* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Bioinformatics
Survey
Document related concepts
Point mutation wikipedia , lookup
Genome evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Human genome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic library wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Metagenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genome editing wikipedia , lookup
Transcript
Bioinformatics Lecture 7: Introduction to Perl Introduction • • Basic concepts in Perl syntax: – variables, strings, input and output – Conditional and iteration – File handling and error handling – Arrays, lists and hashes First program • a basic Strings program: Test.pl – #!/usr/bin/perl – print "Hello boys and girs!\n this is introduction to perl"; • Open with notepad and type the above • Save file as hello.pl • Ensure that hide file extensions option is unchecked. • Run via the command line Variables declarations • $variable name : intergers, floats, strings. • @ arrays • Arithmetic operators: – +, -, *, / , **( exponentation); % modulus • Double v single quotation marks – $x = ‘ I am from Cork ‘ – print “the value of $x is $x\n” – print ’the value of $x is $x\n’ – print “the value of \$x is $x\n” # note the \$x – #evaluating expressions in print (# comment line symbol) – $ x = 15; – Print “the value of x is “, $x + 3, “\n” (ArithmeticExample.pl) • Input , output and files handling Input – $var = <> (input a line of text and assign it to $var): also iputs return character – Chomp $var removes the return character from the #also used the word chop – Alternatively chomp($var = <>); – $line = <DATA> reads in “hardcoded data” • Output – print (already covered) • File Handling – – – – – open MYFILE , ‘data.txt’ (open file for reading;) open MYFILE, ‘>data.txt’ (open file for writing) Open MYFILE, ‘>> data.txt’ (open file for appending) $line = <MYFILE > #read one line from file @entire_file = <MYFILE> ; (called slurping) #reads all the file into an array – print MYFILE “Do you like computers….”, $number/3, “\n” # write out to file – close MYFILE; Conditional Operator • • • • • • • == Equality != Not equal < Less than > Greater than <= Less than or equal to >= Greater than or equal to ! Logical not $a == $b $a != $b $a < $b $a > $b $a <= $b $a >= $b $ = !$b String conditional operator • • • • • • • • eq ne lt gt le ge . =~ Equality $a eq $b Not equal $a ne $b Less than $a lt $b Greater than $a gt $b Less than or equal to $a le $b Greater than or equal to $a ge $b Concatenation $a.$c Pattern match $a =~ /gatc/ Conditional statements • If and elseif and else if_else.pl • #!/usr/bin/perl • • print “Enter your age: ”; $age = <>; • • • • • • • • • • if ($age <= 0) { print “You are way too young to be using a computer.\n”; } elseif ($age >= 100) { print “Not in a dog’s life!\n”; } else { print “Your age in dog years is ”,$age/7,“\n”; } • Iteration: loops • While-loops – – – – – – #!/usr/bin/perl $count = 1; while ($count <= 5) { print “$count potato\n”; $count = $count + 1; } • Until-loops – – – – – – #!/usr/bin/perl $count = 1; until ($count > 5) { print “$count potato\n”; $count = $count + 1; } Loops with defined • • • • #!/usr/bin/perl # defined fnt is true if $line assigned a value print “Type something. ‘quit’ to finish\n ”; while ( defined($line = <>) ) { – chomp $line; – last if $line eq ‘quit’; # breaks out of loop at quit – print “You typed ‘$line’\n\n”; – print “Type something> ”; • } • print “goodbye!\n”; loops_defined.pl Shorthand input notation • #!/usr/bin/perl • print “Type something. ‘quit’ to finish\n ”; • while (<>) { – chomp; # $_ generic variable name – last if $_ eq ‘quit’; – print “You typed ‘$_ ’\n\n”; – print “Type something> ”; • } • print “goodbye!\n”; Change Standard input/ output • redirect Sdout to a file – U:\test test.pl > stdout.txt [produces a text file ] • print file goes to file and not to screen • Run Loops_defined to redirect to output to file • The <> input has one feature where if a file name is on the command line it beings to read from it otherwise it reads from keyboards – U:\test commandline.pl stdin.txt Finding length of file • • • • #!/usr/bin/perl #File_size_1.pl # file size.pl $length = 0; # set length counter to zero $lines = 0; # set number of lines to zero • print “enter text one line at a time and press (ctrl z) to quit”; • while (<>) { # read file one line at a time – chomp; # remove terminal newline – $length = $length + length $_ ; – $lines = $lines + 1; • } • print “LENGTH = $length\n”; • print “LINES = $lines\n”; • Try using keyboard as Stdin (ctrl Z) and file name on command line Dynamic Arrays • Declaration of an array in perl – @sequences = (‘123a’, ‘23ed4’, ‘2334d’); – Array contains 3 strings!!! • Array operations: – – – – – – $one_seq = @sequences[2] {zero based array} @seq = @sequences; assigns arrays @seq = (@seq, ‘125f’); adding an value @combined = (@seq, @seq2) Removing (splice) @removed = splice @seq, 1, 2 slicing : @slice = @seq[1,2]; • Splice_slice_array.pl Dynamic Arrays – push @sequences, ‘2345d’; (adds element to end of array) – Pop @sequences removes and returns (function returns) last element of array – Shifting: removes and returns the first element of an array. – Unshifting: Adds an element or list of elements onto the beginning of an array. Shift Pop push unshift example • #! /usr/bin/perl • # The 'pushpop' program - pushing, popping, shifting and unshifting. • • • • • • • • • • • • @sequences = ( 'TTATTATGTT', 'GCTCAGTTCT', 'GACCTCTTAA', 'CTATGCGGTA', 'ATCTGACCTC' ); • What is the expected output (run code to confirm) print "@sequences\n"; $last = pop @sequences; print "@sequences\n"; $first = shift @sequences; print "@sequences\n"; unshift @sequences, $last; print "@sequences\n"; push @sequences, ( $first, $last ); print "@sequences\n"; Arrays: two more functions • Substr (extracting a substring from a string) – $sub = substr ($string, offset position[position to begin extraction], size of substring) • Substr and index: • To obtain the reverse complement of a DNA sequence: assume the sequence is stored in array: (GGGGTTTT becomes AAAACCCC) Iterating through an array: – foreach $dna (@dna) – { • $dna = reverse $dna; # reverse the contents of a scalar $dna • $dna =~ tr/gatcGATC/ctagCTAG/; • – # tr (translate first set into second; e.g. g becomes c ) complement (replace) – } Questions • how would you read in a file of DNA sequence into an array and print both the original and reverse complementary copy • What use could this program have? (biology related answer) Array and lists • Lists are an array of constants or variables – Values of a list assigned to any array • @clones = (’192a8’,’18c10’,’327h1’,’201e4’); – Values in an array assigned to a list – ($first,$second,$third) = @clones; Hashes: associative arrays • Similar arrays but elements are unordered – Two parts: the identifer (name), a scalar value (string) – Add Elements are referred to by strings: • • • • %oligos = (); $oligos{’192a8’} = ‘GGGTTCCGATTTCCAA’; $oligos{’18c10’} = ‘CTCTCTCTAGAGAGAGCCCC’; $oligos{’327h1’} = ‘GGACCTAACCTATTGGC’; – Note in the name part use ‘ ‘ – Removing elements: • Delete $oligos{’192a8’}; Hashes • Outputting hash results • $s = $oligos{’192a8’}; • print “oligo 192a8 is $s\n”; • print “oligo 192a8 is ”,length $oligos{’192a8’},“ base pairs long\n”; • print “oligo 18c10 is $oligos{’18c10’}\n”; • Expected output: input_output_hash.pl • oligo 192a8 is GGGTTCCGATTTCCAA • oligo 192a8 is 16 base pairs long • oligo 18c10 is CTCTCTCTAGAGAGAGCCCC Hashes • Example of the use of a Hash table – hash_bases.pl program • For loops and hash tables – – – – – foreach $clone (’327h1’,’192a8’,’18c10’) { print “$clone: $oligos{$clone}\n”; } %oligos is refers to the hash table $oligos is used to refer to elements • $size = keys %oligo; returns the number of entries Displaying all entries in a hash table • while ( ( $genome, $count ) = each %gene_counts ) • { • print "`$genome' has a gene count of $count\n"; } • • • • • foreach $genome ( sort keys %gene_counts ) { print "`$genome' has a gene count of $gene_counts { $genome }\n";} Refer to genes.pl Error Handling • die function: • open myfile, ‘stdin.txt’ or • Die “could not open file aborting…\n”; – If file does not exits the program terminates with the above message • Write a program to read in data from a file to an array and when all the data is input to output in reverse order • Create a hash table that performs the condon to AA conversion and use it to convert codons {entered from the key board} into their corresponding Amino Acids