Download T-cell Acute Lymphoblastic Leukemia-The

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Silencer (genetics) wikipedia , lookup

Protein–protein interaction wikipedia , lookup

Secreted frizzled-related protein 1 wikipedia , lookup

Biochemical cascade wikipedia , lookup

Gene expression wikipedia , lookup

Polyclonal B cell response wikipedia , lookup

Paracrine signalling wikipedia , lookup

Western blot wikipedia , lookup

Monoclonal antibody wikipedia , lookup

Signal transduction wikipedia , lookup

Expression vector wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Proteolysis wikipedia , lookup

Endogenous retrovirus wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Point mutation wikipedia , lookup

Two-hybrid screening wikipedia , lookup

Transcript
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
T-cell Acute Lymphoblastic Leukemia-The Associated Gene SCL/ tal Codes for
a 42-Kd Nuclear Phosphoprotein
By Adam N. Goldfarb, Said Goueli, Dan Mickelson, and James M. Greenberg
SCL/tal is a putative oncogene originally identified through
its involvement in the translocation t(1;14)(p32;qll) present
in the leukemic cell line DU.528. Subsequent studies have
shown an upstream deletion activating expression of SCLI
tal to be one of the most common genetic lesions in T-cell
acute lymphoblastic leukemia (T-ALL). The cDNA sequence
of SCL/tal encodes a basic helix-loop-helix (bHLH) protein
with regions of marked homology to lyl-1 and tal-2, two
other bHLH proteins involved in T-ALL chromosomal translocations. The bHLH motif suggests that the SCL/tal product
localizes to the nucleus, binds to specific DNA sequences,
and regulates transcription of a specific array of target genes.
Our studies directly identify the SCL/tal product as a 42-Kd
phosphoprotein that efficiently localizes to the nucleus.
Deletion mutagenesis has allowed identification of a region
critical for nuclear localization, a region that corresponds to
the DNA-binding basic domain within the bHLH motif. Because this domain is shared by lyl-l and tal-2, these latter
putative T-cell oncoproteins probably use a nuclear localization mechanism identical to that of SCL/tal.
0 1992 by The American Society of Hematology.
A
in which the derived amino acid sequence of SCL/tal
includes a basic helix-loop-helix (bHLH)
This
motif places SCL/tal in a family of proteins, identified in
organisms ranging from yeast to humans, which bind
specific DNA sequences and regulate the transcriptional
activity of target genes.l0 Other bHLH genes involved in
leukemic translocations include C-mycl’ and E2A,I2J3contributing to an emerging pattern of translocation-associated
proto-oncogenes containing transcription factor motifs.14
Of great interest in this regard is the identification of a
subset of bHLH proteins, lyl-1, SCL/tal, and tal-2, all of
which share marked homology ( > 85%) within the bHLH
region and all of which have been associated with T-ALLspecific t r a n s l o ~ a t i o n s . ~ ~ J ~
In an effort to gain an understanding of the function of
the SCL/tal gene in both normal and neoplastic development we have undertaken studies of the protein product
encoded by this gene. As presented below, the nuclear
localization of the SCL/tal protein supports its role as a
transcriptional factor. This observation is reinforced by the
experimental identification of a nuclear localization domain within the SCL/tal protein. In addition, evidence is
presented that the SCL/tal protein undergoes phosphorylation and that some of this phosphorylation may occur
before nuclear localization.
NOVEL transcriptional unit 04 chromosome number
1,band p32 has recently been s p w n to be involved in
the translocation, t(1;14)(p32;qll) found in rare cases of
T-cell acute lymphoblastic leukemia (T-ALL) and stem cell
1e~kemia.l.~
Investigators at several laboratories, including
the University of Minnesota, have independently cloned
this translocational breakpoint and identified the associated transcriptional unit on chromosome lp32, which we
have designated SCL/tal based on previously published
nomenclature.’-“ Several different kinds of chromosomal
breakpoints affecting the SCL/tal gene have been observed
in cases of acute leukemia. In the multipotential leukemic
cell line, DU.528, the t(1;14)(p32:qll) is associated with
disruption of the 3’ untranslated sequences of exon VI.’ In
one case report of T-ALL associated with t( 1;7)(p32:q35)
the breakpoint occurs 35 kb downstream of the entire
SCL/tal IOCUS.~
In approximately 2% to 3% of T-ALLs the
t(1;14)(p32;qll) breakpoint disrupts or eliminates 5’ noncoding exons.h Finally, in 16% to 25% of cases of T-ALL, a
submicroscopic interstitial deletion upstream of the SCL/
tal locus juxtaposes noncoding exons from a novel gene
expressed in thymocytes, SIL, with coding exons from
SCL/tal, aberrantly placing the SCL/tal gene under the
control of a promoter active in T cell^.^-^
Our own sequencing efforts support the previous reports,
MATERIALS AND METHODS
From the University of Minnesota Hospital Department of Laboratory Medicine and Pathology, and Minneapolis VA Medical Center,
Universityof Minnesota School of Medicine, Minneapolis.
Submitted May 19, 1992; accepted July 31, 1992.
Supported in part by grantsfrom the Minnesota Medical Foundation
and the Vikings Children’s Fund of the University of Minnesota
Department of Pediatrics. A.N.G. is a recipient of a Foundation
Fellowship from the College of American Pathologists. J.M.G . is the
recipient of a Clinical Investigator Award from the National Institutes
of Health (CA-01254).
Address reprint requests to Adam N. Goldfarb, MD, Department of
Laboratory Medicine and Pathology, University of Minnesota Hospitals and Clinics, UMHC Box 198, 420 Delaware St SE, Minneapolis,
MN 55455.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
Q 1992 by The American Society of Hematology.
0006-49711921801I -0016$3.00/0
2858
Cell lines. DU.528 (provided by J. Kurtzberg, Duke University)
derived from a human stem cell leukemia containing the translocation t(1;14)(p32;qll) as previously described” was maintained in
RPMI 1640 with 10% fetal bovine serum (FBS) and 10% horse
serum. cos-7 (provided by T. LeBien, University of Minnesota)
was maintained in Dubecco’s Modified Eagle’s Medium (DMEM)
with 10% FBS.
Cloning of SCLItal. High molecular weight genomic DNA
prepared from DU.528 was used to construct a cosmid library using
the Lorist 6 vector. Approximately 200,000 independent clones
were screened with a probe derived from the T-cell receptor D-6 1
locus on chromosome 14qll (provided by M. Minden, Ontario
Cancer Institute). Clones containing the der14 breakpoint were
identified and a repeat-free 8.4-kb EcoRI fragment spanning the
breakpoint was used to screen a Jurkat cDNA library (Stratagene,
La Jolla, CA). Complementary DNA clones of SCLltal were
sequenced and used to screen a human placental genomic DNA A
phage library (Stratagene). A 20-kb genomic DNA A phage clone,
which contained all of the coding exons of SCLltal, was used to
subclone BamHl fragments into pUC 19. B4.4 is a 4.4-kb genomic
Blood, Vol80, No 11 (December 1). 1992: pp 2858-2866
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN
DNA subclone that includes the bHLH and carboxy terminal
coding sequences of SCL/tal.
DNA sequencing. DNA sequencing was accomplished using
single-stranded (M13) or double-stranded (alkali denatured) templates. DNA sequencing reactions used the Sanger dideoxy method
with Sequenase T7 polymerase (US Biochemicals, Cleveland, OH).
Sequence information was read using a digitizer linked to an Apple
Macintosh SE/30 (Apple Computer Inc, Cupertino, CA) and
analyzed with DNAStar software (DNASTAR, Inc, Madison, WI).
Prokaryoticexpression of SCL /tal andpolyclonal antisemmproduction. DNA containing the coding sequences for the 131 carboxy
terminal amino acids of SCL/tal was amplified by polymerase chain
reaction (PCR)18 using the following primers: 5'mer of 5' GCTCTAGAGCCATGCAGCAGAATGTGAACGGGGCCTTT3'and
a 3'mer of S'AAGGATCCAAAGTTCAAGTCCACCGCCTTGCT3'. The template consisted of the B4.4 genomic subclone.
The 550-bp PCR product was digested with Xba 1 and BamH1,
blunt ended with the Klenow fragment of DNA polymerase I and
ligated into the Sma 1 site of pBluescript (Stratagene). The
SCL/tal fragment was shuttled into the prokaryotic expression
vector pGEX-2T (Pharmacia Fine Chemicals, Uppsala, Sweden)
by digestion with BamHl and Xho 1, blunt ending of the fragment
with Klenow and ligation into a unique Sma 1 site. The recombinant expression construct designated pGEXMB 1#7 includes
sequences coding for the 26-Kd carboxy terminus of glutathione
S-transferase (GST) under the control of an isopropylthio-pgalactoside (IPTG) inducible promoter.I9The construct was restriction mapped and sequenced to verify the correct orientation and
reading frame. After IPTG induction, GST-SCL/tal fusion protein
was purified from crude bacterial lysates by glutathione-sepharose
affinity chromatography. SCL/tal peptide, released from its GST
partner by thrombin digestion, was purified by repetition of the
glutathione-sepharose affinity chromatography step. Preparations
of the GST-SCL/tal fusion protein and the SCL/tal thrombinreleased peptide were judged as greater than 95% pure by
Coomassie brilliant blue staining after sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). Primary immunization of New Zealand white rabbits consisted of 50 p,g of
GST-SCL/tal or SCL/tal peptide emulsified in complete Freund's
adjuvant followed by every other week immunizations of 25 pg
protein emulsified in incomplete Freund's adjuvant. Preimmune
serum was obtained from each rabbit before immunization. Three
rabbits (A-1, -2, and -3) were immunized with the intact GST-SCL/
tal protein and two rabbits (A-4 and -5) were immunized with the
133 amino acid SCLital peptide obtained after thrombin digestion
of GST-SCL/tal. Antisera were titered by enzyme-linked immunosorbant assay (ELISA) 8 to 10 weeks after primary immunization.
Generation of constructs. pCWB, a construct encoding the
carboxy terminal 150 amino acids of SCL/tal including the bHLH
region, was prepared as follows: the appropriate DNA sequences
were obtained by PCR-mediated amplification (using genomic
subclone B4.4 as template) using a 5'mer containing an Xba I
cloning site and an in-frame initiation codon within a favorable
Kozak consensus sequence. The 5'mer sequence was 5'GCTCTAGAGCCATGGGTCCCCACACCAAAG'ITGTG3'.The 3'mer
was identical to that used for preparation of the GST-SCL/tal
fusion construct described above. The PCR product was cut with
Xba I and BamHI, blunt ended, and cloned into the Sma I site of
pBluescript (Stratagene). The correct orientation of the clone was
confirmed by restriction mapping and DNA sequence analysis. The
clone was digested with Hind111 and Xba I and ligated into the
corresponding sites in the pCMV 5 eukaryotic expression vector
(Dr D.W. Russell, University of Texas, Southwestern Medical
Center, Dallas). pCMB, a construct encoding the 131 carboxy
2859
terminal amino acids of SCL/tal excluding the basic domain but
including the HLH domain, was constructed in the same way as
pCWB, except with a different 5'mer: S'GCTCTACAGCCATGCAGCAGAATGTGAACGGGGCCTTT 3'. pS-3, a construct encoding the full-length SCL/tal product was derived by excising a
1.2-kb HindIII-Xba I fragment from pBluescript 11-SCL (provided
by Dr I.R. Kirsch, Bethesda Naval Hospital, Bethesda, MD) and
ligating it into the corresponding sites of pCMV-5. pCIS consists of
an Id-SCL fusion gene encoding amino acids 1 to 58 of Id2'' and
amino acids 201 to 331 of SCL/tal cloned into pCMV-5. Further
details regarding construction of the Id-SCL fusion gene will be
published elsewhere.2l The inserts of all PCR-built constructs were
sequenced in their entirety to rule out spontaneous mutations
introduced by Taq polymerase into the open reading frames.
Transfections and immunofluorescent staining. cos-7 cells on
100-mm plastic dishes or glass cover slips were grown to -80%
confluency. Cells were repeatedly washed with phosphate-buffered
saline (PBS) then incubated with 30 p,g Lipofectin (GIBCO BRL
Life Technologies, Inc, Gaithersburg, MD) plus 7 pg plasmid in
serum-free DMEM overnight at 37"C, 5% CO2. Cells were then
allowed to recover 72 hours in DMEM with 10% fbs before
harvesting or fixation. Cells grown on coverslips were fixed 5' in
methanol at -20°C followed by 5' in acetone at -20°C. Coverslips
were washed in PBS and then blocked with PBS/0.2% Tween
20/5% normal goat serum for 1hour at room temperature. Primary
antibody, consisting of rabbit anti-GST-SCL/tal (exhaustively
adsorbed with glutathione sepharose 4B loaded with bacterial
lysates containing GST), was diluted 1/1,000 in PBS/0.2% Tween
20/5% normal goat serum and incubated on coverslips 40 minutes
at room temperature. After repeated washes in PBS/0.2% Tween
20, coverslips were overlaid with secondary antibody, fluorescein
isothiocyanate goat antirabbit, diluted 1/2,000 in PBS/0.2% Tween
20/5% normal goat serum, incubating 30 minutes at room temperature. Coverslips were then repeatedly washed first in PBS/0.2%
Tween 20 and then in PBS alone.
Immunoblotting. Cells grown to 90% confluency on 100-mm
plastic dishes were washed once with PBS and then scraped in
PBS/5 mmol/L EDTA. Pelleted cells were resuspended in 100 p L
of NP-40 extraction buffer (0.5% NP-40, 50 mmol/L Tris HCl, pH
7.6, 100 mmol/L NaCI, 5 mmol/L MgC12, 5 mmol/L EDTA, 1
mmol/L phenylmethylsulfonyl fluoride (PMSF), 1 pg/mL pepstatin, 1 p,g/mL leupeptin, 0.1% aprotinin) and incubated on ice 10
minutes with gentle agitation. Debris was then removed by centrifugation at 13,000 rpm for 10 minutes at 4°C. Supernatants were
fractionated by standard SDS-PAGE using 12% gels. Proteins
were electroblotted onto nitrocellulose membranes. Membranes
were blocked with 10% normal goat serum in TBS (20 mmol/L Tris
HCI, pH 7.5, 500 mmol/L NaCI) with 5% nonfat dried milk for 2
hours at room temperature. Primary antibody (adsorbed rabbit
anti-GST-SCL/tal) was diluted 1/350 in TTBS (TBS/0.2% Tween
20) with 1% nonfat dried milk and incubated on membranes for 2
hours at room temperature. After washing membranes repeatedly
in 'ITBS, secondary antibody, alkaline phosphatase-conjugated
goat anti-rabbit, was diluted 1/1,000 in TTBS with 1% nonfat dried
milk and applied to membranes for 1 hour at room temperature.
Membranes were developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/Nitro blue tetrazolium (NBT) as chromogenic
substrate.
Metabolic labeling and immunoprecipitation. At 60 hours posttransfection, Cos cells were washed extensively with serum-free
deficient media (for 35s-methionine labeling, methionine-deficient
RPMI 1640 [Sigma Chemical Co, St Louis, MO]; for 3ZP-phosphate
labeling, phosphate-deficient DMEM, [Sigma]). Cells were then
incubated for 2 hours at 3 7 T , 5% CO2 in labeling media (methionine-deficient RPMI 1640 with 0.5 mCi/mL Tran-35s Label [ICN
-
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
GOLDFARB ET AL
2860
Pharmaceuticals Inc. Plainview, NY]: phosphate-deficient DMEM
with 0.5 mCi/mL carrier-free 32P-orthophosphate [Amersham,
Arlington Heights, IL]). Each labeling consisted of 0.5 x 10" cells
in 5 mL labeling media. After metabolic labeling, cells were
extensively washed with PBS and scraped in PBS/0.5 mmol/L
EDTA. To the cell pellet was added 500 p L extract buffer: 0.5%
NP-40, 50 mmol/LTris HCI, pH 7.8, 100 mmol/L NaCI, 5 mmol/L
MgCI2, 5 mmol/L EDTA, 1 mmol/L PMSF, 0.1% aprotinin, 1
Fg/mLleupeptin, 1 Fg/mLpepstatin, 10 mmollLsodium pyrophosphate, 100 mmol/L sodium fluoride, 2 mmol/L sodium orthovanadate, 0.1 mmollL sodium metavanadate. Cells were incubated on
ice with extract buffer for 20 minutes and nuclear debris was
removed by centrifugation. Cellular extracts were precleared by
the addition of 20 p L preimmune rabbit sera followed by 50 p L
Pansorbin (Calbiochem Inc, San Diego. CA). Following preclearing, 20 FLof immune or control serum was added to extracts which
were then incubated for 2 hours on ice. Immune complexes were
collected on protein-A agarose (Calhiochem) and subjected to
sequential washes with extract buffer. triple detergent radioimmunoprecipitation buffer (RIPA buffer) (containing 1% NP-40. 1%
sodium deoxycholate, and 0.1% SDS), TBS (20 mmol/L Tris HCI,
pH 7.5,500 mmol/L NaCI), and T E (10 mmol/LTris HCI, pH 7.5,
1 mmol/L EDTA). Immune complexes were then dissociated by
boiling in SDS-PAGE loading buffer for 5 minutes and subjected to
SDS-PAGE followed by autoradiography.
Phosphoamino acid analvsis. 32P-metabolically labeled, immunoprecipitated SCL/tal protein was subjected to phosphoamino
analysis exactly as described by Sorenson et al.'? In brief, protein
was hydrolyzed in 6 mol/L HCI at l 0 0 T for 2 hours under
nitrogen. Hydrolysate was then diluted with a vast excess of
deionized water and lyophilized. The pellet was redissolved in
thin-layer chromatography (TLC) buffer containing phosphoamino
acid standards and spotted onto Whatman 3M paper (Whatman
Lab Sales, Hillsboro, OR). Amino acids were resolved in one
dimension by thin-layer chromatography. Standards were visualized by ninhydrin staining and "P-phosphoamino acids were
visualized by autoradiography.
RESULTS
Sequence, genomic organization, and prokaryotic expression
of SCLltal. The portion of SCL/tal coding scquencc that
includes the bHLH motif is found on a 4.4-kb BumHl
genomic DNA fragment containing exon VI (following the
exon nomenclature used by Aplan et alz3). The open
reading frame of SCL/tal is extended through two upstream exons with a putative initiation codon residing in
exon IV. Published reports describe various additional 5'
exons and at least two 5' cap sites as well as variable
patterns of splicing of 5' untranslatcd exons within diffcrcnt
hematopoietic cell linesz3
To raisc antibodies against the SCL/tal protcin product,
we designed a prokaryotic exprcssion contruct for production of vaccine. DNA sequences corresponding to the 131
carboy terminal amino acids of SCL/tal were cloned
in-frame into the pGEX-2T cxprcssion vector. Production
of the GST-SCL/tal fusion protein was induced by IPTG
treatment of Escherichia coli transformed with the expression construct. Fusion protcin synthesis was shown by
SDS-PAGE analysis of crude bacterial lysates and vcrified
by purification of the induced fusion protein by glutathionesepharose affinity chromatography.
R33 I
ATG
ps-3
I
R33 I
GI81
7&gq
ATG
pCWB
pCMB
R331
L58 Q200
ATG
DClS
Fig 1. Diagrams of the various constructs used for transient
transfection. The parent vector pCMV-5 is not shown in these
diagrams. pS-3 consists of a cDNA fragment possessing all of the
coding sequence of SCL/tal. pCWB encodes an amino terminal
truncation mutant in which the basic HLH domain is preserved
(glycine 181 t o arginine 331). pCMB encodes an amino terminal
truncation mutant omitting the basic domain but preserving the HLH
domain (glutamine 200 t o arginine 331). pClS encodes a domain swap
mutant in which the amino terminal 200 amino acids of SCL/tal are
replaced by the amino terminal 58 amino acids of Id: SCL/tal thus
retains its HLH domain but its basic domain is replaced by the
corresponding neutral portion of
ATG represents the translational initiation codon. Open box represents SCL/tal coding sequence. Solid box represents SCL/tal basic domain. Cross-hatched
box represents SCL/tal HLH domain. Checkerboard box represents Id
coding sequence t o leucine 58. Encoded amino acids are designated
by bold print.
Polyclonal antisenrm production and characterization.
Rabbits A-1 through A-5 wcrc immunized according to the
protocol outlined in Materials and Methods. Three high
responders produced titers in excess of 1:1,000 as measurcd
by ELISA 10 to 12 weeks after primary immunization.
f
e
d
c
b
a
"f
66kd
45kd
21kd
IC
14kd
Fig 2. lmmunoblot of Cos 7 cells transiently transfected with the
constructs shown in Fig 3: lane a, untransfected Cos 7 cells; lane b,
Cos 7 cells transfected with pCMV-5, the parent vector; lane c, Cos 7
cells transfected with pS-3; lane d, Cos 7 cells transfected with
pCWB; lane e, Cos 7 cells transfected with pCMB; lane 1, Cos 7 cells
transfected with pCIS. Polyclonal rabbit anti-SCL/tal was used as the
primary antibody.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN
2861
Fig 3. Indirect immunofluorescence of Cos cell transfectants. (A) Untransfected cells stained with polyclonal rabbit anti-SCL/tal. (E) Cells
transfected with pS-3 stained with preimmune rabbit serum. (C) Cells transfected with pS-3 stained with polyclonal rabbit anti-SCL/tal. (D)Cells
transfected with pClS stained with polyclonal rabbit anti-SCL/tal (original magnification x630).
Fig 4. Indirect immunofluorescence of Cos cell transfectants continued. Cells transfected
with pClS stained with polyclonal rabbit anti-SCL/tal. (original magnification x630).
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2862
GOLDFARB ET AL
Fig 5. Indirect immunofluorescence of Cos cell transfectants continued. (A and E) Cells transfected with pCWB stained with polyclonal rabbit
anti-SCL/tal. (C and D) Cells transfected with pCMB stained with polyclonal rabbit anti-SCL/tal (original magnification x630).
Antisera were purified by either adsorption with GST
protein or by affinity selection on a GST-SCL/tal-Affigel
column. Both modes of purification yielded similar results
on immunofluorescence and immunoblot analysis.
Expression of SCLltal protein in Cos cells. The constructs depicted in Fig 1 were transiently transfected into
cos-7 cells, which were then subjected to standard immunoblot analysis. As seen in Fig 2, the full-length SCL/tal
Fig 6. Indirect immunofluorescence of NIH-3T3 transfectants.
(Top two panels) Cells transfected with pS-3 stained with
polyclonal rabbit anti-SCL/tal.
(Bottom panel) Cells transfected
with control vector pCMV5
stained with polyclonal rabbit
anti-SCL/tal (original magnification x630).
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
SCL/tal: A 42-Kd NUCLEAR PHOSPHOPROTEIN
cDNA yielded a protein product of 42 Kd (lane c); close
inspection showed this 42-Kd species to be a tight multiplet.
In addition, a minor species of 37-Kd (not clearly visible in
Fig 2 but clearly evident in Figs 7 and 8) also derived from
the full-length SCL/tal cDNA. Two amino terminal delction mutants pCWB and pCMB yielded products of 24 Kd
and 22 Kd, respectively (Fig 2, lanes d and e). As with the
full-length SCL/tal products, the proteins encoded by each
of the deletion mutants also consisted of multiple species. A
domain swap mutant in which the amino terminal of
SCL/tal including the basic domain is replaced by the
corresponding region of the HLH protein Id,?” yielded a
protein product of 28 Kd (Fig 2 lane f); this product
likewise consisted of multiple species.
Indirect immitno~itorescencemicroscopy and atbcellitlar
localization ofSCLltalprotein. To determine the subccllular localization of the SCL/tal protein product, Cos cells
transiently transfected with the constructs depicted in Fig 1
were fixed and subjected to immunofluorescent staining
using purified rabbit anti-SCL/tal polyclonal antibody.
Rcprescntativc results of these studies are shown in Figs 3A
through D, 4, and SA through D. Cells expressing the
full-length SCL/tal product showed a clear, strong nuclear
staining pattern with faint or (in most cells) absent cytoplasmic staining (Fig 3C). The pattern of nuclear staining in
these cells, diffuse and granular with an abscncc of nucleolar staining, is consistent with that of a nuclcoplasmic or
DNA-associated protein rather than a nucleoskeletonassociated protein. Cells transfected with pCWB, a deletion
construct that retains the bHLH domain of SCL/tal,
similarly showed efficient nuclear localization (Fig SA and
B). Cells transfected with pCMB, a dclction construct
similar to pCWB except lacking the basic domain, showed
absence of nuclear localization by the encoded protein (Fig
5C and D). In fact, the pCMB-cncodcd protein seemed to
be excluded from the nucleus, with the vast majority of the
product located in the cytoplasm. Cells transfected with
pCIS, the Id-SCL fusion construct in which the basic
domain of SCL/tal has been replaced by the corresponding
neutral domain of Id, showed relatively inefficient nuclear
localization of the encoded product (Figs 3D and 4).
Significant quantities of the Id-SCL protein product were
clearly detectable in the cytoplasm, extending along the
cytoplasmic processes of cells. Control cells transfected
with the parent vector and stained with the anti-SCL/tal
antibody showed no background fluorescence (Fig 3A).
Likewise, control cells transfected with all of the constructs
depicted in Fig 1 and stained with prcimmunc rabbit serum
showed no background fluorescence (representative field in
Fig 3B). To insure that the nuclear localization of the intact
SCL/tal protein was not an artifact of expression in Cos
cells, stably transfected NIH-3T3 cells cxprcssing SCL/tal
were also analyzed by immunofluorescence. Control NIH3T3 cells, stably transfected with pCMV5, and stained with
the anti-SCL/tal antibody showed no detectable fluorcscence (Fig 6, bottom panel). By comparison, antibody
staining of NIH-3T3 cells expressing the SCL/tal protein
resulted in a clear pattern of nuclear fluorcsccncc (Fig 6,
top two pancls). (The heterogeneity of SCL/tal expression
2863
observed in the NIH-3T3 transfectants has occurred because the cells are not a pure clonal population). In
summary, these experiments show that SCL/tal is a nuclear
protein and that the basic domain is critical in directing the
proper subcellular localization.
Extractability of the SCL/tal protein. Hann and Eisenman have shown that the c-Myc protein is avidly complexed
within the nucleus and cannot, even when present in high
abundance, be extracted with nonionic detergent.24 In
addition, Mittnacht and Weinberg have shown that specific
isoforms of the Rb protein show preferential “tethering,”
ie, high affinity binding to the nucleus.25 To explore the
association of the SCL/tal protein with the nuclear compartment, transiently transfected Cos cells were subjected to
sequential rounds of extraction with buffer containing 0.5%
NP-40 and increasing concentrations of NaCl (0 mmol/L,
250 mmol/L, and 500 mmol/L). After extraction with 500
mmol/L NaCI, residual nuclei werc solubilized by boiling in
SDS-PAGE buffer. As shown in Fig 7, the vast majority of
U
a
m
2
2z
a
vi
n
E
5:
z
0
0
0
VI
m
(d
E
In
E
(d
z
VI
E
N
0
p42 SCL/talp37 SCL/tal-
p22 MB-
Fig 7. lmmunoblot analysis of Cos cell extracts with polyclonal
rabbit anti-SCL/tal. (A) Cos cells were transiently transfected with
pS-3 and then subjected to extraction with NP-40 extraction buffer as
described in Materials and Methods except that the NaCl concentrations were altered as indicated. Thus, cells were initially extracted
with 100 pL of extraction buffer with 0 mmol/L NaCl then washed
three times with 1 mL of the same buffer. After washing cells were
extracted with 100 pL of extraction buffer with 250 mmol/L NaCl and
washed with this buffer. Cells were then subjected to a similar round
of extraction in 500 mmol/L NaCl followed by washing. The residual
nuclear debris was then solubilized by boiling in SDS-PAGE buffer. (B)
Results from the same type of experiment performed on Cos cells
transfected with pCMB are shown.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
GOLDFARB ET AL
2864
the intact SCL/tal protein within the cells ( > 99%) was
extractable with nonionic detergent and either no salt or
low salt (250 mmol/L NaCL) conditions. As expected, the
cytoplasmic amino terminal truncation mutant, MB, was
virtually completely extracted under no salt conditions.
Therefore, the intact SCL/tal protein in contrast to c-Myc is
primarily located in the detergent-extractable nucleoplasmic compartment and in contrast fo Rb does not show any
detectable isoform-specificnuclear "tethering."
Phosphoryfutionof the SCL/tufprotein. Cos cells expressing the intact SCL/tal protein and the cytoplasmic amino
terminal truncation mutant, MB, were metabolically labeled either with 35s-methionine or with 32P-orthophosphate and subjected to immunoprecipitation followed by
SDS-PAGE (Fig 8). For the intact SCL/tal protein, 35smethionine labeling with immunoprecipitation yielded similar results to those observed with immunoblotting: a
predominant 42-Kd species and a minor 37-Kd species.
With 32P-orthophosphate metabolic labeling, only the
42-Kd species was observed, suggesting that the 37-Kd
product may represent a hypophosphorylated species of
SCL/tal. Alternatively, 32P metabolic labeling in these
experiments may simply not provide sufficient isotope
incorporation to permit detection of the minor 37-Kd
product. For the cytoplasmic truncation mutant, MB, 35slabeling yielded a single species of 22-Kd, whereas 32P:
labeling yielded, in addition to the major 22-Kd species, a
minor species of 24-Kd. This 24-Kd species most likely
represents a low abundance, hyperphosphorylated form of
MB.
Phosphoamino acid analysis of 32P-labeled intact SCL/
tal showed that the vast majority of phosphorylation of
SCL/tal ( > 99%) within nonsynchronized, basally prolifer-
ating Cos 7 cells occurs on serine residues (Fig 9). Under
these circumstances there was no detectable threonine or
tyrosine phosphorylation. Antiphosphotyrosine immunoblot analysis of immunoprecipitated intact SCL/tal protein
also showed no evidence of tyrosine phosphorylation in the
Cos cells (data not shown).
DISCUSSION
The SCL/tal gene encodes a putative transcriptional
factor that was cloned by virtue of its physical association
with a chromosomal translocation breakpoint in a leukemic
cell line. Its bHLH motif implies a functional similarity to
other proteins in the family of bHLH transcriptional
regulators. In this report we characterize the SCL/tal
protein product primarily as a 42-Kd phosphoprotein with a
minor species at 37 Kd. The 37-Kd species may represent a
hypophosphorylated form of SCL/tal. Our studies have not
ruled out the additional possibilities that the 37-Kd isoform
may arise from limited proteolysis or from use of a
downstream initiation codon. Additional causes for the
discrepancy between predicted (34 Kd) and observed (37 to
42 Kd) sizes of SCL/tal may include other forms of
posttranslational modification or simply anomalous migration on SDS-PAGE as has been observed for C - n ~ y c . ~ ~
The nuclear localization of the SCL/tal product is
consistent with its bHLH motif and putative function as a
transcriptional factor. The identification of the basic domain within the bHLH motif as an element important in
nuclear localization of the SCL/tal product is of interest.
Because the T-ALL putative oncogenes lyl-1 and tal-2 show
marked homology to SCL/tal within this region, it is likely
that their protein products use a similar if not identical
mechanism for nuclear localization. The colocalization of
Fig 8. Immunoprecipitation
analysis of metabolically labeled
Cos cell transfedants. Cells were
labeled either with 35s-methionine or with 32P-orthophosphate
as indicated in the figure. Cells
were transfectedeither with pS-3
or with pCMB expression constructs as indicated. One of the
controls consisted of cells transfected with neither construct;
these cells were transfectedwith
the parent vector pCMV5. Immunoprecipitation was performed
with polyclonal rabbit anti-SCL/
tal, indicatedas "Immune" in the
figure. Control immunoprecipitation was performed on pS-3
transfectants with preimmune
rabbit serum. 35s- and 32P-labeled proteinswere run in parallel on the same 12% SDS-polyacrylamide gel. The positions of
the molecular weight standards
(66 Kd, 45 Kd, 31 Kd, 21.5 Kd, and
14.4 Kd) are designated by bars.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2865
SCLltai: A 42-Kd NUCLEAR PHOSPHOPROTEIN
Fig 9. Phosphoamino acid analysis of 32P metabolically labeled
SCL/tal protein. Labeled SCL/tai protein, immunoprecipitatedfrom
COS Cells transfected with ps-3, was subjected to Hcl hydrolysis and
thin-layer chromatography as described in Materials and Methods. (A)
The autoradiographic detection of 32P-phosphoaminoacids is shown.
(B) The positions of the ninhydrin-stained internal phosphoamino acid
standards are shown.
the nuclear localizing and DNA-binding functions within
the basic domain of SCL/tal raises the possibility that this
domain evolved as a bifunctional unit with the development
of one function (DNA binding) dependent on the development of another function (nuclear localization). Whether
the basic domain of SCL/tal actually serves as a signal for
active nuclear transport or nuclear retention or both cannot
be detemined from these studies*It is also possib'e that
Other sequences not identifiedin this study may ako play a
role in the efficient nuclear localization of the SCL/tal
protein.
In C-mYC two nuclear 10CaliZatiOn sequences have been
identified, one of which coincides with the basic domain;
however, of the two nuclear localization sequences in
C-myc, the one coinciding with the basic domain shows
much less efficiency in conferring nuclear localization.26In
the bHLH protein MyoD deletion mutagenesis has identified only the basic domain as playing a role in nuclear
lo~alization.~~
Id, a member of the HLH protein family,
displays nuclear localization despite lacking a basic domain.2RHowever, an Id-SCL fusion protein containing the
amino terminal half of Id joined to the carboxy terminal
half of SCL/tal displayed relatively inefficient nuclear
localization. Thus, even within the HLH family of proteins
divergent mechanisms have probably evolved to promote
nuclear localization, diminishing the likelihood that some
shared, universal nuclear localizing sequence exists within
this large family of proteins. Furthermore, heterogeneity
exists among bHLH proteins with regard to the compartment occupied within the nucleus. Whereas C-myc occupies
a detergent-insoluble structural compartment within the
nucleus, SCL/tal exists in a detergent-extractable nucleoplasmic fraction.
The phosphorylation of SCL/tal is not unexpected because other bHLH proteins such as C-myc and MyoD are
phosphoprotein^.^^^^^ The phosphorylation of the cytoplasmic truncation mutant of SCL/tal, MB, indicates that a fair
portion of the phosphorylation of SCL/tal occurs on serine
residues in the carboxy terminal region of the protein. Of
relevance, multiple casein kinase I1 serine recognition sites
are observed in the carboxy terminal region of SCL/tal. In
addition, our laboratory has recently shown in vitro phosphorylation by purified casein kinase 11 of a recombinant
SCL/tal peptide containingthe carboxy temina1 130 amin'
acids (data not shown). The phosphorylation of the cytoplasmic truncation mutant of SCL/tal, MB, also indicates that
phosphorylation of this portion of SCL/tal may occur in the
cytoplasm before nuclear 10CahZatiOll. Further studies to
address the exact sites of phosphorylation in SCL/tal, the
responsible kinases, and the functional consequences of
PhosPhoVlation are being Performed in our laboratoryACKNOWLEDGMENT
We thank our colleagues Drs J.H. Kersey, T.W. LeBien, C.
Pennell, and J.P. Houchins for advice and encouragement. Thanks
to Drs P. Sorenson and P. Lampe for guidance with phosphoamino
acid ana~ysis. we wish to thank D~~I.R. Kirsch, M. Minden, D.W.
Russell, R. Benezra, and J. Kurtzberg for generously providing
plasmids and cell lines. Very special thanks to Dr J. McCarthy for
making his expertise and facilities available to us.
REFERENCES
undergoes chromosome translocation in T cell leukemia and
1. Begley CG, Aplan PD, Denning SM, Haynes BF, Waldmann
potentially encodes a helix-loop-helixprotein. EMBO J 9:415,1990
TA, Kirsch IR: The gene SCL is expressed during early hematopoi4. Goldfarb AN, Greenberg JM: Unpublished observations,
esis and encodes a differentiation-related DNA-binding motif.
Proc Natl Acad Sci USA 8610128,1989
June 1991
2. Finger LB, Kagan J, Christopher G, Kurtzberg J, Hershfield
5. Fitzgerald TJ, Neale GAM, Raimondi SC, Goorha RM: c-tal,
MS, Nowell PC, Croce CM: Involvement of the TCL-5 gene on
a helix-loop-helix protein, is juxtaposed to the T-cell receptor p
chromosome 1 in T-cell leukemia and melanoma. Proc Natl Acad
chain gene by a reciprocal chromosomal translocation: t(1;7)(p32;
Sci USA 865039,1989
q35). Blood 78:2686,1991
3. Chen Q, Cheng J-T, Tsai L-H, Schneider N, Buchanan G,
6. Bernard 0, Guglielmi P, Jonveaux P, Cherif D, Gisselbrecht
Carroll A, Crist W, Ozanne B, Siciliano MJ, Baer R The tal gene
S , Mauchauffe M, Berger R, Larsen C-J, Mathieu-Mahul D: Two
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2866
distinct mechanisms for the SCL gene activation in the t(1;14)
translocation of T cell leukemias. Genes Chromosomes Cancer
1:194,1990
7. Brown L, Cheng J-T, Chen Q, Siciliano MJ, Crist W,
Buchanan G, Baer R: Site-specific recombination of the tal-1 gene
is a common occurrence in human T cell leukemia. EMBO J
9:3343, 1990
8. Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness
VL, Kirsch IR: Disruption of the human SCL locus by “illegitimate”
V-(D)-J recombinase activity. Science 250:1426,1990
9. Aplan PD, Lombardi DP, Reaman G, Sather H, Hammond
GD, Kirsch I R Involvement of the putative hematopoietic transcription factor SCL in T-cell acute lymphoblastic leukemia. Blood
79:1327,1992
10. Murre C, McCaw PS, Vaessin H, Caudy M, Jan LY, Jan YN,
Cabrera CV, Buskin JN, Hauschka SD, Lassar AB, Weintraub H,
Baltimore D: Interactions between heterologous helix-loop-helix
proteins generate complexes that bind specifically to a common
DNA sequence. Cell 58:537, 1989
11. Dalla-Favera R, Bregni M, Erickson J, Patterson D, Gallo
RC, Croce CM: Human C-Myc oncogene is located on the region
of chromosome 8 that is translocated in Burkitt lymphoma cells.
Proc Natl Acad Sci USA 79:7824,1982
12. Kamps MP, Murre C, Sun X, Baltimore D: A new homeobox
gene contributes the DNA binding domain of the t(1;19) translocation in pre-B ALL. Cell 60547, 1990
13. Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E,
Smith SD, Cleary ML: Chromosomal translocation t( 1;19) results
in synthesis of a homeobox fusion mRNA that codes for a potential
chimeric transcription factor. Cell 60535, 1990
14. Rabbitts TH: Translocations, master genes, and differences
between the origins of acute and chronic leukemias. Cell 67:641,
1991
15. Mellentin J, Smith SD, Cleary M: lyl-1, a novel gene altered
by chromosomal translocation in T cell leukemia, codes for a
protein with a helix-loop-helix DNA binding motif. Cell 58:77,1989
16. Xia Y, Brown L, Yang CY-C, Tsan JT, Siciliano MJ,
Espinosa R, Le Beau MM, Baer RJ: TAL2, a helix-loop-helix gene
activated by the t(7;9)(q34;q32) translocation in human T-cell
leukemia. Proc Natl Acad Sci USA 88:11416,1991
GOLDFARB ET AL
17. Kurtzberg J, Waldmann TA, Davey MP, Bigner SH, Moore
JO, Hershfield MS, Haynes BF: CD7+, CD4-, CD8- acute
leukemia: A syndrome of malignant pluripotent lymphohematopoietic cells. Blood 73:381, 1989
18. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn
GT, Mullis KB, Erlich H A Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science
239:488,1988
19. Smith DB, Johnson KS: Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione
S-transferase. Gene 67:31,1988
20. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub
H: The protein Id: A negative regulator of helix-loop-helix DNA
binding proteins. Cell 61:49,1990
21. Goldfarb AN, Wolf ML, Greenberg JM: Expression of a
chimeric helix-loop-helix gene, Id-SCL, in K562 human leukemic
cells is associated with nuclear segmentation. Am J Pathol 1992 (in
press)
22. Sorensen PHB, Mui AL-F, Murthy SC, Kqstal G: Interleukin-3, GM-CSF, and TPA induce distinct phosphorylation events
in an interleukin-3 dependent multipotential cell line. Blood
73:406, 1989
23. Aplan PD, Begley CG, Bertness V, Nussmeier M, Ezquerra
A, Coligan J, Kirsch IR: The SCL gene is formed from a
transcriptionally complex locus. Mol Cell Biol10:6426, 1990
24. Hann S, Eisenman R: Proteins encoded by the human C-myc
oncogene: Differential expression in neoplastic cells. Mol Cell Biol
4:2486, 1984
25. Mittnacht S, Weinberg R A G U S phosphorylation of the
retinoblastoma protein is associated with an altered affinity for the
nuclear compartment. Cell 65:381, 1991
26. Dang C, Lee W: Identification of the human C-myc protein
nuclear translocation signal. Mol Cell Biol8:4048, 1988
27. Tapscott SJ, Davis RL, Thayer MJ, Cheng P-F, Weintraub
H, Lassar AB: MyoD1: A nuclear phosphoprotein requiring a Myc
homology region to convert fibroblasts to myoblasts. Science
242:405,1988
28. Jen Y, Weintraub H, Benezra R: Overexpression of Id
protein inhibits the muscle differentiation program: In vivo association of Id with E2A proteins. Genes Dev 6:1466,1992
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
1992 80: 2858-2866
T-cell acute lymphoblastic leukemia--the associated gene SCL/tal
codes for a 42-Kd nuclear phosphoprotein
AN Goldfarb, S Goueli, D Mickelson and JM Greenberg
Updated information and services can be found at:
http://www.bloodjournal.org/content/80/11/2858.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.