* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nucleotide sequences of genome segments $8, encoding a capsid
Structural alignment wikipedia , lookup
Bimolecular fluorescence complementation wikipedia , lookup
Protein design wikipedia , lookup
Protein folding wikipedia , lookup
Protein domain wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Protein purification wikipedia , lookup
Western blot wikipedia , lookup
Intrinsically disordered proteins wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Alpha helix wikipedia , lookup
Protein mass spectrometry wikipedia , lookup
Journal of General Virology (1991), 72, 2837-2842. Printed in Great Britain 2837 Nucleotide sequences of genome segments $8, encoding a capsid protein, and $10, encoding a 36K protein, of rice gall dwarf virus Hiroaki Noda, 1 Koichi Ishikawa, 2 Hiroyuki Hibino, 2 Hajime Kato2t and Toshihiro Omura 2. 1National Institute of Sericultural and Entomological Science and 2National Agriculture Research Center, Tsukuba, Ibaraki 305, Japan The nucleotide sequences of DNAs complementary to the eighth ($8) and the tenth (S10) largest of the 12 genome segments of rice gall dwarf virus (RGDV) were determined. The $8 and S10 segments consist of 1578 and 1198 nucleotides, each with a single open reading frame extending for 1278 nucleotides from nucleotide 21, and 960 nucleotides from nucleotide 22, respectively. $8 encodes a polypeptide of 426 amino acids with an Mr of 47419. The amino acid sequences of several peptide fragments of the major outer capsid protein reported as 45K were contained in the predicted polypeptide. This protein, renamed the 47K protein, showed high homology with the outer capsid proteins of rice dwarf virus (RDV) and wound tumour virus (WTV); there was 56, 52 and 48 % amino acid sequence identity between R G D V and WTV, R G D V and RDV, and R D V and WTV, respectively. S10 had the coding potential for a polypeptide of 320 amino acids with an Mr of 36095 (36K protein), which exhibits 32% and 35 % amino acid sequence identity with the predicted translation product of R D V $9 and the P9 capsid protein encoded by WTV S 1 l, respectively. The conserved terminal sequences 5' G G . . . G A U 3' which are present in all genome segments of W T V and R D V so far analysed, and in $9 of RGDV, were also found in R G D V $8 and S 10. This conserved sequence together with the segment-specific inverted repeats found in the terminal sequence of R G D V $8 and S10 are thus characteristic structures common to all three phytoreoviruses. The nucleotide sequence of the region surrounding the inverted repeats was more similar between R G D V and WTV than between R G D V and RDV. The phytoreoviruses, wound tumour virus (WTV), rice dwarf virus (RDV) and rice gall dwarf virus (RGDV), have icosahedral double-shelled particles approximately 65 to 70 nm in diameter, containing 12 segments of dsRNA and several proteins (Nuss & Dall, 1990). Of the proteins, the outer capsid protein is the major constituent of the virus particles. Therefore, information on the primary structure of the eapsid protein would be useful for understanding a major part of the organization of the particle. The nucleotide sequence of the eighth largest genome segment ($8) encoding the outer capsid protein has been analysed for WTV (Xu et al., 1989a) and RDV (Omura et al., 1989). In WTV, the primary structure of the P9 protein, which was reported to be another constituent of the capsid, was studied by nucleotide sequence analysis of genome segment Sll (Dall et al., 1989). This paper describes the nucleotide sequence of genome segment $8 of RGDV which encodes the outer capsid protein and that of S10 which encodes a protein with an amino acid sequence highly homologous to the P9 protein of WTV. The cDNA library of RGDV genome segments cloned into pBR322 was described by Koganezawa et al. (1990). Of the five clones that hybridized specifically with $8 dsRNA labelled with [7-32p]ATP, two corresponding to the original full-length dsRNA were selected for sequencing. A series of unidirectionally deleted cDNAs were formed by digestion from one end with exonuclease III (Takara Shuzo) and the ssDNAs were prepared for sequencing. Both polarities of the cDNAs were sequenced at least twice. Dideoxynucleotide chain termination reactions and sequence analysis were carried out as reported by Koganezawa et al. (1990). The nucleotide sequence of segment $8 is shown in Fig. 1 (a). The segment contains 1578 bp of dsRNA with a calculated Mr of 1"01 × l06 and a GC content of 42-5~. It has one long open reading frame, which starts from residue 21 and extends for 1278 nucleotides, followed by a 3' non-coding region of 280 nucleotides. No other open reading frame, including those in the strand of opposite polarity, exceeded 54 amino acids. The open reading frame has the coding potential for a 426 amino acid polypeptide with a calculated Mr of t Present address: Kobe University, Nada, Kobe 657, Japan. 0001-0297 © 1991 SGM Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49 Short communication 2838 (a) ~ S R A W E T S A L I C I S £ y G T K C S F D T F O G L T I 119 33 L O A M S C F V N F I S 239 73 I A T Y I K R F S R T V 359 113 AA~AC~c~Ac~A~c~Au~A~AcC~AA~cc°~°°cGuciGU°~G~UC~G~Au~AcccA~G~AcccCGC~Uc~°cui~°~cA~°u°~A~G~UAA~U~^~uucA N D I S T L N L M N Q I V A S V G F T A O R H A M L O K N W D S D V A P L N D V T T R T D N P 479 153 UCU~AC°UACU~GCCA°~UUAAUAAUUUU°CCUU~A°CCAAU~°AAAAiCCAAAACU°AUCUCCA~ACAACUU°°A°UUCUGAA°°CUUAU~AUAUACC°UAUUC~ACACCAAUcAAU M D V A R S A N V V 0 V S R R A L S T L I Q G A O N V T I V S E S 599 193 D 719 233 AA~AUUAUCUUUG~AAcUAGAUcUCUAAAU~CUAUU°¢UCCA~CAAUUUUCA~AUUAAUGUACCA~CA~UAUU~AGAC~U~AAU~UAGUU~AC~CUAG~AUU~AUUU~AcUAAUA°U 839 273 sLs s o o * , ~ V r T V, T o Y o t A 959 313 s P S ~ , s o x v , , ° , , I079 353 1199 393 0 P L P F A S R K L I I H L i V l " S F I V F G R Y Y T V 1319 428 N 1439 AU~cGACA¢ACUAACUAcUA~c~A~A°ACCAU¢UcUA~U~UU~°~UUAA~AU~CA~C~A°U~AU~¢A°CAAUCGAC~cA~°A~UU°A°~AGUA~cU~A~c°U°CU~GCCcA¢~CA¢ 1559 1578 UGU°OUCACAAAAAAUGAU (b) TST wrv L I NIV D S D)A qV S F S L]AGL~_~JVII, V r T A VIP ,('~0 ~ * I A Z E olD,, LSNLS /= YGF PI° x x RIC]O s Y y 1"[GV]S I I'lL0 A o~Pt~ ~ ~ ~ ~l Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49 3zs Short communication 47419 (47K). Among the RGDV proteins, the 45K protein, the major constituent of the outer capsid (Omura et al., 1985), was the closest in size to the predicted polypeptide. Hence, partial amino acid sequences of the outer capsid protein were analysed and compared with those of the predicted 47K polypeptide. RGDV was purified as reported previously (Omura et al., 1982). Amino acid sequencing of the major capsid was carried out according to the method of Omura et al. (1989). After electrophoresis of the dissociated proteins of purified RGDV, the band corresponding to the outer capsid protein reported as the 45K protein was electroeluted and digested with trypsin. The peptide fragments were isolated by HPLC with a reverse-phase column and were subjected to amino acid sequence analysis using automatic protein sequencers (Applied Biosystems, 477A and Shimadzu PSQ-1). As shown in Fig. 1 (a), amino acid sequences of the polypeptide fragments obtained by digestion with trypsin correlated with the amino acid residues 85 to 95, 143 to 148, 160 to 166, 363 to 375 and 404 to 407 of the polypeptide predicted from the nucleotide sequence. These results demonstrate that genome segment $8 of RGDV encodes the major outer capsid protein which has previously been called the 45K protein. The protein is to be renamed the 47K protein. The phytoreoviruses have almost identical morphologies, based on electron microscopic observation of RDV (Omura et al., 1989), RGDV (Omura & Inoue, 1985) and WTV (Streissle & Granados, 1968). They all have icosahedral double-shelled spherical particles of 65 to 70 nm. The morphological similarity of these viruses is considered to depend on the spatial conformation of structural proteins; i.e. the subunit proteins of the capsomere and the core proteins. The outer capsid of RDV is composed of 180 capsomeres (Kimura & Shikata, 1968; Uyeda & Shikata, 1982) which are trimers of 46K protein subunits (Omura et al., 1989) and the core of RDV consists of 114K proteins (Kano et al., 1990). The major outer capsid proteins of the three viruses are similar in size, 47K in RGDV (Fig.1 a), 46K in RDV (Omura et al., 1989) and 48K (one of the outer capsid proteins, P8, encoded by $8) in WTV (Xu et al., 1989a). As shown in Fig. 1(b), the primary structures of these proteins show homology: 56, 52 and 48% amino acid sequence identity between RGDV and WTV, RGDV and RDV, and RDV and WTV, respectively. Furthermore, approximately 38 % of the sequences are common among the three viruses. The amino- and carboxyterminal domains of the proteins are especially highly 2839 conserved among the three viruses, i.e. 14 of the first 19 amino-terminal amino acids and 18 of the last 25 carboxy-terminal amino acids are identical in the three viruses. Some regions with stretches of 10 amino acids identical were detected between residues 381 and 390 of RGDV and 377 to 386 of RDV, and between residues 414 to 423 of RGDV and 415 to 424 of WTV. This similarity in primary structure may result in subunits being folded to give capsomeres of the same dimensions, which would make the three viruses indistinguishable in electron microscopy. The high scores (70 to 75%) obtained for chemically similar amino acids (Dayhoff et al., 1972) would also support the supposition that the spatial conformations of the subunit proteins are identical. The similar structures, with homologous arrangement of the capsid protein amino acids as described above, nevertheless seem to be serologically distinguishable. No cross-reaction was observed between RGDV and RDV (Omura et al., 1985), or between RDV and WTV (Liu & Black, 1978) when intact virus particles were used as antigens. The domains with long identical amino acid sequences are therefore not thought to be on the surface of the virus particles. This assumption correlates with the fact that RGDV reacts with antiserum against dissociated RDV particles (Matsuoka et al., 1986). The spatial disposition of amino acids in capsomeres, and the interactions between capsomeres and the core should be discernible by X-ray diffraction studies using crystals of RDV (Mizuno et al., 1990). The nucleotide sequence of S10 is shown in Fig. 2(a). The segment contains 1198 bp of dsRNA with a calculated Mr of 0-77 x 106 and a GC content of 45-2%. It has one long open reading frame, which starts from residue 22 and extends for 960 nucleotides, followed by a 3' non-coding region of 217 nucleotides. None of the other open reading frames exceeds 61 amino acids. The open reading frame has the coding potential for a 320 amino acid polypeptide with a calculated Mr of 36095 (36K). High homology was detected between the 36K protein of RGDV and the 38-9K protein of RDV, encoded by genome segment $9 (Fukumoto et al., 1989), and the P9 protein of WTV, encoded by genome segment SI1 (Dall et al., 1989) (Fig. 2b). There is 35%, 32% and 37 % amino acid sequence identity between RGDV and WTV, RGDV and RDV, and RDV and WTV, respectively. There are a series of identical six-amino acid sequences at residues 3 to 8 in the 36K protein of RGDV and the corresponding region in the 38.9K Fig. 1. (a) Nucleotidesequence of the plus-sense strand of segment$8 of RGDV and the amino acid sequence of its predicted translation product. The in-phase termination codon is indicated with an asterisk. The amino acid sequences of several peptide fragmentswhichhavebeendeterminedare underlined.(b) Alignmentof the predictedaminoacidsequencesof the majoroutercapsid proteins of RGDV, RDV and WTV, whichare all encodedby genomesegment$8. Identicalaminoacids are boxed. Gaps (-) were inserted to maximizethe alignment.Numbers are amino acid positions from the N terminus. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49 2840 Short communication (a) GGUAUUUUUcGcAUAGAcGCAAUGGccGG0~AAc~cA~GAc~Cc~AA~cAA~A~Ac~A~0AAcc~c~c~A~A~c~UG~A~UcA~cAA~A~ M A 6 K L O D G V A I A K I K E T I N F C E Y S F G D L V N N 120 33 R K N A A L A W P D L 1 ~ C F H S S H Y G V ~ K F L 240 73 G F T L L G V S S Q N ~ P F D L ~ V T K A P C N L D F 360 113 D F S S ~ H S A F L D E E G H S H S E L G I fl D E D 480 153 UUUGUUCUGcGUAcUAAGC~GCUUUUCUACAUCAUUCAU~AAUAUCAcAUGAGCCUGGAC~AGAUUGAGCCUUGGU~GGAGAAG¢UGCCUGAUGCAUCAGGG~GUACG0UACUCAACCAA F V L R T K L F I I H E Y H ~ S L D E I E P W L K L P 9 A S G G r L N 600 193 AAGAGUAAAGAG0AAAUGCGGGUAAUCUUUUCGAAUGCUAAAGUUAGAAiUGCGAACAGUAUUAACUUGUAUGUAACUACGCACACCAAUAGUUA¢AAUGAGUAC~UUCGCGAAGUCGCA K S K E 0 M V I S N A K V R I A N S I N L V T H T N S Y N E ~ V E V 720 233 GA~UAUGUcGCU~ACUUGUGGAA¢AUCCAAAcGACCACAAA~ACUCAA~6ACAUGAAAACGAACUUGCAGC~GAG~AUU~CG~AGUGUUGGCU~CAUCUUCACA~AUGAAUGGAACGAAA E Y V A D L M I T T T N T O G H E N E L A E D G V L A S S S Q ~ G T 840 273 L 96O 313 R ~ I ¥ G R V H D D I A L S T R F l D E ¥ L H N S E L G 0 S I A K D 6 N E V K L E P A ~ F N 0 T E E M E L A G S E F S 1080 320 A~CGACGACGGAA~AAUGGGGUAAGUACGCUUACUUcAGCGGCAUCcAACU~AUCACcAGG~UGAAAGAUA¢UG~UGUAUAUUUUCGcCAAU~UA~AAUCAUUUAACAUCUUUGAAA~G S D D G ~ M * 1198 A~Gc~c~C~A~c~G~c~UcA~0~U~c~Gc~cA~c~0~C~GGAGcccG~GUAcccACcUU~G~GGAA~ccc~GGA0AAGGAG~ccU6~c~A~GcGAGAA~AU~A~ (b) ,oo, 1,, RGDV DSPS5~ RGDV - E A DEEGVHS~SI~IEILI-IGI8IDIIEDIRFI~ILIRI-'TKRL VAD L M IO-- TT- OG ....... . . . . . . N ....... . Y IHE A . HM DKIEPII~LEKL~'" ". . FGVL . . . . -S S MN i~2 271 . 351 320 313 Fig. 2. (a) Nucleotide sequence of the plus-sense strand of segment S l 0 of R G D V and the a m i n o acid sequence of its predicted translation product. The in-phase termination codon is indicated with an asterisk. (b) Alignment of the predicted amino acid sequences encoded by genome segment S10 of R G D V , $9 of R D V and S11 of WTV. Identical a m i n o acids are boxed. G a p s (-) were inserted to maximize the alignment. N u m b e r s are a m i n o acid positions from the N terminus. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49 Short communication RGDV S10 RGDV $9 RGDV $8 2841 5' GG U AUUUUUGUAccAAcAcGAUG AAAAAACAcUGGUGUGCUGG GU 3' UA GGUAuuu UUUcccUUUUGAGUCAUCAUG GGUAuUuu UCGCAUAGACGCAAUG uAGUAGAAGAGCGUAUC uAGUAAAuAAAAGGG WTV $8 WTV $9 WTV $I1 5' 3' GGUAuUuuucuccuUUUGAAAAGCCAUG uAGUAcAAAGAGGA GGUAu UUUUCUAccUACCGCGAUG uAGUAcAAAAGGUGG GGUAu UUUUCUCUUUA C CAUG UAGUACAAAGGAGAAAUCAfiUAC RDV $8 RDV $9 5' GGCAAAAAUCGCCACCuGCCAcuAUG AUAUUUGGCAGGUGGAC UGAUGC 3 ' UAGU GGuAAAAAUCGUGUG UCCUCCGUGAUG GCAUAUUUAGCACAC UA Fig. 3. Comparison ofthe terminal sequence domains ofthe inverted repeats of the corresponding segments (see text)ofRGDV, RDV and WTV. No segment corresponding to $9 of RGDV and WTV could be detected in segments $3 to $I0 of RDV. Data cited were reported by Koganezawa et al. (1990) for RGDV $9, Xu et al. (1989a) for WTV $8, Anzola et al. (I 989) for WTV $9, Dall et al. (1989) for WTV Sll, Omura et al. 0989) for RDV $8 and Fukumoto et al. (1989) for RDV $9. protein of RDV, and at residues 6 to 11 and 80 to 85 in the RGDV protein and corresponding regions in the P9 protein of WTV, respectively. The P9 protein of WTV (Xu et al., 1989b) has been proposed as one of the capsid proteins (Reddy & MacLeod, 1976). As mentioned above, the predicted amino acid sequence of the P9 protein of WTV (Dall et al., 1989) is homologous to the 36K protein of RGDV which does not correspond to any protein released from purified RGDV (Omura et al., 1985). There is no evidence indicating that the 38.9K protein of RDV is also a capsid protein. By including the sequence information for genome segments $8 and SI0 with $9 of RGDV (Koganezawa et al., 1990), striking similarities were found in the terminal structures of the genome segments of all three phytoreoviruses. The terminal sequences, 5" G G . . . G A U Y, conserved in all the genome segments of WTV (Anzola et al., 1987), RDV $3 to S10 ( U y e d a e t a l . , 1987, 1989, 1990; Omura et al., 1988, 1989; Fukumoto et al., 1989; Nakashima et al., 1990; Suzuki et al., 1990a, b) and RGDV $9 (Koganezawa et al., 1990), were found in RGDV $8 and S10. Segment-specific inverted repeats were also found in residues 5 to 21 and 1557 to 1573 for $8, and 4 to 16 and 1282 to 1195 for S10 of RGDV (Fig. 3), as reported in all the genome segments of WTV, RDV and RGDV described above. Thus, the terminal sequence, 5' G G . . . GAU 3', and the inverted repeat are structures characteristic of genome segments of phytoreoviruses and may be associated with common functions. Terminal nucleotide sequences associated with the inverted repeat were compared among the three phytoreoviruses (Fig. 3). All nine nucleotides at the 5' and five nucleotides at the 3' termini were identical among RGDV $8, $9 and SI0 and WTV $8, $9 and Sll. However, homology was low between RGDV and RDV, except for the conserved 5' (GG) and 3' (GAU) termini. The molecular structures of the genome termini, assumed to regulate their own expression in WTV (Xu et al., 1989a), were closer between RGDV and WTV than between RGDV and RDV, despite the fact that the plant host and vectors are different for RGDV and WTV and similar for RGDV and RDV. The authors are grateful to Dr H. Kano, Dr H. Hirano and Dr T. Watanabe for their continued interest and valuable suggestions. References ANZOLA, J. V., Xu, Z., ASAMIZU,T. & NUSS, D. L. (1987). Segmentspecific inverted repeats found adjacent to conserved terminal sequences in wound tumor virus genome and defective interfering RNAs. Proceedings o f the National Academy o f Sciences, U.S.A. 84, 8301-8305. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49 2842 Short communication ANZOLA, J. V., DALL, D. J., Xu, Z. & NUSS, D. L. (1989). Complete nucleotide sequence of wound tumor virus genomic segments encoding non-structural polypeptides. Virology 171, 222-228. DALL, D. J., ANZOLA,J. V., Xu, Z. & NUSS, D. L. (1989). Complete nucleotide sequence of wound tumor virus genomic segment S11. Nucleic Acids Research 17, 3599. DAYHOFF, M. O., ECK, R. V. & PARK, C. M. (1972). A model of evolutionary change in proteins. In Atlas of Protein Sequence and Structure, vol. 5, pp. 89-99. Edited by M. O. Dayhoff. Washington, D.C. : National Biomedical Research Foundation. FUKUMOTO,F., OMURA,T. & MINOBE,Y. (1989). Nucleotide sequence of segment $9 of the rice dwarf virus genome. Archives of Virology 107, 135-139. KANO, H., KOIZUMI, M., NOOA, H., MIZUNO, H., TSUKIHARA,T., ISHIKAWA,K., HImNO, H. & OMURA,T. (1990). Nucleotide sequence of rice dwarf virus (RDV) genome segment $3 coding for 114K major core protein. Nucleic Acids Research 1g, 6700. KIMURA,I. t~ SHIKATA,E. (1968). Structural model of rice dwarf virus. Proceedings of the Japan Academy 44, 538-543. KOGANEZAWA,H., HImNo, H., MOTOYOSHI,F., KATO, H., NODA, H., ISHIKAWA,K. • OMURA,T. (1990). Nucleotide sequence of segment $9 of the genome of rice gall dwarf virus. Journal of General Virology 71, 1861-1863. LIU, H. Y. & BLACK, L. i . (1978). Neutralization of infectivity of potato yellow dwarf virus and wound tumor virus assayed on vectorcell monolayers. Phytopathology 68, 1243-1248. MATSUOKA, M., MINOBE, Y. & OMURA, T. (1986). Reaction of antiserum against SDS-dissociated rice dwarf virus and a polypeptide of rice gall dwarf virus. Phytopathology 75, 1125-1127. MIZUNO, H., OMURA,T., KOIZUMI, M., KANO, H., KONDOH, M. & TSUKIHARA, T. (1990). Crystallographic studies of double shelled spherical viruses, rice dwarf virus. Proceedings of the XVth International Congress and GeneralAssembly, International Union of Crystallography, Bordeaux, France, C-89. NAKASrlIMA,K., KAKUTANI,T. & MINOBE,Y. (1990). Sequence analysis and product assignment of segment 7 of the rice dwarf virus genome. Journal of General Virology 71, 725-729. Nuss, n. L. & DALL, D. J. (1990). Structural and functional properties of plant reovirus genomes. Advances in Virus Research 38, 249-306. OMURA, T. & INOUE, H. (1985). Rice gall dwarf virus. CMI/AAB Descriptions of Plant Viruses, no. 296. OMURA,T., MORINAKA,T., INOUE,H. & SAITO,Y. (1982). Purification and some properties of rice gall dwarf virus, a new Phytoreovirus. Phytopathology 72, 1246-1249. OMURA,T., MINOBE,Y., MATSUOKA,M., NOZU, Y., TSUCmZAKI,T. & SAI'rO, Y. (1985). Location of structural proteins in particles of rice gall dwarf virus. Journal of General Virology 66, 811-815. OMURA,T., MINOBE,Y. & TSUCHIZAKI,T. (1988). Nucleotide sequence of segment S10 of the rice dwarf virus genome. Journal of General Virology 69, 227-231. OMURA, T., ISHIKAWA,K., HIRANO, H., UGAKI, M., MINOBE, Y., TSUCHIZAKI,T. & KATO, T. (1989). The outer capsid protein of rice dwarf virus is encoded by genome segment $8. Journal of General Virology 70, 2759-2764. REDDY, D. V. R. & MACLEOD,R. (1976). Polypeptide components of wound tumor virus. Virology 70, 274-282. SaXmSSLE, G. & G~,ANADOS,R. R. (1968). The fine structure of wound tumor virus and reovirus. Archiv f~r die Gesamte Virusforschung 25, 369-372. SuzuKI, N., WATASABE,Y., KUSANO,T. & KIXA6AWA,Y. (1990a). Sequence analysis of rice dwarf phytoreovirus genome segments $4, $5 and $6: comparison with the equivalent wound tumor virus segments. Virology 179, 446-454. SUKUKI, N., WATANABE,Y., KUSANO,T. & KITAGAWA,Y. (1990b). Sequence analysis of the rice dwarf phytoreovirus segment $3 transcript encoding for a major structural core protein of 114 kDa. Virology 179, 455-459. UYEDA, I. & SHIKATA,E. (1982). Ultrastructure of rice dwarf virus. Annals of the Phytopathological Society of Japan 48, 295-300. UYEDA, I., MATSUMURA,T., SANO, T., OHSHIMA,K. & SHIKATA,T. (1987). Nucleotide sequence of rice dwarf virus genome segment I0. Proceedings of the Japan Academy 63, 227-230. UYEDA, 1., KUDO, H., TAKAHASHI,T., SANO, T., OmmMA, K., MATSUMURA,T. & SHIKATA,E. (1989). Nucleotide sequence of rice dwarf virus genome segment 9. Journal of General Virology70, 12971300. UYEDA, I., KUDO, H., YAMADA,N., MATSUMURA,T. & SHIKATA,E. (1990). Nucleotide sequence of rice dwarf virus genome segment 4. Journal of General Virology 71, 2217-2222. XU, Z., ANZOLA,J. V., NALIN, C. M. & NUSS, D. L. (1989a). The 3'terminal sequence of a wound tumor virus transcript can influence conformational and functional properties associated with the 5'terminus. Virology 170, 511-522. Xu, Z., ANZOLA,J. V. & NUSS, D. L. (1989b). Assignment of wound tumor virus nonstructural polypeptides to cognate dsRNA genome segments: in vitro expression of tailored full-length eDNA clones. Virology 168, 73-78. (Received 2 April 1991 ; Accepted 10 July 1991) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 06 May 2017 16:36:49