Download Molecular cloning of a rhodopsin gene from salamander rods.

Molecular Cloning of a Rhodopsin Gene From
Salamander Rods
Ning Chen, Jian-xing Ma,% D. Wesley Corson, E. Starr Hazard, and Rosalie K. Crouch
Purpose. Salamander photoreceptor cells have been used widely as models in vision research.
However, the salamander opsin genes had not been cloned. The purpose of this study was
to clone a salamander rhodopsin and to determine its primary structure and cell type-specific
expression.
Methods. Using salamander retina RNA as a template and Xenopus rhodopsin-specific oligonucleotides as primers, reverse transcription and polymerase chain reaction (RT—PCR) were
used to amplify and clone a rhodopsin cDNA fragment. This fragment was used as a probe
to isolate a full-length cDNA of the rhodopsin from a cDNA library of salamander retina.
The dideoxynucleotide chain termination method was used to determine the nucleotide
sequence. Single rod and cone cells were isolated by micromanipulation, and the absorbance
spectra of the rod outer segments were measured with a photon-counting microspectrophotometer. Individual rod and cone cells were lysed for RT-PCR and Southern blot analysis to
detect cell-specific expression of this gene.
Results. A 1.2 kb rhodopsin cDNA containing the full-length coding region of rhodopsin has
been cloned and sequenced from the larval tiger salamander, Ambystoma tigrinum. This cDNA
encodes 354 amino acids that, by hydropathy profile, could form seven transmembrane domains characteristic of other rhodopsins. Sequence identity was found with other amphibian
rhodopsins at the nucleic acid (82% to 83%) and the amino acid (88% to 89%) levels. Key
amino acids critical for structure and function of rhodopsin have been retained. The mRNA
of this rhodopsin was identified in red rod cells (\.m:ix 506 nm). No expression of the gene
was detected in cone cells.
Conclusions. The cloned rhodopsin is a newly isolated member of the G protein-coupled
receptor superfamily. This protein is expressed in rods but not in cones. Invest Ophthalmol
VisSci. 1996;37:1907-1913.
.Amphibian photoreceptor cells are used extensively
as models for vision research in biochemical and electrophysiological studies. Some of the first observations
of visual pigments were made using frog retinas,1 2
and the first two-dimensional rhodopsin crystal was
obtained from frog rod disks.H Salamander photoreceptors provide a number of advantages for physiolog-
From the Department of Ophthalmology, Storm Eye Institute, Medical University of
South Carolina, Charleston.
Presented in part at the annual meeting of the Association for Research in Vision
and Ophthalmology, Fort Uiuderdale, Florida, May 1995.
Supported in part Iry National Institutes of Health grants EY04939 (HKC) and
EY07543 (DWC), a Medical University of South Carolina intramural grant (JXM),
and an unrestricted departmental grant from Research to Prevent Blindness, Inc.
Submitted for publication December 21, 1995; revised March 21, 1996; accepted
April 26, 1996.
Proprietary interest category: N.
Refmnt reqtiesls: Jian-xing Ma, Department of Ophthalmology, Medical University
of South Carolina, 171 Ashley Avenue, Charleston, SC 29425.
ical studies because they are large, easy to isolate, give
good responses to light for at least 48 hours,'1 and can
be maintained alive in cell culture for several weeks.5
Like other amphibians, salamanders have two types of
rods, abundant "red" rods and sparsely distributed
"green" rods, which have distinct spectral absorbance
peaks for a given chromophore.6 Each rod type can
have a mixture of two chromophores, 11-osretinaldehyde (rhodopsin) or W-cis 3-dehydroretinaldehyde
(porphyropsin). The porphyropsin form yields pigments with absorbance maxima near 523 and 433 nm
in the red and green rods, respectively.'' Because red
rods from larval tiger salamanders contain some rhodopsin with a \MKIX near 502 nm, the absorbance maximum of a given red rod can vary from 502 to 523 nm,
depending on the ratio of pigment types.
To date, no genes responsible for visual transduc-
Investigative Ophthalmology & Visual Science, August 1996, Vol. 37, No. 9
Copyright © Association for Research in Vision and Ophthalmology
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
1907
1908
Investigative Ophthalmology & Visual Science, August 1996, Vol. 37, No. 9
tion in the tiger salamander have been described. To
elucidate the structural basis for the distinct absorbance peaks of the two rod types, we have isolated
a putative rhodopsin cDNA from the salamander retina.
MATERIALS AND METHODS
Animals and Tissues
Care, use, and treatment of animals in this study complied strictly with the ARVO Statement for the Use of
the Animals in Ophthalmic and Vision Research and
with the Guidelines for the Care and Use of Laboratory Animals of the Medical University of South Carolina. Tissues and cells used in the experiments were
from larval tiger salamanders {Ambystoma tigrinum,
aquatic phase) obtained from Charles D. Sullivan
Company (Nashville, TN) and were maintained on a
12-hour light-12-hour dark cycle at 8°C to 10°C.
Isolation of Total RNA From the Retina
Retinas were removed from 6 to 10 freshly dissected
salamander eyes. Total RNA was extracted from the
retinas using the guanidinium isothiocyanate-CsCl
gradient centrifugation method described by Sambrook et al.8
Reverse Transcription -Polymerase Chain
Reaction and Polymerase Chain Reaction
To obtain a probe for library screening, we performed
reverse transcription-polymerase chain reaction
(RT-PCR). Moderately degenerate PCR primers were
designed based on the conserved regions of three amphibian rhodopsin cDNAs (Xenopus laevis, Xenopus
laevis tadpole, and Rana pipiens rhodopsins). The
primers were synthesized by a DNA synthesizer at the
Medical University of South Carolina. Moloney murine leukemia virus (M-MLV) reverse transcriptase
and reaction buffer were obtained from Gibco/BRL
Life Technologies (Gaithersburg, MD). Polymerase
chain reaction reagents, including dNTPs (2-deoxynucleoside 5-triphosphates), PCR reaction buffer,
MgCl2 solution, and AmpliTaq DNA polymerase, were
purchased from Perkin Elmer Cetus (Foster City, CA).
The RT mixture was composed of 1 fig of RNA, 1 /xl
of 2.5 mM dNTP, 2 //I of 5X reverse transcription
buffer (250 mM Tris-HCl, pH 8.3, 375 mM KC1, 15
mM MgCl2), 1 fi\ of 0.1 M dithiothreitol, 10 pmol of
3' primer [AAGAAAGCC(T)GGGAT(C)GGTCATGAAG] (corresponding to 858-881 in Fig. 1), and 1
(il of M-MLV reverse transcriptase in a total volume
of 10 [A. Reverse transcription was carried out at 37°C
for 60 minutes, followed by heating at 55°C for 10
minutes to inactivate the reverse transcriptase. The
PCR mixture was composed of 5 fA of the RT reaction
mixture, 50 pmol of each primer (3' primer is the
same as that in RT reaction; 5' primer: TGGCTGCCTACATGTTCCTGC) (118-139 in Fig. 1), 5 fi\ of 2.5
mM dNTP, 5 //I of 10X PCR buffer (100 mM TrisHCl, pH 8.3, 500 mM KC1, 15 mM MgCl2, 0.1% gelatin) , and 2.5 U of AmpliTaq DNA polymerase in a
total volume of 50 fi\. Polymerase chain reaction was
carried out for 30 cycles at 94°C for 1 minute, 50°C
for 2 minutes, and 72°C for 3 minutes in a DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, CT). The
RT-PCR product was purified by passage through a
Select-D G-50 Sephadex (Boulder, CO) spin column
(5 prime —* 3 prime). One tenth of the product purified from the first PCR was used as the template for
the second PCR. In the second PCR, both primers (3'
primer: CCTGGTGGGTGAAGATGTAGAATG [815835 in Fig. 1]; 5' primer: TAC(T)A(G)TG(T)GT
GGTC(G)T GCAAGCCCATG [405-429 in Fig. 1])
were nested to ensure the specific amplification.
Southern Blot Analysis and Colony
Hybridization
The RT-PCR products were subjected to Southern
blot analysis as described by Ausubel et al.9 They were
resolved by agarose gel electrophoresis and transferred onto a Duralon-UV nylon membrane (Stratagene, La Jolla, CA) by capillary action and immobilized by UV-cross-linking. The membrane was probed
with a bovine rhodopsin cDNA (a generous gift of
Dr. D. Oprian at Brandeis University, Waltham, MA)
labeled with 32P a-dCTP by nick-translation method
using a kit supplied by Gibco/BRL. The identified
PCR products were purified by agarose gel electrophoresis and cloned into a pCR II (TA cloning kit; Invitrogen, San Diego, GA) or pUC19 vector introduced
into Escherichia coli strain ToplO cells. Positive colonies
were identified by colony hybridization using the
cDNA probe o n S & S NC nitrocellulose membranes
(Schleicher & Schuell, Keene, NH) according to the
protocol provided by the supplier. The hybridization
was carried out in a solution containing 5 X SSPE (1
X SSPE = 0.18 M NaCl, 10 mM NaH 2 PO 4 , 1 mM Na2
ethylenediaminetetraacetic acid, pH 7.4), 5 X Denhardt's solution (1 X Denhardt's solution = 0.1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.5% sodium dodecyl sulfate, and 100
/^g/ml of Herring sperm DNA at 55°C overnight. The
membranes were washed twice in a final solution of 6
X SSPE and 0.1% sodium dodecyl sulfate at 55°C and
were exposed to Kodak X-Omat film (Eastman Kodak,
Rochester, NY).
Screening of the cDNA Library of Salamander
Retina
A salamander retinal cDNA library was generously provided by Dr. J. L. Arriza in the Vollum Institute of Ore-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
Cloning of a Salamander Rhodopsin
1909
-9
72
24
1
MetAsnGlyThrGluGlyProAsnPheTyrValProPheSerAsnLysSerGlyValValArgSerProPhe
73
25
GAATACCCCCAGTACTATCTGGCGGAGCCATGGCAGTACTCCGTACTAGCGGCCTACATGTTCTTGCTGATCCTGCTGGG
GluTyrProGlnTyrTyrLeuAlaGluProTrpGlnTyrSerValLeuAlaAlaTyrMetPheLeuLeuIleLeuLeuGl
TM I (37-61)
152
51
153
51
TTTCCCCGTCAACTTCCTGACCCTGTATGTCACGATCCAGCACAAGAAACTCCGAACCCCCCTCAACTATATCCTTCTGA
yPheProValAsnPheLeuThrLeuTyrValThrlleGlnHisLysLysLeuArqThrProLeuAsnTyrlleLeuLeuA
232
78
78
snLeuAlaPheAlaAsnHisPheMetValPheGlyGlyPheProValThrMetTyrSerSerMetHisGlyTyrPheVal
TM II (77-99)
104
105
PheGlyGlnThrGlyCysTyrlleGluGlyPhePheAlaThrMetGlyGlyGluIleAlaLeuTrpSerLeuValValLe
TM III (111-133)
131
131
uAlalleGluArgTyrValValValCysLysProHetSerAsnPheArgPheGlyGluAsnHisAlalleMetGlyValM
158
158
etHetThrTrpIleMetAlaLeuAlaCysAlaAlaProProLeuPheGlyTrpSerArgTyrlleProGluGlyMetGln
TM IV (153-176)
184
185
CysSerCysGlyValAspTyrTyrThrLeuLysProGluValAsnAsnGluSerPheVallleTyrMetPheLeuValHi
211
211
sPheThrlleProLeuMetllellePhePheCysTyrGlyArqLeuValCysThrValLysGluAlaAlaAlaGlnGlnG
TM V (203-270)
238
238
lnGluSerAlaThrThrGlnLysAlaGluLysGluValThrArgMetValllelleMetValValAlaPheLeuIleCys
264
265
TrpValProTyrAlaSerValAlaPheTyrllePheSerAsnGlnGlyThrAspPheGlyProIlePheMetThrValPr
TM VI (249-276)
291
291
QAlaPhePheAlaLysSerSerAlalleTyrAsnProVallleTyrlleValLeuAsnLysGlnPheArgAsnCysMetl
TM VII (285-309)
318
318
leThrThrlleCysCysGlyLysAsnProPheGlyAspAspGluThrThrSerAlaALaThrSerLysThrGluAlaSer
344
1033
345
SerValSerSerSerGlnValSerProAla*
1112
354
1113
TATGACTCCCACCCAGACCCG
1133
FIGURE l. Nucleotide sequence and deduced amino acid sequence of the salamander rhodopsin cDNA. {upper line) Nucleotide sequence, {lower line) Deduced amino acid sequence.
Nucleotide and amino acid numbering begins at the translational start codon. The stop
codon is indicated by asterisks. Putative transmembrane regions (TM I-VII) are underscored.
Putative glycosylation sites are indicated by filled triangles. GenBank accession No. for this
cDNA is U36574.
gon Health Science University (Portland, OR). This
cDNA library was constructed in the \ ZAP II phage
vector (Stratagene). Screening of the library was carried
out according to the standard plaque-lifting protocol.10
Plaques of \ ZAP II phage were transferred to S & S NC
(Schleicher & Schuell) nitrocellulose membranes. The
rhodopsin cDNA fragment cloned by RT-PCR was labeled by nick-translation and used as a probe for library
screening. The resultant positive phage clones were
plaque-purified by secondary and tertiary screening.
These clones were converted to pBluescript II SK(—) by
the in vivo excision in the presence of the ExAssist helper
phage (Stratagene).
(QIAGEN, Chatsworth, GA). Inserts were sequenced
on both strands by Sanger's dideoxynucleotide chain
termination method" using Sequenase Version 2.0
DNA Sequencing Kit (United States Biochemical,
Cleveland, OH) or dsDNA Cycling Sequencing System
(Gibco/BRL). DNA sequence acquisition and analysis
were conducted by BLAST network service at the National Center for Biotechnology Information, GeneWorks software (version 2.4; IntelliGenetics, Mountain
View, CA), or Wisconsin Genetic Computer Group
(version 8.1) UNIX system software packages available
from the Biomolecular Computing Network Resource
at the Medical University of South Carolina.
DNA Sequence Analysis
Double-stranded DNA was isolated from the positive
clones by Wizard Minipreps (Promega, Madison, WI)
or QIAGEN Plasmid Midi DNA Purification System
Single-Cell Isolation and Single-Cell Polymerase
Chain Reaction
Single rod and cone cells were identified based on their
morphology and were isolated from the triturated retina
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
Investigative Ophthalmology & Visual Science, August 1996, Vol. 37, No. 9
1910
NH
FIGURE 2. Putative secondary structure of salamander rhodopsin. The transmembrane helices
were defined according to Kyte-Doolitde hydropathy plots and comparison with the structure of rhodopsins from other species. Putative transmembrane domains are boxed, and
conserved key residues are shaded. The shadded box in the carboxyl terminal region indicates the extra residues that do not exist in mammalian opsin.
preparation of dark-adapted larval tiger salamanders under infrared illumination. The inner segment of a rod was
drawn into a suction micropipette, and the absorbance
spectrum of each rod cell was measured through the
exposed outer segment with a dual beam photon-counting microspectrophotometer.li! Each cell was then transferred to a microcentrifuge tube containing 10 /xl of Ringer's solution (108 mM NaCl; 2.4 mM KC1; 1.6 mM CaCl2;
1.2 mM MgCl2; 1.0 mM NaH2PO4; 0.5 mM NaHCO,; 5
mM glucose; and 10 mM Hepes buffer, pH 7.8). Each
cell was sedimented by a brief centrifugation, and the
Ringer's solution was removed carefully. The isolated single cells either were used directly for RT-PCR or were
frozen immediately at — 70°C. The single cells were lysed
with the GeneReleaser reagents (Bio Ventures, Murfreesboro, TN) according to the manufacturer's instructions
to release their RNA. The single cell lysates were then
subjected to RT-PCR amplification and Southern blot
analysis as described above, except that a nested oligonucleotide (GAAGGCTGAGAAAGAGGTCACC, corresponding to 732-753 in Fig. 1) was used as the probe
and the hybridization was under a stringent condition
(65°C) to ensure the specific hybridization.
RESULTS
Cloning and Sequence Analysis of the
Salamander Rhodopsin cDNA
A 430 bp fragment of rhodopsin cDNA was amplified
and cloned from salamander retina by RT-PCR. This
fragment was used as a probe for cDNA library screening,
which isolated six independent phage clones. One of
these clones was sequenced completely and was found to
contain a ~1.2 kb insert, including a full-length coding
region of 1065 bp, a translation start codon ATG, a termination codon TAA, 87 bp of 5' noncoding sequence, and
68 bp of 3' noncoding sequence (Fig. 1). The sequence
of the coding region was confirmed by sequencing five
more independent clones. The sequence has a high degree of similarity to many vertebrate rhodopsins but does
not match with any of the existing genes or cDNAs in
the GenBank, indicating that it is previously unreported
rhodopsin cDNA.
Deduced Amino Acid Sequence and Secondary
Structure
This cDNA encodes 354 amino acids. Based on hydropathy analysis, this sequence could form seven
transmembrane domains. The putative transmembrane domains (TM I-VII) assignments were based on
similarity comparison with other vertebrate rhodopsins (Fig. 1) and results of the hydropathy profiles.13 M
The deduced secondary structure of this rhodopsin is
shown in Figure 2. The molecular weight calculated
from the derived amino acid sequence is 39,762 Da,
and the pi is 7.
Comparison With Rhodopsins of Other Species
Sequence analysis shows that this salamander rhodopsin cDNA shares a high degree of sequence similarity
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
Cloning of a Salamander Rhodopsin
1911
A.
B.
Wavelength (run I
C.
'**
i
2
3
4
5
6
7
8
D
1 2
3
4
5
6
7
FIGURE 3. Absorbance spectrum, reverse transcription-polymerase chain reaction (RTPCR), and Southern blot analyses of single rod cells. (A) Isolation of single rods. A single
rod cell was isolated using a micropipette, and the absorbance spectrum of the exposed
outer segment was measured with a probe beam relative to a reference beam (left). (B)
Average absorbance spectrum of single red rods. The plot represents an average spectrum
of four red rods. The \1IlIlx is near 506 nm. (C) RT-PCR using single rods and cones as
templates. RT-PCR generated a dominant band under UV-light from four isolated rods
(lanes J to 4) but not from four cones (lanes 5 to 8) under the same conditions. (D) Southern
blot analysis of RT-PCR products. The RT-PCR products from single rods and cones were
probed with a nested oligonucleotide primer of salamander rhodopsin cDNA. All the RTPCR products from rods were hybridized with the probe.
with the rhodopsin cDNAs of a number of mammalian, avian, and amphibian species. At the nucleic acid
level, this rhodopsin has 79% to 82% sequence identity with rhodopsins of human, bovine, canine, and
chicken, and at the amino acid level, it has 85% to 86%
identity. The highest sequence similarity was found
between salamander and other amphibian rhodopsins, such as Xenopus and frog (83% at the nucleotide
level and 88% at the amino acid level).
The regions conserved among other rhodopsins
are also largely present in this protein:
1. The Lys-296 residue (shaded in Fig. 2) is the site
for the SchifFs base linkage with the chromophore. l5lJti
2. In the third transmembrane region, Glu-113
(shaded in Fig. 2) serves as a counterion forming
a salt bridge with Lys-296.17-19
3. All 10 cysteine residues in the human and bovine
rhodopsins are conserved in salamander, although amphibian rhodopsins have one (Cys-89,
Xenopus laevis, Cys-228, tiger salamander) or two
(Cys-82 and Cys-89, Rana pipiens) additional cysteines.
4. The sequence of the second cytoplasmic loop
region (Glu-134 to His-152) of this salamander
rhodopsin closely resembles those of mamma-
lian rhodopsins. Near the border of the third
transmembrane domain in this region, the ERY
(Glu-134, Arg-135, Tyr-136) motif (shaded in
Fig. 2), thought to be critical for G-protein
(transducin) activation, also is retained.20"123
5. Three positively charged histidine residues (His65, His-152, and His-211) (shaded in Fig. 2),
thought to be critical in regulation of the transition from metarhodopsin I to metarhodopsin II,
are conserved.20"*4
6. The carboxyl terminal region of this protein is
extremely rich in serines (eight residues) and
threonines (four residues). These residues are
the potential sites of phosphorylation by rhodopsin kinase and are required for inactivation of
photoactivated rhodopsin and for binding of a
regulatory protein, arresting 5 - J7
7. This pigment also has a high proportion of proline and glycine residues in its alpha helices. The
invariant proline and glycine residues noted by
Dratz and Hargrave 28 in five helices (III, Gly-121;
IV, Pro-171, V, Pro-215; VI, Pro-267; VII, Pro/
Gly-291 and Pro-303) also are found in the salamander.
Taken together, these observations indicate
a high level of structural and functional similar-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
1912
Investigative Ophthalmology & Visual Science, August 1996, Vol. 37, No. 9
ity between this derived protein and other vertebrate rhodopsins.
Rod Cell-Specific Expression
To study the cell-specific expression of this rhodopsin
gene, we isolated 20 single rods and 20 cones from
the tiger salamander (Fig. 3A). The rods all showed
the typical absorbance spectrum of red rods with a
\in:ix near 506 nm (Fig. 3B). The absorbance peak is
within the range of absorbance reported by Harosib
for red rods that contain a mixture of rhodopsin and
porphyropsin, and it is more than 70 nm from the
spectral absorbance maximum of green rods. These
cells were lysed as templates for RT-PCR, which amplified a 430-bp fragment (nucleotides 405-835) from
every analyzed rod cell. This fragment amplification
was not observed in any of the 20 cone cells examined
(Fig. 3C). These PCR products were hybridized with
a nested oligonucleotide probe that demonstrates its
specificity (Fig. 3D). The results strongly suggest that
this rhodopsin is expressed in red rods but not cones.
DISCUSSION
Amphibians are used widely as models for studying
visual transduction because of the large size of their
photoreceptors and their convenience for electrophysiological preparations. It has been reported that
there are two morphologic types of rod cells with distinct absorbance spectra in salamander, frog, and tadpole retina, i.e., red rods and green rods.6"29'30 These
two types of rods display different absorbance peaks
for a given chromophore. With ll-as-3-dehydroretinaldehyde as the chromophore, red rods of the salamander display a \m;ix of approximately 523 nm,
whereas the green rod shows a \max of 433 nm.<)10
These results indicate that there may be two distinct
opsins responsible for the two peaks. To elucidate the
molecular basis for the two absorbance peaks and to
understand the structure and function of these two
opsins, it is necessary to isolate their genes and determine the primary structures of the two proteins. In
the current work, we have cloned a rhodopsin cDNA
and determined its primary structure. This rhodopsin
cDNA encodes 354 amino acids, forming seven transmembrane domains, and shares a high degree of sequence similarity with rhodopsins of other species,
although it has six more amino acids in its carboxylterminal region. Nickells et al31 reported recently that
34 amino acids are highly conserved among all the
opsin sequences examined from distantly related species. All these conserved residues are retained as well
in the salamander rhodopsin reported here. These
results suggest that this salamander rhodopsin is similar to those of other species in structure and function
and, therefore, is a suitable biochemical model for
vision research.
In the salamander retina, the red rods are the
most prevalent rod cell type, and they represent more
than 60% of the total population of rods and cones/1
Electron microscopy and rod-specific anti-opsin antibody studies suggest that the green rods comprise approximately 1 % or less of the total population of photoreceptors.32'33 We have attempted to isolate green
rods based on their morphologic features and absorbance spectra. After isolation and analysis of more
than 100 rods, only one rod with an absorbance of
a \m:ix less than 450 nm was found. Our results are,
therefore, in agreement with the estimates of green
rod prevalence at approximately 1 % the total population of photoreceptors.32'33 It is probable that the opsin that has been cloned is responsible for the absorbance of red rods at >500 nm, but, until the protein is expressed and the absorption spectrum is
measured, this cannot be confirmed.
In conclusion, spectrophotometric and single-cell
RT-PCR results demonstrate that the cloned rhodopsin gene is expressed in all rods with a X.11KIX near 506
nm, but is not present in the cones analyzed. These
results suggest that this rhodopsin gene is rod specific
and may be responsible for the absorbance peak of
the red rods. It is unknown whether this rhodopsin
gene is only expressed in the red rods or is expressed
in both green and red rods.
Key Words
Ambystoma, cloning, cDNA, reverse transcription-polymerase chain reaction (RT-PCR), rhodopsin
Acknowledgments
The authors thank Dr. J. L. Arriza for the generous gift of
salamander retinal cDNA library and Dr. Daniel D. Oprian
for kindly providing synthetic bovine rhodopsin cDNA.
References
1. Miiller H. Zur histologie der retina. Z Wiss Zool.
1851; 3:234-237. In German.
2. Boll F. Zur anatomie und physiologie der retina. Arch
Anat Physiol (Physiol Abt). 1877;4-36. [An English
translation appears in Vision Res. 1977; 17:1253-1264].
3. Corless JM, McCaslin DR, Scott BL. Two-dimensional
rhodopsin crystals from disk membranes of frog retinal rod outer segments. Proc Nail Acad Sci USA.
1982; 79:1116-1120.
4. Bader CR, MacLeish PR, Schwartz EA. Responses to
light of solitary rod photoreceptors isolated from tiger
salamander retina. Proc Natl Acad Sci USA. 1978;
75:3507-3511.
5. MacLeish PR, Townes-Anderson E. Growth and synapse formation among major classes of adult salamander retinal neurons in vitro. Neuron. 1988; 1:751—760.
6. Harosi F. Absorption spectra and linear dichroism of
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017
Cloning of a Salamander Rhodopsin
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
some amphibian photoreceptors. J Gen Physiol. 1975;
66:357-382.
Chen N, Ma J-x, Menick DR, Corson DW, Crouch
RK. Molecular cloning of a rhodopsin gene from the
salamander retina. ARVO Abstracts. Invest Ophthalmol
Vis Sri. 1995;36:S889.
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning:
A laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory; 1989.
Ausubel FM, Brent R, Kingston RE, et al. Current Protocols in Molecular Biology. Vols. 1, 2. New York: John
Wiley; 1987.
Harosi FI. An analysis of two spectral properties of
vertebrate visual pigments. Vision Res. 1994; 34:13591367.
Sanger F, Nicklen S, Coulson AR. DNA sequencing
with chain-terminating inhibitors. Proc Natl Acad Sri
USA. 1977; 74:5463-5467.
Corson DW, Cornwall MC, MacNichol EF, et al. Relief
of opsin desensitization and prolonged excitation of
rod photoreceptors by 9-desmethylretinal. Proc Natl
Acad Sri USA. 1994;91:6958-6962.
Engelman DM, Steitz TA, Goldman A. Identifying
nonpolar transbilayer helices in amino acid sequences
of membrane proteins. Ann Rev Biophys Bioj)hys Chem.
1986;15:321-353.
Kyte J, Doolittle RF. A simple method for displaying
the hydropathic character of a protein. / Mol Biol.
1982; 157:105-132.
Bownds D. Site of attachment of retinal in rhodopsin.
Nature. 1967;216:1178-1181.
WangJK, McDowell JH, Hargrave PA. Site of attachment of 11-cis-retinal in bovine rhodopsin. Biochemistry. 198O;19:5111-5117.
Zhukovsky EA, Oprian DD. Effect of carboxylic acid
side chains on the absorption maximum of visual pigments. Srience. 1989; 246:928-930.
Sakmar TP, Franke RR, Khorana HG. Glutamic acid113 serves as the retinylidene Schiff base counterion
in bovine rhodopsin. Proc Natl Acad Sri USA.
1989;86:8309-8313.
Sakmar TP, Franke RR, Khorana HG. The role of the
retinylidene Schiff base counterion in rhodopsin in
determining wavelength absorbance and Schiff base
pKa. Proc Natl Acad Sri USA. 1991;88:3079-3083.
Weitz CJ, Nathans J. Rhodopsin activation: Effects on
1913
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
the metarhodopsin I-metarhodopsin II equilibrium of
neutralization or introduction of charged amino acids
within putative transmembrane segments. Biochemistry.
1993;32:14176-14182.
FindlayJB, Donnelly D, Bhogal N, Hurrell C, Attwood
TK. Structure of G-protein-linked receptors. Biochem
Soc Trans. 1993;21:869-873.
Baldwin JM. The probable arrangement of the helices
in G protein-coupled receptors. EMBO J. 1993; 12:
1693-1703.
Probst WC, Snyder LA, Schuster DI, Brosius J, Sealfon
SC. Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol. 1992; 11:1-20.
Weitz CJ, Nathans J. Histidine residues regulate the
transition of photoexcited rhodopsin to its active conformation, metarhodopsin II. Neuron. 1992; 8:465472.
Ohguro H, Palczewski K, Ericsson LH, Walsh KA,
Johnson RS. Sequential phosphorylation of rhodopsin
at multiple sites. Biochemistry. 1993;32:5718-5724.
McDowell JH, Nawrocki JP, Hargrave PA. Phosphorylation sites in bovine rhodopsin. Biochemistry. 1993;
32:4968-4974.
Papac DI, Oatis JE Jr, Crouch RK, Knapp DR. Mass
spectrometric identification of phosphorylation sites
in bleached bovine rhodopsin. Biochemistry. 1993;32:
5930-5934.
Ohguro H, Johnson RS, Ericsson LH, Walsh KA, Palczewski K. Control of rhodopsin multiple phosphorylation. Biochemistry. 1994;33:1023-1028.
Dartnall HJ. The visual pigment of the green rods.
Vision Res. 1967; 7:1-16.
Liebman PA, Entine G. Visual pigments of frog and
tadpole (Rana pipiens). Vision Res. 1968;8:761-775.
Nickells RW, Burgoyne CF, Quigley HA, Zack DJ.
Cloning and characterization of rod opsin cDNA from
the old world monkey, Macaca fasricularis. Invest Ophthalmol Vis Sri. 1995;36:72-82.
Attwell D, Wilson M. Behaviour of the rod network in
the tiger salamander retina mediated by membrane
properties of individual rods. /Physiol. 1980; 309:287315.
Mandell JW, MacLeish PR, Townes-Anderson E. Process outgrowth and synaptic varicosity formation by
adult photoreceptors in vitro. / Neurosri. 1993;
13:3533-3548.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933194/ on 05/04/2017