Download DNA Forensics

DNA Forensics
How DNA is used
Ethical Issues
By : Daniel DiCenzo
What is DNA?
•
•
•
•
•
DNA - Deoxyribonucleic acid
DNA is the blueprint for the design of our bodies
Consists of certain base pairs that form specific sequences
These sequences can code for specific amino acids
These amino acids combine
to form proteins
• The proteins together make
our entire body
• Everyone’s DNA is unique
• DNA holds all of the information
needed to make living things
What is DNA used to do?
• Code for amino acids in our bodies
• Act as a bar code that identifies who we are (DNA
Fingerprint)
• DNA can be analyzed and compared to other
DNA
• Comparing DNA can be used for many purposes
• To match and analyze people’s DNA, scientists
must perform special tests
What Are These Tests
• There are many ways to process DNA
• Polymerase Chain Reaction (PCR)
• Restriction Fragment Length Polymorphism
(RFLP)
• Short Tandem Repeat (STR)
• Mitochondrial DNA (mtDNA)
– DNA is taken from mitochondrion instead of nucleus
Polymerase Chain Reaction
• To put it simply PCR’s are used to amplify a certain piece
of DNA
• The initial piece of DNA is separated into two strands
• RNA primer is attached at specific spot on DNA
• DNA polymerase adds base pairs to both single stranded
DNA
• The product is two identical pieces of double stranded DNA
• This process is repeated many times to achieve a large
amount of DNA
• The amount of DNA produced after every cycle however
increases exponentially
• This process allows a large amount of DNA to be produced
from only a minute sample collected
http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/
Restriction Fragment Length Polymorphism
• DNA is cut at specific points into fragments
• These fragments are then put in a gel
• Via “gel electrophoresis” the DNA fragments
travel across the gel and stop at specific
distances
• DNA can be compared to other DNA run through
this same method
• This process however requires a large amount of
DNA sample
http://www.ars.usda.gov/pandp/docs.htm?docid=11828
Short Tandem Repeat
•
•
•
•
•
•
Example of a tandem repeat
TAAGCTAAGCTAAGCTAAGC
In this tandem repeat – TAAGC is repeated four times
Every person’s DNA contains these tandem reapeats
These are inherited from your mother and your father
These are used in identification because they are very
unique in individuals
• Scientists analyze 13 loci in our DNA, this prevents any
doubt that someone else shares these same genes
• If only 2 loci are analyzed the probability that someone else
shares those genes are much higher which is not effective
in identifying people using DNA
What are these fingerprints used for?
•
•
•
•
•
•
•
•
DNA fingerprinting has many uses
DNA fingerprinting has the ability to:
Prove someone is guilty/innocent of a crime
Instantly find the culprit if they are in a DNA
database
Identify unknown bodies (old or new)
Determine who the father of a baby is (Paternity
Test)
Find an organ match for a person
Catch poachers hunting and selling the meat of
endangered animals
Ethical Issues
• DNA identification Act (1998)
– Forces all those in Canada who have been convicted of a
certain crime to be entered into the National DNA
Databank (NDDB)
• This is also the case in the U.S.
– In 1998, all 50 states used their DNA databank, known as
the National DNA Index System (NDIS)
• Having to be forced to provide DNA is a violation of human
rights, even if you are a criminal
• Many believe in the future, everyone’s DNA will be on file
• All of our most valuable secrets are exposed
• Many believe this is an invasion of privacy
• Our DNA can predict how we will die, do we want that
information?
Genetic Discrimination
• DNA holds secret to almost every weakness you
have
• By allowing Insurance companies, employers,
schools or banks access to any illness or flaw that
you will, may or already have, you can be denied
instantly
• Government can learn anything about you without
your consent
• Those with “Good” DNA will be given better
opportunities and success than those with “Bad”
DNA
• This will lead to a new discrimination, not by race
or religion, but by your DNA
Is DNA fingerprinting Reliable?
• People have come to believe that DNA evidence is
indisputable in courtrooms (Too much faith in DNA)
• Human error is always a factor
– Contamination of evidence
– Labs are too pressured by police to give them the
evidence they want to close the case
• With more strict regulations on the quality of labs and
technological advances, human error will be greatly
reduced
• Planting of evidence is a new problem
– This always leaves doubt into the reliability of DNA
evidence
• Must look for probable cause in a case and not rely solely
on DNA evidence
DNA Databanks
• There are approximately 200 000 people in the
Canadian National DNA Databank
• To this date there have been 10 000 offender hits
because of this system
• In the U.S., 6.5 million people have been entered
into their national DNA databank
• This databank is the largest in the world and has
participated in over 77 000 investigations
Taken from NDDB statistics page
http://www.nddb-bndg.org/stats_e.htm
Taken from NDDB annual report for 2006/2007
http://www.nddb-bndg.org/an_report_e.htm
Conclusion
• DNA holds all of the secrets of our bodies
• There are many ways that DNA can be used to
identify and learn about other people
• It is an effective tool in crime solving
• The use of DNA databanks has caused major
concern over the civil rights of convicted felons
and possibly in the future, the civil rights of
everyone
• If people’s DNA is exposed, there is concern for
our privacy being violated
Bibliography
•
•
•
•
•
•
•
•
•
Federal Bureau of Investigation. (2008). CODIS – NDIS Statistics. Retrieved
December 9, 2008, from: http://www.fbi.gov/hq/lab/codis/clickmap.htm
Fink, Sheri. (2006, July). Reasonable Doubt. Discover, 27(7), 54-59. Retrieved
from EBSCO host database.
Fridell, Ron. (2001). DNA Fingerprinting The Ultimate Identity. Toronto: Franklin
Watts.
Genge, N.E. (2002). The Forensic Casebook. New York: Ballantine Publishing
Group.
Human Genome Project Information. (2008). DNA Forensics. Retrieved November
10, 2008, from:
http://www.ornl.gov/sci/techresources/Human_Genome/elsi/forensics.shtml#1
Lampton, Christopher. (1991). DNA Fingerprinting. Boston: Christopher Lampton.
Learn Genetics. (2008). Can DNA demand a verdict?. Retrieved December 1,
2008, from: http://learn.genetics.utah.edu/content/labs/gel/forensics/
National DNA Databank. (2006). Welcome to the National DNA Databank Website.
Retrieved November 20, 2008, from: http://www.nddb-bndg.org/main_e.htm
Zonderman, Jon. (1990). Beyond the Crime Lab. Toronto: John Wiley and Sons.