* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download T-cell Acute Lymphoblastic Leukemia-The
Silencer (genetics) wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Biochemical cascade wikipedia , lookup
Gene expression wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Paracrine signalling wikipedia , lookup
Western blot wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Signal transduction wikipedia , lookup
Expression vector wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Proteolysis wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
From www.bloodjournal.org by guest on August 11, 2017. For personal use only. T-cell Acute Lymphoblastic Leukemia-The Associated Gene SCL/ tal Codes for a 42-Kd Nuclear Phosphoprotein By Adam N. Goldfarb, Said Goueli, Dan Mickelson, and James M. Greenberg SCL/tal is a putative oncogene originally identified through its involvement in the translocation t(1;14)(p32;qll) present in the leukemic cell line DU.528. Subsequent studies have shown an upstream deletion activating expression of SCLI tal to be one of the most common genetic lesions in T-cell acute lymphoblastic leukemia (T-ALL). The cDNA sequence of SCL/tal encodes a basic helix-loop-helix (bHLH) protein with regions of marked homology to lyl-1 and tal-2, two other bHLH proteins involved in T-ALL chromosomal translocations. The bHLH motif suggests that the SCL/tal product localizes to the nucleus, binds to specific DNA sequences, and regulates transcription of a specific array of target genes. Our studies directly identify the SCL/tal product as a 42-Kd phosphoprotein that efficiently localizes to the nucleus. Deletion mutagenesis has allowed identification of a region critical for nuclear localization, a region that corresponds to the DNA-binding basic domain within the bHLH motif. Because this domain is shared by lyl-l and tal-2, these latter putative T-cell oncoproteins probably use a nuclear localization mechanism identical to that of SCL/tal. 0 1992 by The American Society of Hematology. A in which the derived amino acid sequence of SCL/tal includes a basic helix-loop-helix (bHLH) This motif places SCL/tal in a family of proteins, identified in organisms ranging from yeast to humans, which bind specific DNA sequences and regulate the transcriptional activity of target genes.l0 Other bHLH genes involved in leukemic translocations include C-mycl’ and E2A,I2J3contributing to an emerging pattern of translocation-associated proto-oncogenes containing transcription factor motifs.14 Of great interest in this regard is the identification of a subset of bHLH proteins, lyl-1, SCL/tal, and tal-2, all of which share marked homology ( > 85%) within the bHLH region and all of which have been associated with T-ALLspecific t r a n s l o ~ a t i o n s . ~ ~ J ~ In an effort to gain an understanding of the function of the SCL/tal gene in both normal and neoplastic development we have undertaken studies of the protein product encoded by this gene. As presented below, the nuclear localization of the SCL/tal protein supports its role as a transcriptional factor. This observation is reinforced by the experimental identification of a nuclear localization domain within the SCL/tal protein. In addition, evidence is presented that the SCL/tal protein undergoes phosphorylation and that some of this phosphorylation may occur before nuclear localization. NOVEL transcriptional unit 04 chromosome number 1,band p32 has recently been s p w n to be involved in the translocation, t(1;14)(p32;qll) found in rare cases of T-cell acute lymphoblastic leukemia (T-ALL) and stem cell 1e~kemia.l.~ Investigators at several laboratories, including the University of Minnesota, have independently cloned this translocational breakpoint and identified the associated transcriptional unit on chromosome lp32, which we have designated SCL/tal based on previously published nomenclature.’-“ Several different kinds of chromosomal breakpoints affecting the SCL/tal gene have been observed in cases of acute leukemia. In the multipotential leukemic cell line, DU.528, the t(1;14)(p32:qll) is associated with disruption of the 3’ untranslated sequences of exon VI.’ In one case report of T-ALL associated with t( 1;7)(p32:q35) the breakpoint occurs 35 kb downstream of the entire SCL/tal IOCUS.~ In approximately 2% to 3% of T-ALLs the t(1;14)(p32;qll) breakpoint disrupts or eliminates 5’ noncoding exons.h Finally, in 16% to 25% of cases of T-ALL, a submicroscopic interstitial deletion upstream of the SCL/ tal locus juxtaposes noncoding exons from a novel gene expressed in thymocytes, SIL, with coding exons from SCL/tal, aberrantly placing the SCL/tal gene under the control of a promoter active in T cell^.^-^ Our own sequencing efforts support the previous reports, MATERIALS AND METHODS From the University of Minnesota Hospital Department of Laboratory Medicine and Pathology, and Minneapolis VA Medical Center, Universityof Minnesota School of Medicine, Minneapolis. Submitted May 19, 1992; accepted July 31, 1992. Supported in part by grantsfrom the Minnesota Medical Foundation and the Vikings Children’s Fund of the University of Minnesota Department of Pediatrics. A.N.G. is a recipient of a Foundation Fellowship from the College of American Pathologists. J.M.G . is the recipient of a Clinical Investigator Award from the National Institutes of Health (CA-01254). Address reprint requests to Adam N. Goldfarb, MD, Department of Laboratory Medicine and Pathology, University of Minnesota Hospitals and Clinics, UMHC Box 198, 420 Delaware St SE, Minneapolis, MN 55455. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.section 1734 solely to indicate this fact. Q 1992 by The American Society of Hematology. 0006-49711921801I -0016$3.00/0 2858 Cell lines. DU.528 (provided by J. Kurtzberg, Duke University) derived from a human stem cell leukemia containing the translocation t(1;14)(p32;qll) as previously described” was maintained in RPMI 1640 with 10% fetal bovine serum (FBS) and 10% horse serum. cos-7 (provided by T. LeBien, University of Minnesota) was maintained in Dubecco’s Modified Eagle’s Medium (DMEM) with 10% FBS. Cloning of SCLItal. High molecular weight genomic DNA prepared from DU.528 was used to construct a cosmid library using the Lorist 6 vector. Approximately 200,000 independent clones were screened with a probe derived from the T-cell receptor D-6 1 locus on chromosome 14qll (provided by M. Minden, Ontario Cancer Institute). Clones containing the der14 breakpoint were identified and a repeat-free 8.4-kb EcoRI fragment spanning the breakpoint was used to screen a Jurkat cDNA library (Stratagene, La Jolla, CA). Complementary DNA clones of SCLltal were sequenced and used to screen a human placental genomic DNA A phage library (Stratagene). A 20-kb genomic DNA A phage clone, which contained all of the coding exons of SCLltal, was used to subclone BamHl fragments into pUC 19. B4.4 is a 4.4-kb genomic Blood, Vol80, No 11 (December 1). 1992: pp 2858-2866 From www.bloodjournal.org by guest on August 11, 2017. For personal use only. SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN DNA subclone that includes the bHLH and carboxy terminal coding sequences of SCL/tal. DNA sequencing. DNA sequencing was accomplished using single-stranded (M13) or double-stranded (alkali denatured) templates. DNA sequencing reactions used the Sanger dideoxy method with Sequenase T7 polymerase (US Biochemicals, Cleveland, OH). Sequence information was read using a digitizer linked to an Apple Macintosh SE/30 (Apple Computer Inc, Cupertino, CA) and analyzed with DNAStar software (DNASTAR, Inc, Madison, WI). Prokaryoticexpression of SCL /tal andpolyclonal antisemmproduction. DNA containing the coding sequences for the 131 carboxy terminal amino acids of SCL/tal was amplified by polymerase chain reaction (PCR)18 using the following primers: 5'mer of 5' GCTCTAGAGCCATGCAGCAGAATGTGAACGGGGCCTTT3'and a 3'mer of S'AAGGATCCAAAGTTCAAGTCCACCGCCTTGCT3'. The template consisted of the B4.4 genomic subclone. The 550-bp PCR product was digested with Xba 1 and BamH1, blunt ended with the Klenow fragment of DNA polymerase I and ligated into the Sma 1 site of pBluescript (Stratagene). The SCL/tal fragment was shuttled into the prokaryotic expression vector pGEX-2T (Pharmacia Fine Chemicals, Uppsala, Sweden) by digestion with BamHl and Xho 1, blunt ending of the fragment with Klenow and ligation into a unique Sma 1 site. The recombinant expression construct designated pGEXMB 1#7 includes sequences coding for the 26-Kd carboxy terminus of glutathione S-transferase (GST) under the control of an isopropylthio-pgalactoside (IPTG) inducible promoter.I9The construct was restriction mapped and sequenced to verify the correct orientation and reading frame. After IPTG induction, GST-SCL/tal fusion protein was purified from crude bacterial lysates by glutathione-sepharose affinity chromatography. SCL/tal peptide, released from its GST partner by thrombin digestion, was purified by repetition of the glutathione-sepharose affinity chromatography step. Preparations of the GST-SCL/tal fusion protein and the SCL/tal thrombinreleased peptide were judged as greater than 95% pure by Coomassie brilliant blue staining after sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). Primary immunization of New Zealand white rabbits consisted of 50 p,g of GST-SCL/tal or SCL/tal peptide emulsified in complete Freund's adjuvant followed by every other week immunizations of 25 pg protein emulsified in incomplete Freund's adjuvant. Preimmune serum was obtained from each rabbit before immunization. Three rabbits (A-1, -2, and -3) were immunized with the intact GST-SCL/ tal protein and two rabbits (A-4 and -5) were immunized with the 133 amino acid SCLital peptide obtained after thrombin digestion of GST-SCL/tal. Antisera were titered by enzyme-linked immunosorbant assay (ELISA) 8 to 10 weeks after primary immunization. Generation of constructs. pCWB, a construct encoding the carboxy terminal 150 amino acids of SCL/tal including the bHLH region, was prepared as follows: the appropriate DNA sequences were obtained by PCR-mediated amplification (using genomic subclone B4.4 as template) using a 5'mer containing an Xba I cloning site and an in-frame initiation codon within a favorable Kozak consensus sequence. The 5'mer sequence was 5'GCTCTAGAGCCATGGGTCCCCACACCAAAG'ITGTG3'.The 3'mer was identical to that used for preparation of the GST-SCL/tal fusion construct described above. The PCR product was cut with Xba I and BamHI, blunt ended, and cloned into the Sma I site of pBluescript (Stratagene). The correct orientation of the clone was confirmed by restriction mapping and DNA sequence analysis. The clone was digested with Hind111 and Xba I and ligated into the corresponding sites in the pCMV 5 eukaryotic expression vector (Dr D.W. Russell, University of Texas, Southwestern Medical Center, Dallas). pCMB, a construct encoding the 131 carboxy 2859 terminal amino acids of SCL/tal excluding the basic domain but including the HLH domain, was constructed in the same way as pCWB, except with a different 5'mer: S'GCTCTACAGCCATGCAGCAGAATGTGAACGGGGCCTTT 3'. pS-3, a construct encoding the full-length SCL/tal product was derived by excising a 1.2-kb HindIII-Xba I fragment from pBluescript 11-SCL (provided by Dr I.R. Kirsch, Bethesda Naval Hospital, Bethesda, MD) and ligating it into the corresponding sites of pCMV-5. pCIS consists of an Id-SCL fusion gene encoding amino acids 1 to 58 of Id2'' and amino acids 201 to 331 of SCL/tal cloned into pCMV-5. Further details regarding construction of the Id-SCL fusion gene will be published elsewhere.2l The inserts of all PCR-built constructs were sequenced in their entirety to rule out spontaneous mutations introduced by Taq polymerase into the open reading frames. Transfections and immunofluorescent staining. cos-7 cells on 100-mm plastic dishes or glass cover slips were grown to -80% confluency. Cells were repeatedly washed with phosphate-buffered saline (PBS) then incubated with 30 p,g Lipofectin (GIBCO BRL Life Technologies, Inc, Gaithersburg, MD) plus 7 pg plasmid in serum-free DMEM overnight at 37"C, 5% CO2. Cells were then allowed to recover 72 hours in DMEM with 10% fbs before harvesting or fixation. Cells grown on coverslips were fixed 5' in methanol at -20°C followed by 5' in acetone at -20°C. Coverslips were washed in PBS and then blocked with PBS/0.2% Tween 20/5% normal goat serum for 1hour at room temperature. Primary antibody, consisting of rabbit anti-GST-SCL/tal (exhaustively adsorbed with glutathione sepharose 4B loaded with bacterial lysates containing GST), was diluted 1/1,000 in PBS/0.2% Tween 20/5% normal goat serum and incubated on coverslips 40 minutes at room temperature. After repeated washes in PBS/0.2% Tween 20, coverslips were overlaid with secondary antibody, fluorescein isothiocyanate goat antirabbit, diluted 1/2,000 in PBS/0.2% Tween 20/5% normal goat serum, incubating 30 minutes at room temperature. Coverslips were then repeatedly washed first in PBS/0.2% Tween 20 and then in PBS alone. Immunoblotting. Cells grown to 90% confluency on 100-mm plastic dishes were washed once with PBS and then scraped in PBS/5 mmol/L EDTA. Pelleted cells were resuspended in 100 p L of NP-40 extraction buffer (0.5% NP-40, 50 mmol/L Tris HCl, pH 7.6, 100 mmol/L NaCI, 5 mmol/L MgC12, 5 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride (PMSF), 1 pg/mL pepstatin, 1 p,g/mL leupeptin, 0.1% aprotinin) and incubated on ice 10 minutes with gentle agitation. Debris was then removed by centrifugation at 13,000 rpm for 10 minutes at 4°C. Supernatants were fractionated by standard SDS-PAGE using 12% gels. Proteins were electroblotted onto nitrocellulose membranes. Membranes were blocked with 10% normal goat serum in TBS (20 mmol/L Tris HCI, pH 7.5, 500 mmol/L NaCI) with 5% nonfat dried milk for 2 hours at room temperature. Primary antibody (adsorbed rabbit anti-GST-SCL/tal) was diluted 1/350 in TTBS (TBS/0.2% Tween 20) with 1% nonfat dried milk and incubated on membranes for 2 hours at room temperature. After washing membranes repeatedly in 'ITBS, secondary antibody, alkaline phosphatase-conjugated goat anti-rabbit, was diluted 1/1,000 in TTBS with 1% nonfat dried milk and applied to membranes for 1 hour at room temperature. Membranes were developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/Nitro blue tetrazolium (NBT) as chromogenic substrate. Metabolic labeling and immunoprecipitation. At 60 hours posttransfection, Cos cells were washed extensively with serum-free deficient media (for 35s-methionine labeling, methionine-deficient RPMI 1640 [Sigma Chemical Co, St Louis, MO]; for 3ZP-phosphate labeling, phosphate-deficient DMEM, [Sigma]). Cells were then incubated for 2 hours at 3 7 T , 5% CO2 in labeling media (methionine-deficient RPMI 1640 with 0.5 mCi/mL Tran-35s Label [ICN - From www.bloodjournal.org by guest on August 11, 2017. For personal use only. GOLDFARB ET AL 2860 Pharmaceuticals Inc. Plainview, NY]: phosphate-deficient DMEM with 0.5 mCi/mL carrier-free 32P-orthophosphate [Amersham, Arlington Heights, IL]). Each labeling consisted of 0.5 x 10" cells in 5 mL labeling media. After metabolic labeling, cells were extensively washed with PBS and scraped in PBS/0.5 mmol/L EDTA. To the cell pellet was added 500 p L extract buffer: 0.5% NP-40, 50 mmol/LTris HCI, pH 7.8, 100 mmol/L NaCI, 5 mmol/L MgCI2, 5 mmol/L EDTA, 1 mmol/L PMSF, 0.1% aprotinin, 1 Fg/mLleupeptin, 1 Fg/mLpepstatin, 10 mmollLsodium pyrophosphate, 100 mmol/L sodium fluoride, 2 mmol/L sodium orthovanadate, 0.1 mmollL sodium metavanadate. Cells were incubated on ice with extract buffer for 20 minutes and nuclear debris was removed by centrifugation. Cellular extracts were precleared by the addition of 20 p L preimmune rabbit sera followed by 50 p L Pansorbin (Calbiochem Inc, San Diego. CA). Following preclearing, 20 FLof immune or control serum was added to extracts which were then incubated for 2 hours on ice. Immune complexes were collected on protein-A agarose (Calhiochem) and subjected to sequential washes with extract buffer. triple detergent radioimmunoprecipitation buffer (RIPA buffer) (containing 1% NP-40. 1% sodium deoxycholate, and 0.1% SDS), TBS (20 mmol/L Tris HCI, pH 7.5,500 mmol/L NaCI), and T E (10 mmol/LTris HCI, pH 7.5, 1 mmol/L EDTA). Immune complexes were then dissociated by boiling in SDS-PAGE loading buffer for 5 minutes and subjected to SDS-PAGE followed by autoradiography. Phosphoamino acid analvsis. 32P-metabolically labeled, immunoprecipitated SCL/tal protein was subjected to phosphoamino analysis exactly as described by Sorenson et al.'? In brief, protein was hydrolyzed in 6 mol/L HCI at l 0 0 T for 2 hours under nitrogen. Hydrolysate was then diluted with a vast excess of deionized water and lyophilized. The pellet was redissolved in thin-layer chromatography (TLC) buffer containing phosphoamino acid standards and spotted onto Whatman 3M paper (Whatman Lab Sales, Hillsboro, OR). Amino acids were resolved in one dimension by thin-layer chromatography. Standards were visualized by ninhydrin staining and "P-phosphoamino acids were visualized by autoradiography. RESULTS Sequence, genomic organization, and prokaryotic expression of SCLltal. The portion of SCL/tal coding scquencc that includes the bHLH motif is found on a 4.4-kb BumHl genomic DNA fragment containing exon VI (following the exon nomenclature used by Aplan et alz3). The open reading frame of SCL/tal is extended through two upstream exons with a putative initiation codon residing in exon IV. Published reports describe various additional 5' exons and at least two 5' cap sites as well as variable patterns of splicing of 5' untranslatcd exons within diffcrcnt hematopoietic cell linesz3 To raisc antibodies against the SCL/tal protcin product, we designed a prokaryotic exprcssion contruct for production of vaccine. DNA sequences corresponding to the 131 carboy terminal amino acids of SCL/tal were cloned in-frame into the pGEX-2T cxprcssion vector. Production of the GST-SCL/tal fusion protein was induced by IPTG treatment of Escherichia coli transformed with the expression construct. Fusion protcin synthesis was shown by SDS-PAGE analysis of crude bacterial lysates and vcrified by purification of the induced fusion protein by glutathionesepharose affinity chromatography. R33 I ATG ps-3 I R33 I GI81 7&gq ATG pCWB pCMB R331 L58 Q200 ATG DClS Fig 1. Diagrams of the various constructs used for transient transfection. The parent vector pCMV-5 is not shown in these diagrams. pS-3 consists of a cDNA fragment possessing all of the coding sequence of SCL/tal. pCWB encodes an amino terminal truncation mutant in which the basic HLH domain is preserved (glycine 181 t o arginine 331). pCMB encodes an amino terminal truncation mutant omitting the basic domain but preserving the HLH domain (glutamine 200 t o arginine 331). pClS encodes a domain swap mutant in which the amino terminal 200 amino acids of SCL/tal are replaced by the amino terminal 58 amino acids of Id: SCL/tal thus retains its HLH domain but its basic domain is replaced by the corresponding neutral portion of ATG represents the translational initiation codon. Open box represents SCL/tal coding sequence. Solid box represents SCL/tal basic domain. Cross-hatched box represents SCL/tal HLH domain. Checkerboard box represents Id coding sequence t o leucine 58. Encoded amino acids are designated by bold print. Polyclonal antisenrm production and characterization. Rabbits A-1 through A-5 wcrc immunized according to the protocol outlined in Materials and Methods. Three high responders produced titers in excess of 1:1,000 as measurcd by ELISA 10 to 12 weeks after primary immunization. f e d c b a "f 66kd 45kd 21kd IC 14kd Fig 2. lmmunoblot of Cos 7 cells transiently transfected with the constructs shown in Fig 3: lane a, untransfected Cos 7 cells; lane b, Cos 7 cells transfected with pCMV-5, the parent vector; lane c, Cos 7 cells transfected with pS-3; lane d, Cos 7 cells transfected with pCWB; lane e, Cos 7 cells transfected with pCMB; lane 1, Cos 7 cells transfected with pCIS. Polyclonal rabbit anti-SCL/tal was used as the primary antibody. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN 2861 Fig 3. Indirect immunofluorescence of Cos cell transfectants. (A) Untransfected cells stained with polyclonal rabbit anti-SCL/tal. (E) Cells transfected with pS-3 stained with preimmune rabbit serum. (C) Cells transfected with pS-3 stained with polyclonal rabbit anti-SCL/tal. (D)Cells transfected with pClS stained with polyclonal rabbit anti-SCL/tal (original magnification x630). Fig 4. Indirect immunofluorescence of Cos cell transfectants continued. Cells transfected with pClS stained with polyclonal rabbit anti-SCL/tal. (original magnification x630). From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2862 GOLDFARB ET AL Fig 5. Indirect immunofluorescence of Cos cell transfectants continued. (A and E) Cells transfected with pCWB stained with polyclonal rabbit anti-SCL/tal. (C and D) Cells transfected with pCMB stained with polyclonal rabbit anti-SCL/tal (original magnification x630). Antisera were purified by either adsorption with GST protein or by affinity selection on a GST-SCL/tal-Affigel column. Both modes of purification yielded similar results on immunofluorescence and immunoblot analysis. Expression of SCLltal protein in Cos cells. The constructs depicted in Fig 1 were transiently transfected into cos-7 cells, which were then subjected to standard immunoblot analysis. As seen in Fig 2, the full-length SCL/tal Fig 6. Indirect immunofluorescence of NIH-3T3 transfectants. (Top two panels) Cells transfected with pS-3 stained with polyclonal rabbit anti-SCL/tal. (Bottom panel) Cells transfected with control vector pCMV5 stained with polyclonal rabbit anti-SCL/tal (original magnification x630). From www.bloodjournal.org by guest on August 11, 2017. For personal use only. SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN cDNA yielded a protein product of 42 Kd (lane c); close inspection showed this 42-Kd species to be a tight multiplet. In addition, a minor species of 37-Kd (not clearly visible in Fig 2 but clearly evident in Figs 7 and 8) also derived from the full-length SCL/tal cDNA. Two amino terminal delction mutants pCWB and pCMB yielded products of 24 Kd and 22 Kd, respectively (Fig 2, lanes d and e). As with the full-length SCL/tal products, the proteins encoded by each of the deletion mutants also consisted of multiple species. A domain swap mutant in which the amino terminal of SCL/tal including the basic domain is replaced by the corresponding region of the HLH protein Id,?” yielded a protein product of 28 Kd (Fig 2 lane f); this product likewise consisted of multiple species. Indirect immitno~itorescencemicroscopy and atbcellitlar localization ofSCLltalprotein. To determine the subccllular localization of the SCL/tal protein product, Cos cells transiently transfected with the constructs depicted in Fig 1 were fixed and subjected to immunofluorescent staining using purified rabbit anti-SCL/tal polyclonal antibody. Rcprescntativc results of these studies are shown in Figs 3A through D, 4, and SA through D. Cells expressing the full-length SCL/tal product showed a clear, strong nuclear staining pattern with faint or (in most cells) absent cytoplasmic staining (Fig 3C). The pattern of nuclear staining in these cells, diffuse and granular with an abscncc of nucleolar staining, is consistent with that of a nuclcoplasmic or DNA-associated protein rather than a nucleoskeletonassociated protein. Cells transfected with pCWB, a deletion construct that retains the bHLH domain of SCL/tal, similarly showed efficient nuclear localization (Fig SA and B). Cells transfected with pCMB, a dclction construct similar to pCWB except lacking the basic domain, showed absence of nuclear localization by the encoded protein (Fig 5C and D). In fact, the pCMB-cncodcd protein seemed to be excluded from the nucleus, with the vast majority of the product located in the cytoplasm. Cells transfected with pCIS, the Id-SCL fusion construct in which the basic domain of SCL/tal has been replaced by the corresponding neutral domain of Id, showed relatively inefficient nuclear localization of the encoded product (Figs 3D and 4). Significant quantities of the Id-SCL protein product were clearly detectable in the cytoplasm, extending along the cytoplasmic processes of cells. Control cells transfected with the parent vector and stained with the anti-SCL/tal antibody showed no background fluorescence (Fig 3A). Likewise, control cells transfected with all of the constructs depicted in Fig 1 and stained with prcimmunc rabbit serum showed no background fluorescence (representative field in Fig 3B). To insure that the nuclear localization of the intact SCL/tal protein was not an artifact of expression in Cos cells, stably transfected NIH-3T3 cells cxprcssing SCL/tal were also analyzed by immunofluorescence. Control NIH3T3 cells, stably transfected with pCMV5, and stained with the anti-SCL/tal antibody showed no detectable fluorcscence (Fig 6, bottom panel). By comparison, antibody staining of NIH-3T3 cells expressing the SCL/tal protein resulted in a clear pattern of nuclear fluorcsccncc (Fig 6, top two pancls). (The heterogeneity of SCL/tal expression 2863 observed in the NIH-3T3 transfectants has occurred because the cells are not a pure clonal population). In summary, these experiments show that SCL/tal is a nuclear protein and that the basic domain is critical in directing the proper subcellular localization. Extractability of the SCL/tal protein. Hann and Eisenman have shown that the c-Myc protein is avidly complexed within the nucleus and cannot, even when present in high abundance, be extracted with nonionic detergent.24 In addition, Mittnacht and Weinberg have shown that specific isoforms of the Rb protein show preferential “tethering,” ie, high affinity binding to the nucleus.25 To explore the association of the SCL/tal protein with the nuclear compartment, transiently transfected Cos cells were subjected to sequential rounds of extraction with buffer containing 0.5% NP-40 and increasing concentrations of NaCl (0 mmol/L, 250 mmol/L, and 500 mmol/L). After extraction with 500 mmol/L NaCI, residual nuclei werc solubilized by boiling in SDS-PAGE buffer. As shown in Fig 7, the vast majority of U a m 2 2z a vi n E 5: z 0 0 0 VI m (d E In E (d z VI E N 0 p42 SCL/talp37 SCL/tal- p22 MB- Fig 7. lmmunoblot analysis of Cos cell extracts with polyclonal rabbit anti-SCL/tal. (A) Cos cells were transiently transfected with pS-3 and then subjected to extraction with NP-40 extraction buffer as described in Materials and Methods except that the NaCl concentrations were altered as indicated. Thus, cells were initially extracted with 100 pL of extraction buffer with 0 mmol/L NaCl then washed three times with 1 mL of the same buffer. After washing cells were extracted with 100 pL of extraction buffer with 250 mmol/L NaCl and washed with this buffer. Cells were then subjected to a similar round of extraction in 500 mmol/L NaCl followed by washing. The residual nuclear debris was then solubilized by boiling in SDS-PAGE buffer. (B) Results from the same type of experiment performed on Cos cells transfected with pCMB are shown. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. GOLDFARB ET AL 2864 the intact SCL/tal protein within the cells ( > 99%) was extractable with nonionic detergent and either no salt or low salt (250 mmol/L NaCL) conditions. As expected, the cytoplasmic amino terminal truncation mutant, MB, was virtually completely extracted under no salt conditions. Therefore, the intact SCL/tal protein in contrast to c-Myc is primarily located in the detergent-extractable nucleoplasmic compartment and in contrast fo Rb does not show any detectable isoform-specificnuclear "tethering." Phosphoryfutionof the SCL/tufprotein. Cos cells expressing the intact SCL/tal protein and the cytoplasmic amino terminal truncation mutant, MB, were metabolically labeled either with 35s-methionine or with 32P-orthophosphate and subjected to immunoprecipitation followed by SDS-PAGE (Fig 8). For the intact SCL/tal protein, 35smethionine labeling with immunoprecipitation yielded similar results to those observed with immunoblotting: a predominant 42-Kd species and a minor 37-Kd species. With 32P-orthophosphate metabolic labeling, only the 42-Kd species was observed, suggesting that the 37-Kd product may represent a hypophosphorylated species of SCL/tal. Alternatively, 32P metabolic labeling in these experiments may simply not provide sufficient isotope incorporation to permit detection of the minor 37-Kd product. For the cytoplasmic truncation mutant, MB, 35slabeling yielded a single species of 22-Kd, whereas 32P: labeling yielded, in addition to the major 22-Kd species, a minor species of 24-Kd. This 24-Kd species most likely represents a low abundance, hyperphosphorylated form of MB. Phosphoamino acid analysis of 32P-labeled intact SCL/ tal showed that the vast majority of phosphorylation of SCL/tal ( > 99%) within nonsynchronized, basally prolifer- ating Cos 7 cells occurs on serine residues (Fig 9). Under these circumstances there was no detectable threonine or tyrosine phosphorylation. Antiphosphotyrosine immunoblot analysis of immunoprecipitated intact SCL/tal protein also showed no evidence of tyrosine phosphorylation in the Cos cells (data not shown). DISCUSSION The SCL/tal gene encodes a putative transcriptional factor that was cloned by virtue of its physical association with a chromosomal translocation breakpoint in a leukemic cell line. Its bHLH motif implies a functional similarity to other proteins in the family of bHLH transcriptional regulators. In this report we characterize the SCL/tal protein product primarily as a 42-Kd phosphoprotein with a minor species at 37 Kd. The 37-Kd species may represent a hypophosphorylated form of SCL/tal. Our studies have not ruled out the additional possibilities that the 37-Kd isoform may arise from limited proteolysis or from use of a downstream initiation codon. Additional causes for the discrepancy between predicted (34 Kd) and observed (37 to 42 Kd) sizes of SCL/tal may include other forms of posttranslational modification or simply anomalous migration on SDS-PAGE as has been observed for C - n ~ y c . ~ ~ The nuclear localization of the SCL/tal product is consistent with its bHLH motif and putative function as a transcriptional factor. The identification of the basic domain within the bHLH motif as an element important in nuclear localization of the SCL/tal product is of interest. Because the T-ALL putative oncogenes lyl-1 and tal-2 show marked homology to SCL/tal within this region, it is likely that their protein products use a similar if not identical mechanism for nuclear localization. The colocalization of Fig 8. Immunoprecipitation analysis of metabolically labeled Cos cell transfedants. Cells were labeled either with 35s-methionine or with 32P-orthophosphate as indicated in the figure. Cells were transfectedeither with pS-3 or with pCMB expression constructs as indicated. One of the controls consisted of cells transfected with neither construct; these cells were transfectedwith the parent vector pCMV5. Immunoprecipitation was performed with polyclonal rabbit anti-SCL/ tal, indicatedas "Immune" in the figure. Control immunoprecipitation was performed on pS-3 transfectants with preimmune rabbit serum. 35s- and 32P-labeled proteinswere run in parallel on the same 12% SDS-polyacrylamide gel. The positions of the molecular weight standards (66 Kd, 45 Kd, 31 Kd, 21.5 Kd, and 14.4 Kd) are designated by bars. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2865 SCLltai: A 42-Kd NUCLEAR PHOSPHOPROTEIN Fig 9. Phosphoamino acid analysis of 32P metabolically labeled SCL/tal protein. Labeled SCL/tai protein, immunoprecipitatedfrom COS Cells transfected with ps-3, was subjected to Hcl hydrolysis and thin-layer chromatography as described in Materials and Methods. (A) The autoradiographic detection of 32P-phosphoaminoacids is shown. (B) The positions of the ninhydrin-stained internal phosphoamino acid standards are shown. the nuclear localizing and DNA-binding functions within the basic domain of SCL/tal raises the possibility that this domain evolved as a bifunctional unit with the development of one function (DNA binding) dependent on the development of another function (nuclear localization). Whether the basic domain of SCL/tal actually serves as a signal for active nuclear transport or nuclear retention or both cannot be detemined from these studies*It is also possib'e that Other sequences not identifiedin this study may ako play a role in the efficient nuclear localization of the SCL/tal protein. In C-mYC two nuclear 10CaliZatiOn sequences have been identified, one of which coincides with the basic domain; however, of the two nuclear localization sequences in C-myc, the one coinciding with the basic domain shows much less efficiency in conferring nuclear localization.26In the bHLH protein MyoD deletion mutagenesis has identified only the basic domain as playing a role in nuclear lo~alization.~~ Id, a member of the HLH protein family, displays nuclear localization despite lacking a basic domain.2RHowever, an Id-SCL fusion protein containing the amino terminal half of Id joined to the carboxy terminal half of SCL/tal displayed relatively inefficient nuclear localization. Thus, even within the HLH family of proteins divergent mechanisms have probably evolved to promote nuclear localization, diminishing the likelihood that some shared, universal nuclear localizing sequence exists within this large family of proteins. Furthermore, heterogeneity exists among bHLH proteins with regard to the compartment occupied within the nucleus. Whereas C-myc occupies a detergent-insoluble structural compartment within the nucleus, SCL/tal exists in a detergent-extractable nucleoplasmic fraction. The phosphorylation of SCL/tal is not unexpected because other bHLH proteins such as C-myc and MyoD are phosphoprotein^.^^^^^ The phosphorylation of the cytoplasmic truncation mutant of SCL/tal, MB, indicates that a fair portion of the phosphorylation of SCL/tal occurs on serine residues in the carboxy terminal region of the protein. Of relevance, multiple casein kinase I1 serine recognition sites are observed in the carboxy terminal region of SCL/tal. In addition, our laboratory has recently shown in vitro phosphorylation by purified casein kinase 11 of a recombinant SCL/tal peptide containingthe carboxy temina1 130 amin' acids (data not shown). The phosphorylation of the cytoplasmic truncation mutant of SCL/tal, MB, also indicates that phosphorylation of this portion of SCL/tal may occur in the cytoplasm before nuclear 10CahZatiOll. Further studies to address the exact sites of phosphorylation in SCL/tal, the responsible kinases, and the functional consequences of PhosPhoVlation are being Performed in our laboratoryACKNOWLEDGMENT We thank our colleagues Drs J.H. Kersey, T.W. LeBien, C. Pennell, and J.P. Houchins for advice and encouragement. Thanks to Drs P. Sorenson and P. Lampe for guidance with phosphoamino acid ana~ysis. we wish to thank D~~I.R. Kirsch, M. Minden, D.W. Russell, R. Benezra, and J. Kurtzberg for generously providing plasmids and cell lines. Very special thanks to Dr J. McCarthy for making his expertise and facilities available to us. REFERENCES undergoes chromosome translocation in T cell leukemia and 1. Begley CG, Aplan PD, Denning SM, Haynes BF, Waldmann potentially encodes a helix-loop-helixprotein. EMBO J 9:415,1990 TA, Kirsch IR: The gene SCL is expressed during early hematopoi4. Goldfarb AN, Greenberg JM: Unpublished observations, esis and encodes a differentiation-related DNA-binding motif. Proc Natl Acad Sci USA 8610128,1989 June 1991 2. Finger LB, Kagan J, Christopher G, Kurtzberg J, Hershfield 5. Fitzgerald TJ, Neale GAM, Raimondi SC, Goorha RM: c-tal, MS, Nowell PC, Croce CM: Involvement of the TCL-5 gene on a helix-loop-helix protein, is juxtaposed to the T-cell receptor p chromosome 1 in T-cell leukemia and melanoma. Proc Natl Acad chain gene by a reciprocal chromosomal translocation: t(1;7)(p32; Sci USA 865039,1989 q35). Blood 78:2686,1991 3. Chen Q, Cheng J-T, Tsai L-H, Schneider N, Buchanan G, 6. Bernard 0, Guglielmi P, Jonveaux P, Cherif D, Gisselbrecht Carroll A, Crist W, Ozanne B, Siciliano MJ, Baer R The tal gene S , Mauchauffe M, Berger R, Larsen C-J, Mathieu-Mahul D: Two From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2866 distinct mechanisms for the SCL gene activation in the t(1;14) translocation of T cell leukemias. Genes Chromosomes Cancer 1:194,1990 7. Brown L, Cheng J-T, Chen Q, Siciliano MJ, Crist W, Buchanan G, Baer R: Site-specific recombination of the tal-1 gene is a common occurrence in human T cell leukemia. EMBO J 9:3343, 1990 8. Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness VL, Kirsch IR: Disruption of the human SCL locus by “illegitimate” V-(D)-J recombinase activity. Science 250:1426,1990 9. Aplan PD, Lombardi DP, Reaman G, Sather H, Hammond GD, Kirsch I R Involvement of the putative hematopoietic transcription factor SCL in T-cell acute lymphoblastic leukemia. Blood 79:1327,1992 10. Murre C, McCaw PS, Vaessin H, Caudy M, Jan LY, Jan YN, Cabrera CV, Buskin JN, Hauschka SD, Lassar AB, Weintraub H, Baltimore D: Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58:537, 1989 11. Dalla-Favera R, Bregni M, Erickson J, Patterson D, Gallo RC, Croce CM: Human C-Myc oncogene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci USA 79:7824,1982 12. Kamps MP, Murre C, Sun X, Baltimore D: A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation in pre-B ALL. Cell 60547, 1990 13. Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith SD, Cleary ML: Chromosomal translocation t( 1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor. Cell 60535, 1990 14. Rabbitts TH: Translocations, master genes, and differences between the origins of acute and chronic leukemias. Cell 67:641, 1991 15. Mellentin J, Smith SD, Cleary M: lyl-1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Cell 58:77,1989 16. Xia Y, Brown L, Yang CY-C, Tsan JT, Siciliano MJ, Espinosa R, Le Beau MM, Baer RJ: TAL2, a helix-loop-helix gene activated by the t(7;9)(q34;q32) translocation in human T-cell leukemia. Proc Natl Acad Sci USA 88:11416,1991 GOLDFARB ET AL 17. Kurtzberg J, Waldmann TA, Davey MP, Bigner SH, Moore JO, Hershfield MS, Haynes BF: CD7+, CD4-, CD8- acute leukemia: A syndrome of malignant pluripotent lymphohematopoietic cells. Blood 73:381, 1989 18. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich H A Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:488,1988 19. Smith DB, Johnson KS: Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31,1988 20. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H: The protein Id: A negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49,1990 21. Goldfarb AN, Wolf ML, Greenberg JM: Expression of a chimeric helix-loop-helix gene, Id-SCL, in K562 human leukemic cells is associated with nuclear segmentation. Am J Pathol 1992 (in press) 22. Sorensen PHB, Mui AL-F, Murthy SC, Kqstal G: Interleukin-3, GM-CSF, and TPA induce distinct phosphorylation events in an interleukin-3 dependent multipotential cell line. Blood 73:406, 1989 23. Aplan PD, Begley CG, Bertness V, Nussmeier M, Ezquerra A, Coligan J, Kirsch IR: The SCL gene is formed from a transcriptionally complex locus. Mol Cell Biol10:6426, 1990 24. Hann S, Eisenman R: Proteins encoded by the human C-myc oncogene: Differential expression in neoplastic cells. Mol Cell Biol 4:2486, 1984 25. Mittnacht S, Weinberg R A G U S phosphorylation of the retinoblastoma protein is associated with an altered affinity for the nuclear compartment. Cell 65:381, 1991 26. Dang C, Lee W: Identification of the human C-myc protein nuclear translocation signal. Mol Cell Biol8:4048, 1988 27. Tapscott SJ, Davis RL, Thayer MJ, Cheng P-F, Weintraub H, Lassar AB: MyoD1: A nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science 242:405,1988 28. Jen Y, Weintraub H, Benezra R: Overexpression of Id protein inhibits the muscle differentiation program: In vivo association of Id with E2A proteins. Genes Dev 6:1466,1992 From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 1992 80: 2858-2866 T-cell acute lymphoblastic leukemia--the associated gene SCL/tal codes for a 42-Kd nuclear phosphoprotein AN Goldfarb, S Goueli, D Mickelson and JM Greenberg Updated information and services can be found at: http://www.bloodjournal.org/content/80/11/2858.full.html Articles on similar topics can be found in the following Blood collections Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.