was significantly higher than the CE; even MRP4 had a high expression, but it was absent in the CE. However, in ARPE-19, the mRNA expression profile was somewhat sophisticated—MDR1was absent in ARPE-19; significantly higher expression than the RC in MRP1, MRP4, and LRP; and significantly lower in MRP2, MRP5, MRP7, and BCRP. As in the ocular tissues, MRP6 was absent from the HCEC and ARPE-19 (Fig. 2). Western Blotting Studies of Protein Expression in Human Ocular Tissues. Western blotting analysis of protein expression in human ocular tissues is presented in Fig. 3. The quantitative comparison of the fold difference in the expression of efflux transporters is shown in Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 2. mRNA expression levels of efflux transporters in HCEC, APRE-19, CE, and RC. Data are expressed as mean 6 S.D. (n = 6 for CE and RC; n = 3 for HCEC and ARPE-19). *P , 0.05. As MRP3 in RC, MRP4 in CE, and MDR1 in HCEC and ARPE-19 had no expression, the statistical analysis was not performed here. Efflux Transporters in Human Ocular Tissues 1939 Fig. 4. MRP1, MRP3, MRP6, MRP7, and LRP were found in the CE, while only faint MDR1 expression was observed in the CE. MRP1, MRP3, MRP4, MRP6, MRP7, MDR1, BCRP, and LRP were detected in the conjunctiva. MRP1-7, MDR1, and LRP were found in ICB. MRP1, MRP2, MRP3, MRP5, MRP6, MRP7, MDR1, BCRP, and LRP were detected in the RC. MRP1, MRP2, MRP3, MRP7, MDR, BCRP, and LRP were observed in the HCEC. Expression of MRP7, MDR1, BCRP, and LRP was evident in APRE-19. Localization of Efflux Transporters in Human Ocular Tissues. The expression sites of efflux transporters differed among the ocular tissues. In the human cornea, MRP1, MRP2, and MRP6 were found to be predominant in the basal cell layer of the corneal epithelium, as well as faint MRP3 and MRP4; MRP7 and MDR1 were detected in the whole corneal epithelium, with a mild expression of LRP (Fig. 5). In the human conjunctiva, the MRP1, MRP7, and LRP expressions were found in the whole conjunctival epithelium; the MRP2, MRP3, Fig. 4. The quantitative comparison of the fold difference in the expression of efflux transporters. Data are expressed as mean 6 S.D., and n = 4. Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 3. Efflux transporter expressions in the human ocular tissues, HCEC, and ARPE-19 by Western blotting. Each sample contained 50 mg protein in 15 ml loading buffer. 1940 Chen et al. MRP4, MRP6, MDR1, and BCRP expressions were detected in the basal cell layer. The MRP5 expression was detected in the upper layer of the conjunctival epithelium (Fig. 6). In the human ICB, expressions of MRP1, MRP2, and MDR1 were observed in the stromal cells (Fig. 7). High MRP1, MRP2, MRP6, and MDR1 expressions, as well as faint MRP3, MRP7, and LRP expressions were detected in the whole retina (Fig. 8). The immunohistochemical localization of drug transporters in human ocular tissues is summarized in Table 4. Localization of Efflux Transporters in the HCEC and ARPE19. The results of immunofluorescence microscopy are summarized in Figs. 9 and 10. There were also great differences in the expression sites of efflux transporters between the HCEC and ARPE-19. In the HCEC, MRP1, MRP2, MRP3, MRP6, MRP7, MDR1, and LRP were observed in the whole cytoplasm, while MRP4, MRP5, and BCRP were absent. In ARPE-19, MRP7, MDR1, LRP, and BCRP were detected in the whole cytoplasm, while MRP1-6 was absent (Table 4). Discussion Transporter functions may reflect factors of location (within a tissue, as well as within cells), the level of expression, substrate and inhibitor specificity, and functional kinetics (Dallas et al., 2006). It is important to formulate a clear description of the expression profiles of the efflux transporters in ocular tissues. In this study, several barriers in ocular drug absorption, through topical or systemic administration, were chosen to elucidate their efflux transporter expression profiles in mRNA and protein levels. A summary of this study’s results, as well as some expression reports of efflux transporters in human ocular tissues, is shown in Table 5. The Cornea and HCEC. The corneal epithelium is lipoidal in nature and contains 90% of the total cells in the cornea; it displays significant resistance toward permeation of topically administered hydrophilic drugs. Kawazu et al., (1999) first reported the presence of MDR1 in cultured rabbit corneal epithelial cells, where it could help protect cells from being damaged by uptake of substances (Kawazu et al., 1999). In 2003, Dey et al. (2003) found, for the first time, that the human cornea can express MDR1. Since then, individual efflux transporters in human and animal corneas and corneal epithelial cells have been widely investigated (Karla et al., 2007a,b, 2009; Pelis et al., 2009; Vellonen et al., 2010; Barot et al., 2011; Li et al., 2012). Functional activity of some efflux transporters has also been evaluated, but the results of efflux transporter expressions and functions were very different. Dey et al. (2003) and Becker et al. (2007) investigated the mRNA expression of MDR1 in human corneas, as well as the MDR1 expression in a human corneal cell line by Western blotting, but no detectable or very low MDR1 mRNA and/or protein expressions were observed in human corneas according to other reports (Dey et al., 2003; Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 5. Representative figures of immunolocalization of efflux transporters in human cornea. Arrow indicates the localization of efflux transporters. The brown color was seen in positive cells. Nuclei were counterstained in blue with hematoxylin. Efflux Transporters in Human Ocular Tissues 1941 Becker et al., 2007), and these discrepancies may be due to variation in sensitivity of different experimental methods and different tissues used (Vellonen et al., 2010). Regarding the function of efflux transporters, Dey et al. (2003) evaluated the functional activity of MDR1 efflux pump with cultured rabbit primary corneal epithelial cells and a corneal cell line (Statens Seruminstitut rabbit cornea [SIRC] cells) as the model, with the results that MDR1 affected corneal uptake. Becker et al. (2007) evaluated the potential value of different epithelial cell culture systems as in vitro models for investigation of corneal permeability. Transformed human corneal epithelial cells, SIRC cells, SkinEthic human corneal epithelium, Clonetics human corneal epithelium, excised rabbit corneas, and human corneas were involved; however, MDR1 and similar efflux systems were observed to have no significant effects on corneal permeability. Discrepancies have been found not only in the expression of efflux transporters at the mRNA and protein levels, but also in different corneal models; expressions may even fluctuate in the same cell models, depending on the maturation status of cells (Vellonen et al., 2006; Verstraelen, 2011; Juuti-Uusitalo et al., 2012). There have been many reports on the expression and function of efflux transporters in animal corneal cell models; however, to our knowledge, only a few of them are related to the efflux transporter expression in human corneas, and the results are conflicting. In the current study, MDR1 displayed 9.11 6 2.33 Qty/ng RNA expression in the CE, similar to the results of other reports (Becker et al., 2007; Vellonen et al., 2010). MRP1, MRP2, MRP3, MRP7, and BCRP also had low mRNA expressions, while MRP5 and LRP had relatively high mRNA expressions. However, discrepancies in the expression of efflux transporters at the mRNA and protein levels were also found in our results, such as MRP5 and MRP6. BCRP, as a stem cell marker, which was reported to express in human corneas (Saghizadeh et al., 2011), showed Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 6. Representative figures of immunolocalization of efflux transporters in human conjunctiva. Arrow indicates the localization of efflux transporters. The brown color was seen in positive cells. Nuclei were counterstained in blue with hematoxylin. 1942 Chen et al. Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 7. Representative figures of immunolocalization of efflux transporters in human iris-ciliary body. Arrow indicates the localization of efflux transporters. The red color was seen in positive cells. Nuclei were counterstained in blue with hematoxylin. Efflux Transporters in Human Ocular Tissues 1943 Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 8. Representative figures of immunolocalization of efflux transporters in human retina. Arrow indicates the localization of efflux transporters. The red color was seen in positive cells. Nuclei were counterstained in blue with hematoxylin. 1944 Chen et al. very faint mRNA and failed to be detected by Western blotting in this study. The reason may be that stem cells in the cornea amounted to ,1% of total cells, and BCRP existed in the limbal epithelium but not in the stem cell–free corneal epithelium (Budak et al., 2005). Polarization and stratification seem to have only slight effects on the efflux protein expression in HCE cells, since only small differences were detected between the HCE model and nonconfluent HCE cells (Vellonen et al., 2010), so only nondifferentiated state of the HCEC TABLE 4 Summary of immunohistochemical localization of drug transporters in human ocular tissues and immunofluorescence microscopy in the HCEC and ARPE-19 Ocular Tissue MRP1 MRP2 MRP3 MRP4 MRP5 MRP6 MRP7 MDR1 LRP BCRP Corneal Epithelium Conjunctiva Epithelium Iris-Ciliary Body Retina HCEC ARPE-19 + +++ ++ +++ + — + + ++ +++ + — + + — + + — + + — — — — + + — — — — + + + ++ + — + ++ + + + ++ + ++ ++ ++ ++ ++ + ++ + + + + — + — — — + Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 9. Representative figures of immunolabeling of efflux transporters in the HCEC. Arrow indicates the expression of efflux transporters. Efflux Transporters in Human Ocular Tissues 1945 was used in the current study (The ARPE-19 was performed like this). Our results showed that cell lines or primary cells differed substantially from freshly isolated human corneas or corneal epithelium in terms of efflux transporter expressions, as previously reported (Becker et al., 2007; Xiang et al., 2009; Vellonen et al., 2010). Conjunctiva. The conjunctival layer plays a role in the drug absorption of timolol maleate and carbonic anhydrase inhibitors to the posterior segment of the eye, and the conjunctival epithelium is the main barrier (Urtti, 2006; Gaudana et al., 2010). It was reported that MDR1 existed in rabbit conjunctival epithelial cells and impaired the Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Fig. 10. Representative figures of immunolabeling of efflux transporters in ARPE-19. Arrow indicates the expression of efflux transporters. 1946 Chen et al. TABLE 5 Summary of some expression reports of efflux transporters in human ocular tissues Ocular Tissue Corneal Epithelium Conjunctiva Epithelium mRNA MRP2 MRP3 +a +b 2c +d 2a 2b 2c +d 2a +b +d +e Protein IH or IF RFTM RFR RFTM RFR RFTM 2a +b 2c +e +d + +a 2e — 2c +d +g — NR + NR + NR + +b +d + NR — NR — +b +d + NR + +d — — +d — +a 2d + NR + NR + NR + NR — NR + 2b + NR + NR + NR + +b + NR + NR + NR + +d + NR + NR — NR + +d + NR — NR + NR + NR + NR + NR + NR + NR + NR + NR + +b — NR + NR — +b + NR + NR — NR + NR — NR — +d — NR + NR + NR + NR + NR + NR + NR + NR + — NR + NR + + NR — NR — + NR + 2d — — NR + NR + + NR + NR + + NR + NR + NR + +b +d + NR + +h + +b +d + NR + +i + + NR + +c + NR + NR + NR + NR + NR + NR + NR + NR + NR + RFR, results from reports; RFTM, results from this manuscript; IH, immunohistochemistry; IF, immunofluorescence; NR, no report. a Vellonen et al., 2010. b Zhang et al., 2008. c Becker et al., 2007. d Dahlin et al., 2013. e Verstraelen J and Reichl S (2013) Expression analysis of MDR1, BCRP and MRP3 transporter proteins in different in vitro and ex vivo cornea models for drug absorption studies. Int J Pharm 441:765–775. f Dey et al., 2003. g Deprez MP, Nicolas MJ, Moulin AP, Leonidas Z, and Francois M (2011) Expression of the stem cell markers ABCG2/BCRP, Bmi-1, P63alpha And C/EBPdelta in the normal human cornea: an immunohistochemical study. Invest Ophthalmol Vis Sci 52:5115. h Schlingemann RO, Hofman P, Klooster J, Blaauwgeers HG, Van der Gaag R, and Vrensen GF (1998) Ciliary muscle capillaries have blood-tissue barrier characteristics. Exp Eye Res 66:747–754. i Esser P, Tervooren D, Heimann K, Kociok N, Bartz-Schmidt KU, Walter P, and Weller M (1998) Intravitreal daunomycin induces multidrug resistance in proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci 39:164–170. absorption of the immunosuppression drugs such as cyclosporine A and b-blocker propranolol (Saha et al., 1998; Yang et al., 2000). Therefore, it is important to understand the expression and regulation of efflux transporters, as well as their effects on drug transport in the conjunctiva. Our study seems to be the first report on efflux transporter expression profiles in the human conjunctiva. In mRNA expressions, all of the efflux transporters except MRP6 were observed; at the protein level, MRP1, MRP3, MRP4, MRP6, MRP7, MDR1, BCRP, and LRP could be detected in the conjunctiva. Iris-Ciliary Body. The blood-aqueous barrier resides in the iris and ciliary body epithelium. In the iris, the capillary endothelium is not fenestrated, but there are tight junctions. In the ciliary body, there are tight connections between the apical ends of the nonpigmented epithelial cells (Goel et al., 2010). The nonpigmented epithelium of the ciliary body represents an important component of the BAB of the eye. Many therapeutic drugs penetrate poorly across the nonpigmented epithelium into the aqueous humor of the eye interior (Pelis et al., 2009). Previously, only individual efflux transporters in the ICB were investigated. Zhang et al. (2008) observed MDR1, MRP1-3, and BCRP mRNA expressions in the ICB, finding that MRP2 had an extremely low expression; MDR1, MRP3, and BCRP had a low expression; MRP1 had a medium expression in this tissue. Dey et al. (2003) confirmed the BCRP expression in the ciliary epithelium and iris pigment epithelium in adult human eyes by RT-PCR and immunofluorescence studies. In this study, we first reported efflux transporter expression profiles in the human ICB. Only MRP3 and MRP6 could not be detected in mRNA expressions; MRP5 and BCRP could not be detected at the protein level. The results of immunohistochemistry also showed that MRP1, MRP2, and MDR1 had high expressions in the stromal cells of the ciliary body. Retina-Choroid and ARPE-19. The retina is composed of neural retina and retinal pigment epithelium cells, which are adjacent to the choroid (Zhang et al., 2008). The BRB resides in the retina and consists of two major components: the endothelium of retinal blood vessels (inner BRB) and the retinal pigment epithelium (outer BRB). Although the inner and outer BRBs together create a “privileged” environment in the retina and vitreous, the outer BRB constitutes the major absorption barrier for transsclerally or topically administrated drugs. The retina-choroid is commonly used as a tissue-level model to study the permeability of the outer BRB. As an ex vivo model, the retina-choroid can also be a useful tool for identification and characterization of carrier-mediated systems on Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 mRNA BCRP +c + NR — 2c 2d IH or IF LRP 2a +b 2c +e +f + 2a 2e + 2c — 2a + +a 2c 2d + NR + NR + NR + +b +d + NR + NR + +b +d + NR + 2d + RFTM RFR RFTM RFR RFTM RFR MDR1 NR + +a RFTM RFR Protein MRP7 2a — 2a IH or IF mRNA MRP6 + 2a 2e + NR + 2a RFTM RFR RFTM RFR RFTM RFR RFTM RFR MRP5 +a +d + +a mRNA MRP4 2a +d RFTM RFR IH or IF Retina MRP1 Protein Protein ICB RFR Efflux Transporters in Human Ocular Tissues Conclusion This article showed the mRNA and protein expression profiles of efflux transporters in human ocular tissues. The wide differences in expression among tissues and cell lines indicate that investigations on efflux transporter functional activity should be based on their natural expressions in ocular tissues, and cell lines should be used with caution when in vitro models are involved. Acknowledgments The authors thank Dr. Ting Liu for his assistance in immunofluorescence microscopy, Dr. Ye Wang for her assistance in Western blotting, Yao Wang for her assistance in cell culture, Weiyun Shi for his critical review of the manuscript, and Ping Lin for her editorial assistance. Authorship Contributions Participated in research design: Wu, P. Chen. Conducted experiments: P. Chen, H. Chen, Jiang, Han. Contributed new reagents or analytic tools: Zang, M. Chen. Performed data analysis: Wu, P. Chen. Wrote or contributed to the writing of the manuscript: Wu, P. Chen. References Barot M, Gokulgandhi MR, Haghnegahdar M, Dalvi P, and Mitra AK (2011) Effect of emergence of fluoroquinolone resistance on intrinsic expression of P-glycoprotein phenotype in corneal epithelial cells. J Ocul Pharmacol Ther 27:553–559. Becker U, Ehrhardt C, Daum N, Baldes C, Schaefer UF, Ruprecht KW, Kim KJ, and Lehr CM (2007) Expression of ABC-transporters in human corneal tissue and the transformed cell line, HCE-T. J Ocul Pharmacol Ther 23:172–181. Bodó A, Bakos E, Szeri F, Váradi A, and Sarkadi B (2003) The role of multidrug transporters in drug availability, metabolism and toxicity. Toxicol Lett 140-141:133–143. Bouhamyia L, Chantot-Bastaraud S, Zaidi S, Roynard P, Prengel C, Bernaudin JF, and Fleury-Feith J (2007) Immunolocalization and cell expression of lung resistancerelated protein (LRP) in normal and tumoral human respiratory cells. J Histochem Cytochem 55:773–782. Budak MT, Alpdogan OS, Zhou M, Lavker RM, Akinci MA, and Wolosin JM (2005) Ocular surface epithelia contain ABCG2-dependent side population cells exhibiting features associated with stem cells. J Cell Sci 118:1715–1724. Constable PA, Lawrenson JG, Dolman DEM, Arden GB, and Abbott NJ (2004) P–Glycoprotein expression in retinal pigment epithelium cell lines. Invest Ophthalmol Vis Sci 45:1309. Chen P, Yin H, Wang Y, Wang Y, and Xie L (2012) Inhibition of VEGF expression and corneal neovascularization by shRNA targeting HIF-1a in a mouse model of closed eye contact lens wear. Mol Vis 18:864–873. Dahlin A, Geier E, Stocker SL, Cropp CD, Grigorenko E, Bloomer M, Siegenthaler J, Xu L, Basile AS, and Tang-Liu DD, et al. (2013) Gene expression profiling of transporters in the solute carrier and ATP-binding cassette superfamilies in human eye substructures. Mol Pharm 10:650–663. Dallas S, Miller DS, and Bendayan R (2006) Multidrug resistance-associated proteins: expression and function in the central nervous system. Pharmacol Rev 58:140–161. Delou JM, Lopes AG, and Capella MA (2009) Unveiling the role of multidrug resistance proteins in hypertension. Hypertension 54:210–216. Dey S, Gunda S, and Mitra AK (2004) Pharmacokinetics of erythromycin in rabbit corneas after single-dose infusion: role of P-glycoprotein as a barrier to in vivo ocular drug absorption. J Pharmacol Exp Ther 311:246–255. Dey S, Patel J, Anand BS, Jain-Vakkalagadda B, Kaliki P, Pal D, Ganapathy V, and Mitra AK (2003) Molecular evidence and functional expression of P-glycoprotein (MDR1) in human and rabbit cornea and corneal epithelial cell lines. Invest Ophthalmol Vis Sci 44: 2909–2918. du Toit LC, Pillay V, Choonara YE, Govender T, and Carmichael T (2011) Ocular drug delivery a look towards nanobioadhesives. Expert Opin Drug Deliv 8:71–94. Edelhauser HF, Rowe-Rendleman CL, Robinson MR, Dawson DG, Chader GJ, Grossniklaus HE, Rittenhouse KD, Wilson CG, Weber DA, and Kuppermann BD, et al. (2010) Ophthalmic drug delivery systems for the treatment of retinal diseases: basic research to clinical applications. Invest Ophthalmol Vis Sci 51:5403–5420. Eechoute K, Sparreboom A, Burger H, Franke RM, Schiavon G, Verweij J, Loos WJ, Wiemer EA, and Mathijssen RH (2011) Drug transporters and imatinib treatment: implications for clinical practice. Clin Cancer Res 17:406–415. Gaudana R, Ananthula HK, Parenky A, and Mitra AK (2010) Ocular drug delivery. AAPS J 12: 348–360. Ghate D and Edelhauser HF (2006) Ocular drug delivery. Expert Opin Drug Deliv 3:275–287. Giacomini KM, Huang SM, Tweedie DJ, Benet LZ, Brouwer KL, Chu X, Dahlin A, Evers R, Fischer V, and Hillgren KM, et al.; International Transporter Consortium (2010) Membrane transporters in drug development. Nat Rev Drug Discov 9:215–236. Goel M, Picciani RG, Lee RK, and Bhattacharya SK (2010) Aqueous humor dynamics: a review. Open Ophthalmol J 4:52–59. Hariharan S, Gunda S, Mishra GP, Pal D, and Mitra AK (2009) Enhanced corneal absorption of erythromycin by modulating P-glycoprotein and MRP mediated efflux with corticosteroids. Pharm Res 26:1270–1282. Juuti-Uusitalo K, Vaajasaari H, Ryhänen T, Narkilahti S, Suuronen R, Mannermaa E, Kaarniranta K, and Skottman H (2012) Efflux protein expression in human stem cell-derived retinal pigment epithelial cells. PLoS ONE 7:e30089. Kajikawa T, Mishima HK, Murakami T, and Takano M (1999) Role of P-glycoprotein in distribution of rhodamine 123 into aqueous humor in rabbits. Curr Eye Res 18:240–246. Kansara V and Mitra AK (2006) Evaluation of an ex vivo model implication for carrier-mediated retinal drug delivery. Curr Eye Res 31:415–426. Karla PK, Earla R, Boddu SH, Johnston TP, Pal D, and Mitra A (2009) Molecular expression and functional evidence of a drug efflux pump (BCRP) in human corneal epithelial cells. Curr Eye Res 34:1–9. Karla PK, Pal D, and Mitra AK (2007a) Molecular evidence and functional expression of multidrug resistance associated protein (MRP) in rabbit corneal epithelial cells. Exp Eye Res 84:53–60. Karla PK, Pal D, Quinn T, and Mitra AK (2007b) Molecular evidence and functional expression of a novel drug efflux pump (ABCC2) in human corneal epithelium and rabbit cornea and its role in ocular drug efflux. Int J Pharm 336:12–21. Kawazu K, Yamada K, Nakamura M, and Ota A (1999) Characterization of cyclosporin A transport in cultured rabbit corneal epithelial cells: P-glycoprotein transport activity and binding to cyclophilin. Invest Ophthalmol Vis Sci 40:1738–1744. Kennedy BG and Mangini NJ (2002) P-glycoprotein expression in human retinal pigment epithelium. Mol Vis 8:422–430. Klaassen CD and Aleksunes LM (2010) Xenobiotic, bile acid, and cholesterol transporters: function and regulation. Pharmacol Rev 62:1–96. Klaassen CD and Lu H (2008) Xenobiotic transporters: ascribing function from gene knockout and mutation studies. Toxicol Sci 101:186–196. Leonard GD, Fojo T, and Bates SE (2003) The role of ABC transporters in clinical practice. Oncologist 8:411–424. Li B, Lee MS, Lee RS, Donaldson PJ, and Lim JC (2012) Characterization of glutathione uptake, synthesis, and efflux pathways in the epithelium and endothelium of the rat cornea. Cornea 31: 1304–1312. Mannermaa E, Vellonen KS, Ryhänen T, Kokkonen K, Ranta VP, Kaarniranta K, and Urtti A (2009) Efflux protein expression in human retinal pigment epithelium cell lines. Pharm Res 26: 1785–1791. Mannermaa E, Vellonen KS, and Urtti A (2006) Drug transport in corneal epithelium and bloodretina barrier: emerging role of transporters in ocular pharmacokinetics. Adv Drug Deliv Rev 58:1136–1163. Merriman-Smith BR, Young MA, Jacobs MD, Kistler J, and Donaldson PJ (2002) Molecular identification of P-glycoprotein: a role in lens circulation? Invest Ophthalmol Vis Sci 43: 3008–3015. Mitra AK (2009) Role of transporters in ocular drug delivery system. Pharm Res 26: 1192–1196. Miyazawa T, Kubo E, Takamura Y, and Akagi Y (2007) Up-regulation of P-glycoprotein expression by osmotic stress in rat sugar cataract. Exp Eye Res 84:246–253. Mossink MH, van Zon A, Fränzel-Luiten E, Schoester M, Kickhoefer VA, Scheffer GL, Scheper RJ, Sonneveld P, and Wiemer EA (2002) Disruption of the murine major vault protein (MVP/ LRP) gene does not induce hypersensitivity to cytostatics. Cancer Res 62:7298–7304. Nevala H, Ylikomi T, and Tähti H (2008) Evaluation of the selected barrier properties of retinal pigment epithelial cell line ARPE-19 for an in-vitro blood-brain barrier model. Hum Exp Toxicol 27:741–749. Obligacion R, Murray M, and Ramzan I (2006) Drug-metabolizing enzymes and transporters: expression in the human prostate and roles in prostate drug disposition. J Androl 27:138–150. Pahuja P, Arora S, and Pawar P (2012) Ocular drug delivery system: a reference to natural polymers. Expert Opin Drug Deliv 9:837–861. Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 the RPE (Kansara and Mitra, 2006). ARPE-19, a commercially available human RPE cell line, is usually selected as a model of RPE in studies of transport, protein expression/secretion, and barrier breakdown (Zhang et al., 2006; Nevala et al., 2008). Therefore, in this study, the RC and ARPE-19 were used to determine and compare the difference in the efflux transporter expression. The retinal and choroidal tissue complex is composed of multiple layers, and the RPE is just one of the cell types in the RC. To our knowledge, there have been only two reports on efflux transporter mRNA expressions in the human retina (Zhang et al., 2008; Dahlin et al., 2013). Zhang et al. investigated MDR1, MRP1-3, and BCRP mRNA expressions and found that all these efflux transporters had mRNA expressions (Zhang et al., 2008). But the protein expression profiles in the human retina were not concerned. In the current study, no mRNA expression of MRP3 and MRP6, and relatively low expressions of MRP4 and MRP7 were detected, but others had high expressions. At the protein level, we only failed to observe MRP4, and MRP1, MRP2, MRP6, and MDR1 were further verified as having relatively high expressions in the retina. When compared with the human retina-choroid, ARPE-19 had a significantly different efflux transporter expression profile. Therefore, ARPE-19 should be used with caution when in vitro models are used in the efflux transporter research (Constable et al., 2004; Mannermaa et al., 2009). Many ocular tissues exist that are not major barriers to ocular drug delivery but express various efflux transporters (Merriman-Smith et al., 2002; Miyazawa et al., 2007). Further investigations may be needed. 1947 1948 Chen et al. Verstraelen J (2011) Expression analysis of ABCC and ABCG transporters in different in vitro and ex vivo cornea models. Invest Ophthalmol Vis Sci 52:283. Wu CP, Ohnuma S, and Ambudkar SV (2011) Discovering natural product modulators to overcome multidrug resistance in cancer chemotherapy. Curr Pharm Biotechnol 12: 609–620. Wu XG, Xin M, Chen H, Yang LN, and Jiang HR (2010) Novel mucoadhesive polysaccharide isolated from Bletilla striata improves the intraocular penetration and efficacy of levofloxacin in the topical treatment of experimental bacterial keratitis. J Pharm Pharmacol 62: 1152–1157. Xiang CD, Batugo M, Gale DC, Zhang T, Ye J, Li C, Zhou S, Wu EY, and Zhang EY (2009) Characterization of human corneal epithelial cell model as a surrogate for corneal permeability assessment: metabolism and transport. Drug Metab Dispos 37:992–998. Yang JJ, Kim KJ, and Lee VH (2000) Role of P-glycoprotein in restricting propranolol transport in cultured rabbit conjunctival epithelial cell layers. Pharm Res 17:533–538. Zhang N, Kannan R, Okamoto CT, Ryan SJ, Lee VH, and Hinton DR (2006) Characterization of brimonidine transport in retinal pigment epithelium. Invest Ophthalmol Vis Sci 47:287–294. Zhang T, Xiang CD, Gale D, Carreiro S, Wu EY, and Zhang EY (2008) Drug transporter and cytochrome P450 mRNA expression in human ocular barriers: implications for ocular drug disposition. Drug Metab Dispos 36:1300–1307. Address correspondence to: Dr. Xianggen Wu, State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory of Ophthalmology, Shandong Eye Institute, Shandong Academy of Medical Sciences, Qingdao 266071, P. R. China. E-mail: [email protected] Downloaded from dmd.aspetjournals.org at ASPET Journals on May 12, 2017 Pelis RM, Shahidullah M, Ghosh S, Coca-Prados M, Wright SH, and Delamere NA (2009) Localization of multidrug resistance-associated protein 2 in the nonpigmented ciliary epithelium of the eye. J Pharmacol Exp Ther 329:479–485. Perini F, Casabianca A, Battocchi C, Accoroni S, Totti C, and Penna A (2011) New approach using the real-time PCR method for estimation of the toxic marine dinoflagellate Ostreopsis cf. ovata in marine environment. PLoS ONE 6:e17699. Saghizadeh M, Soleymani S, Harounian A, Bhakta B, Troyanovsky SM, Brunken WJ, Pellegrini G, and Ljubimov AV (2011) Alterations of epithelial stem cell marker patterns in human diabetic corneas and effects of c-met gene therapy. Mol Vis 17:2177–2190. Saha P, Yang JJ, and Lee VH (1998) Existence of a p-glycoprotein drug efflux pump in cultured rabbit conjunctival epithelial cells. Invest Ophthalmol Vis Sci 39:1221–1226. Sasaki H, Yamamura K, Mukai T, Nishida K, Nakamura J, Nakashima M, and Ichikawa M (1999) Enhancement of ocular drug penetration. Crit Rev Ther Drug Carrier Syst 16:85–146. Su L, Mruk DD, Lee WM, and Cheng CY (2011) Drug transporters and blood—testis barrier function. J Endocrinol 209:337–351. Tártara LI, Quinteros DA, Saino V, Allemandi DA, and Palma SD (2012) Improvement of acetazolamide ocular permeation using ascorbyl laurate nanostructures as drug delivery system. J Ocul Pharmacol Ther 28:102–109. Ulbrich W and Lamprecht A (2010) Targeted drug-delivery approaches by nanoparticulate carriers in the therapy of inflammatory diseases. J R Soc Interface 7 (Suppl 1):S55–S66. Urtti A (2006) Challenges and obstacles of ocular pharmacokinetics and drug delivery. Adv Drug Deliv Rev 58:1131–1135. Vellonen KS, Turner N, Toropainen E, Honkakoski P, and Urtti A (2006) Gene expression and activity of efflux proteins in human corneal epithelial cells. Invest Ophthalmol Vis Sci 47: 1597. Vellonen KS, Mannermaa E, Turner H, Häkli M, Wolosin JM, Tervo T, Honkakoski P, and Urtti A (2010) Effluxing ABC transporters in human corneal epithelium. J Pharm Sci 99:1087–1098.