Download Identification of a novel cis-acting element for fibroblast

Identification of a novel cis-acting element for
fibroblast-specific transcription of the FSP1 gene
HIROKAZU OKADA, THEODORE M. DANOFF, ANDREAS FISCHER,
JESUS M. LOPEZ-GUISA, FRANK STRUTZ, AND ERIC G. NEILSON
Penn Center for the Molecular Studies of Kidney Diseases,
University of Pennsylvania, Philadelphia, Pennsylvania 19104-6144
FSP1; fibroblast; transcription; cis-acting element
THE FIBROBLAST-SPECIFIC protein, FSP1, belongs to the
S100 family of intracellular calcium-binding proteins
(18, 41, 65). Members of this family have been implicated in microtubule dynamics (10, 18, 42, 54), cytoskeletal-membrane interactions (3, 18, 22, 30, 48, 50),
calcium signal transduction (18, 25), cell-cycle regulation (41), and cellular growth and differentiation (6, 9,
37, 47, 48). The FSP1 gene or its corresponding protein
(12, 26, 37) have been studied in various species (3, 15,
48, 74). The function of FSP1 is not completely understood, but its interaction with nonmuscle myosin II
(20), nonmuscle tropomyosin (67), actin (24, 66, 75), or
tubulin (42, 54), as well as its ability to facilitate
movement when transfected into cultured cells (7, 19,
29, 55), suggest that FSP1 is involved in mesenchymal
morphology and cell motility. Reports concerning the
regulation of the FSP1 gene in normal cells are few (8),
although FSP1 has been investigated as a possible
F306
metastasis-related molecule in dedifferentiated or malignant cells (69–72).
The S100 family of proteins reside in a gene cluster
on human chromosome 1q21 called the epidermal
differentiation complex (16, 46, 73) which is syntenic to
chromosome 3 in the mouse (11). The pattern of expression of the S100 proteins, like FSP1, in normal tissue
varies between the family members, but typically they
are expressed in mesenchymal or interstitial-derived
cells (3, 12, 15, 37, 65). We cloned FSP1 from a
subtractive hybridization between renal fibroblasts and
isogenic tubular epithelium and found that fibroblast
cell lines from different tissues were positive for FSP1,
whereas there was no or extremely low level expression
of FSP1 in culture-normal, nonfibroblast cells (65).
S100 genes (8, 16, 21, 41, 50, 65) are expressed in
more than one tissue, although most are restricted to
specific sets of cells. We anticipate selective regulatory
processes control their individual expression (8, 21, 38).
Tissue- (17, 57, 62) or cell-specific (5, 40, 43, 45, 51, 61)
promoters for a growing number of genes are regulated
by the modular assembly of cis-acting elements (17, 78)
in open chromatin (49) following an interaction with
lineage-specific trans-acting proteins (68). Cell-specific
expression in fibroblasts suggests that the FSP1 gene
may be controlled by mesenchymal-related transcriptional elements.
MATERIAL AND METHODS
Cell culture. The cells used in this study were derived from
mice and passaged as continuous lines using standard conditions: NIH/3T3 fibroblasts, 3T3; renal tubulointerstitial fibroblasts, TFB (2); renal proximal tubular epithelial cells, MCT
(31); and parietal yolk-sac cells, PYS-2 (63).
Transcription analysis using luciferase reporter minigenes.
Parts of the FSP1 gene have been reported (GenBank accession no. M88460) (69). Additional restriction enzyme mapping
and sequencing were performed in this region. A series of
luciferase reporter (L) minigenes were constructed bearing
various 58 fragments of the FSP1 gene. The plasmids, pF2500.L, pF-1892.L, pF-1300.L, pF-970.L, pF-463.L, pF-263.L,
pF-187.L, and pF-87.L contain genomic DNA upstream of the
transcription start site, respectively, from approximately
22500, 21892, 21300, 2970, 2463, 2263, 2187, and 287 bp.
These plasmids, as well as the first noncoding exon (167 bp
38), were placed 58 of the luciferase cDNA in pGL2b (Promega,
Madison, WI). Fragments also containing the first intron
(1159 bp) terminating immediately 58 of the translation start
site (11222 bp 38) were inserted into pGL2b, yielding pF2500.IntL, pF-1892.IntL, pF-1300.IntL, pF-970.IntL, pF463.IntL, pF-263.IntL, pF-187.IntL, and pF-87.IntL. To characterize fragments containing possible regulatory elements,
such fragments were inserted into the upstream or downstream multilinker sites of pF-263.IntL, pF-87.IntL, pGL2p,
0363-6127/98 $5.00 Copyright r 1998 the American Physiological Society
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
Okada, Hirokazu, Theodore M. Danoff, Andreas
Fischer, Jesus M. Lopez-Guisa, Frank Strutz, and Eric
G. Neilson. Identification of a novel cis-acting element for
fibroblast-specific transcription of the FSP1 gene. Am. J.
Physiol. 275 (Renal Physiol. 44): F306–F314, 1998.—The
FSP1 gene encodes a filament-binding S100 protein with
paired EF hands that is specifically expressed in fibroblasts.
This led us to look for cis-acting elements in the FSP1
promoter that might engage nuclear transcription factors
unique to fibroblasts. The first exon of FSP1 is noncoding,
therefore, a series of luciferase reporter minigenes were
created containing varying lengths of 58-flanking sequence,
the first intron, and the noncoding region of the second exon.
A position and promoter-dependent proximal element between 2187 and 288 bp was shown to be active in fibroblasts
but not in epithelium. Sequence in the first intron from 1777
to 1964 had an enhancing effect that was not cell type
specific. Hsv TK reporter constructs driven by this promoter/
intron cassette in transgenic mice were coexpressed appropriately with FSP1 in tissue fibroblasts. Gel mobility shift
competitor assays identified a novel domain, FTS-1 (fibroblast transcription site-1; TTGAT from 2177 to 2173 bp),
that specifically interacts with nuclear extracts from fibroblasts. The necessity of this binding site was confirmed by
site-specific mutagenesis. Database searches also turned up
putative FTS-1 sites in the early promoter regions of other
fibroblast expressed proteins, including the a1 and a2(I), and
a1(III) collagens and the aSM-actin gene. We hypothesize
that the selective engagement of FTS-1 elements may contribute to the mesenchymal phenotype of fibroblasts and perhaps
other dedifferentiated cells.
A REGULATORY ELEMENT IN THE FSP1 GENE
and pGl2b with various promoters: RSV from pREP4 (Invitrogen, San Diego, CA), or minimal promoters E1B and murine
alkaline phosphatase/pAP-44 (Gifts of Dr. Thomas Kadesch,
Howard Hughes Medical Institute, University of Pennsylvania). In addition, pF-187M1.IntL and pF-187M2.IntL were
similar constructs to pF-187.IntL except that the sites 2177/
2173 bp and 2151/2146 bp were mutated, respectively.
pGL2c (Promega, Madison, WI) served as a positive control.
The accuracy of all constructed plasmids were verified by
restriction enzyme mapping or sequencing.
Transient transfections were carried out using CaPO4 (1).
Six micrograms of pGL2c or isomolar amounts of sample
luciferase constructs were cotransfected with 1.5 µg of pCH110
(Pharmacia), a vector expressing b-galactosidase, into 1.0 3
105 cells plated on each well of the 6-multiwell plate. Medium
was changed 24 h later, and cells were harvested 48 h after
F307
transfection by lysis in KPO4-DTT with 1% Triton X-100.
Supernatants were assayed for luciferase activity by Lumat
LB 9501 luminometer. Each luciferase activity was normalized for b-galactosidase activity and then expressed as relative percentage of control pGL2c activity. The final values of
the luciferase activity represent the average of at least three
independent transfections 6 SE.
Mobility gel shift and competitor assay. Nuclear extracts
were prepared from 3T3, TFB, MCT, and PYS-2 cells (1).
Protein concentrations were determined using the BCA Protein Assay Reagent (Pierce), and nuclear extracts were divided into aliquots, and stored at 270°C. The probe 100–58
(2187 to 288) was created by PCR amplification of ,100 bp
region from an FSP1 genomic fragments using the flanking
oligomers as primers; 58 acgcgtCACTCACTACTTGATTGT 38
and 58 gtcgacTGTTGGTTGATGTAGTAA 38. The lower case
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
Fig. 1. Transient transfection of FSP1 minigenes in fibroblasts and tubular epithelium. Minigene reporters were
prepared using the murine FSP1 gene. The 1st exon is noncoding, and 1st intron is ,1100 bp. A: luciferase reporters
only bearing various 58 fragments of the FSP1 gene were transiently transfected into 3T3 fibroblasts and MCT
epithelium. All numbering of constructs is referenced to the number of base pairs upstream of the putative
transcription start site (11, arrows). All the constructs contain the 1st exon and end at 167 bp. B: constructs here
are similar to those in A except these contain the 1st intron in native orientation in addition to the 58 promoter
sequences; all constructs ended at 11222 bp. In contrast to the constructs lacking the 1st intron, the 1st
intron-containing constructs (pF-2500.IntL, pF-263.IntL, and pF-187.IntL) showed strong luciferase activities in
fibroblasts and weaker expression in tubular epithelium. The strong luciferase activity of these intron-containing
reporters drops off in fibroblasts with the deletion of 2187/288 bp (pF-187.IntL vs. pF-87.IntL; P # 0.001).
Activities of each construct in MCT tubular epithelium were similar [P 5 not significant (NS)]. Luciferase activity of
each reporter in all experiments was normalized for transfection efficiency using b-galactosidase activity and then
expressed as relative percentage of control pGL2c activity.
F308
A REGULATORY ELEMENT IN THE FSP1 GENE
M sodium acetate, 0.05 M magnesium acetate, 1 mM EDTA,
and 0.1 mg/ml yeast tRNA. Modified probes were precipitated
with ethanol, washed, dried, and resuspended in 10 mM
Tris · HCl, pH 7.5, and 1 mM EDTA. Nuclear extracts (0 and
10 µg) were incubated with 105 cpm of probe in the presence of
poly-d(I-C) for 30 min at 4°C in a 25 µl of binding buffer. The
samples were electrophoresed through a 5% polyacrylamide
gel in low ionic running buffer. The wet gels were exposed to
X-ray film for overnight, and the free probe and the proteinbound probes were recovered by DEAE membrane method
(39). The recovered samples were cleaved at the positions of
the modifications. To display methylated purines, DNA was
heated at 90°C in 10% piperidine for 30 min. Subsequently,
the samples were lyophilized in a vacuum evaporator until
dry. Addition of 30 µl of water, freezing, and lyophilizing were
repeated twice. Positions of the cleavages were determined by
running through the 7% polyacrylamide/8 M urea gel in TBE
running buffer (89 mM Tris base, 89 mM boric acid, and 2 mM
EDTA). The sample of the G1A reaction of the MaxamGilbert sequencing technique (60) was also run simultaneously as the marker. The gel was dried and exposed to film.
Immunohistochemistry of transgenic mice. A second reporter minigene consisting of 22500/11222 bp of the FSP1
promoter, which is the same as pF-2500.IntL shown in Fig. 1,
driving the herpes simplex virus thymidine kinase (Hsv TK)
cDNA, was assembled (pFSP1.tk) for injection. Blastocysts
were injected with pFSP1.tk, and subsequently two lines
were established and bred against SJL mice. Adult mice were
killed, and their organs were fixed in 4% paraformaldehyde.
Immunohistochemistry on 4-µm tissue sections was carried
Fig. 2. Position and orientation effects of the 58 fragment from 2187/288 bp on the activity of native minimal 58
promoter (287/167 bp) plus 1st intron in fibroblasts and tubular epithelium. Sequence between 2187 and 288 bp
increased the transcriptional activity in fibroblasts more than in epithelium when it was located in its native
orientation (pF-87.IntL vs. pF-87.IntL; P # 0.001), less so in its reverse orientation [pF(2187/288)R-87.IntL vs.
pF-87.IntL; P # 0.05], and not at all when the 2187/288 bp fragment was located downstream of the 1st intron, but
in native orientation [pF-87.IntL(2187/288) vs. pF-87.IntL P 5 NS]. Activities of each construct in MCT tubular
epithelium were similar (P 5 NS). Luciferase activity of each reporter in all experiments was normalized for
transfection efficiency using b-galactosidase activity and then expressed as relative percentage of control pGL2c
activity.
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
letters represent restriction sites to facilitate cloning. The
amplicon was cloned into the vector pCRII (Invitrogen) and
later digested with appropriate restriction enzymes leaving
58 overhangs which were dephosphorylated with calf intestinal alkaline phosphatase. This fragment was end-labeled
with [g-32P]ATP using T4 kinase, generating a probe for gel
shift assays (1). In addition, short fragments of 50 bp and
20–25 bp within region 100–58, with or without mutations,
were synthesized for use as competitive oligomers. A quantity
of 104 cpm of probe was incubated with 10 µg of nuclear
extract in the presence of poly-d(I-C) and competitor oligomers as indicated, 12% glycerol, 10 mM Tris (pH 7.5), 100 mM
KCl, 5 mM MgCl2, 1 mM DTT, 1 mM EDTA, 300 µg/ml BSA,
and 0.1% Triton X-100 in a 25-µl volume for 30 min at 4°C.
Reaction mixtures were electrophoresed through a 5% polyacrylamide gel in low ionic running buffer [6.7 mM Tris (pH
7.5), 3.3 mM sodium acetate, and 1 mM EDTA]. Dried gels
were exposed to X-ray film at 270°C with an intensifying
screen.
Methylation interference assay. Methylation interference
assay was minimally modified from Hendrickson and Schleif
(35). The 100–58 was excised with Mlu I and Sal I from the
pCRII plasmid and end-labeled with [32P]dCTP and [32P]dGTP,
or [32P]dCTP and [32P]TTP, respectively, using Klenow fragment, yielding 1/2 strand probes. Purines were methylated
by adding 1 µl of dimethyl sulfate to the DNA probe in 200 µl
of a solution of 50 mM sodium cacodylate (pH 8.0), 10 mM
MgCl2, and 0.1 mM EDTA and incubating for 5 min at room
temperature. This reaction was stopped by adding 50 µl of a
solution of 1 M Tris · HCl (pH 7.5), 1 M 2-mercaptoethanol, 1.5
F309
A REGULATORY ELEMENT IN THE FSP1 GENE
out using polyclonal anti-FSP1 antibodies (65) and antithymidine kinase antibodies (provided by W. C. Summers,
Yale University) developed by the ABC-peroxidase method
(Vectastain Elite ABC kit; Vector Laboratories, Burlingame,
CA).
Statistics. In some experiments statistics were performed
using Student’s t-test.
RESULTS
32P-labeled
100-58
100-bp (2187/288) probe
58 CACTCACTACTTGATTGTGCCTGCTGGGGAGGGAGCAGGAAGCCTGGTTCCCAGACTGGGCTGGTCGAGGGTGCTATG
ACATTTACTACATCAACCAACA 38
Competitor 50-bp oligomers
C1/2(50) 58 CACTCACTACTTGATTGTGCCTGCTGGGGAGGGAGCAGGAAGCCTGGTTC 38
C2/3(50) 58 GGGGAGGGAGCAGGAAGCCTGGTTCCCAGACTGGGCTGGTCGAGGGTGCTA 38
C3/4(50) 58 CGAGACTGGGCTGGTCGAGGGTGCTATGACATTTACTACATCAACAACA 38
Competitor 25-bp oligomers
C1(25)
C2(25)
C3(25)
C4(25)
58
58
58
58
CACTCACTACTTGATTGTGCCTGCT 38
GGGGAGGGAGCAGGAAGCCTGGTTC 38
CCAGACTGGGCTGGTCGAGGGTGCTA 38
TGACATTTACTACATCAACCAACA 38
M1-1
M1-2
M1-3
M1-4
M1-5
58
58
58
58
58
TGTCTACTACTTGATTGTGCCTGCT
CACTCGTCGTTTGATTGTGCCTGCT
CACTCACTACCCAGCTGTGCCTGCT
CACTCACTACTTGATCACATCTGCT
CACTCACTACTTGATTGTGCTCATC
Mutated competitor 25-bp oligomers
38
38
38
38
38
32P-Labeled probe 100-58 was incubated with nuclear extract alone
or with 200-fold molar excess of an unlabeled, double-stranded
oligonucleotides as a competitor. Competitors [C1/2(50), C2/3(50),
C3/4(50), C1(25), C2(25), C3(25), and C4(25)] consist of partial
sequences of the native 100 bp of 100-58, and mutated competitors
(M1-1, -2, -3, -4, and -5) have serial 5 nucleotide substitutes (shown in
boldface letters) within the native 25 bps of C1(25).
were resequenced for comparison with the reported
sequence (71). Only one discrepancy was found; 2142
to 2140 bp is GGT instead of AGA. All sequences,
competitors, and mutants used for the shift assays are
listed in Table 1. Nuclear extracts prepared from 3T3
fibroblasts and MCT epithelium were compared in
shifts (Fig. 3) using a 32P-labeled 100-bp probe spanning 2187 to 288 bp (100–58). The minor band marked
by the solid arrow in Fig. 3 was consistently present in
fibroblasts, and all the bands observed in this gel shift
assay were completely quenched in the presence of a
200-fold molar excess of unlabeled probe (Fig. 4A).
Other gel shifts using the same 100–58 probe and
nuclear extracts from TFB fibroblasts and PYS-2 endoderm demonstrated the same set of shifted bands only
with fibroblasts (data not shown).
To localize the protein DNA-binding site, synthesized
oligomers within 100–58 were employed as competitors
(Table 1) in gel shifts under similar conditions as
reported above. Among the 50-bp competitive oligomers
employed in this study, only the 58 fragment C1/2(50)
could prevent probe retardation, suggesting that the 58
end of the 100-bp probe is important for binding (data
not shown). Subsequently, a 25-bp oligomer from 2187
to 2162 bp, C1(25), competed out the shifted band
created by 100–58 probe with fibroblast extract, whereas
an adjacent 25-bp oligomer could not (Fig. 4A). By
repeating the competition with a series of mutant
oligomers made from C1(25), we observed that mutant
M1–3 failed to abolish the shifted band, indicating that
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
Functional characterization of cis-acting regulatory
elements in the flanking regions of the murine FSP1
promoter. Since murine transcripts encoding FSP1 are
predominantly seen in fibroblasts (65), we began looking for the cis-acting elements responsible for restricting transcription to these cells. Figure 1 shows a
restriction map of the murine FSP1 gene. In the first
set of constructs (Fig. 1A), a series of luciferase reporters (L) were assembled using a 58 EcoR I-Nhe I fragment (around 22500/167 bp) and its subfragments all
ending at 167 bp. Transfection of these constructs
demonstrated significantly greater expression in 3T3
fibroblasts than in MCT epithelium. This finding is
consistent with transfection results using other tissue
fibroblasts and nonfibroblast cells (65); data not shown.
A second set of luciferase constructs were assembled
by adding the 1st intron with the splice donor and
acceptor sequences in native configuration (Int) to the
constructs used above. Overall the expression of FSP1
promoter (Fig. 1B) in 3T3 fibroblasts was greatly
enhanced by the addition of the first intron compared
with the intronless promoters (pF-2500.L, pF-263.L,
pF-187.L, and pF-87.L) described in Fig. 1A. This
enhancement was also seen to proportionally affect
epithelial cells and therefore was not cell lineage
specific. Subsequent experiments isolated this enhancement to a discrete region in the first intron (1777 to
1964 bp; data not shown). Of special note in Fig. 1B
was the strong luciferase activity of pF-187.IntL in
fibroblasts, which fell to levels registered in epithelium
with the promoter deletion of 2187 to 288 bp (pF187.IntL vs. pF-87.IntL; P # 0.001), suggesting this
proximal region spanning 2187 to 288 is important to
the fibroblast phenotype. All of the transfection experiments in MCT epithelium were confirmed using several
other nonfibroblastic cell lines (data not shown).
We next created a series of constructs in which the
putative fibroblast-specific promoter-proximal fragment (2187 to 288 bp) was placed either upstream or
downstream of pF-87.IntL in the reverse and native
orientation, generating pF(2187/288)R-87.IntL and
pF-87.IntL(2187/288), respectively. In Fig. 2 this fragment increased the transcriptional activity in 3T3
fibroblasts best when it was located at the upstream,
native orientation (pF-187.IntL P # 0.001), somewhat
less in the reverse upstream position (pF(2187/288)R87.IntL; P # 0.05), and not at all when located downstream in a forward orientation [pF-87.IntL(2187/
288); P 5 not significant (NS)].
Mapping a proximal element in the 58-flanking region
of the FSP1 promoter. Both strands of the FSP1 promoter region contained within the construct pF-187.L
Table 1. Gel shift oligomers
F310
A REGULATORY ELEMENT IN THE FSP1 GENE
the base pairs changed in this oligomer were critical for
the binding of the fibroblast nuclear factors (Fig. 4B).
Thus a core binding site was approximately localized to
58 TTGAT 38, from 2177 to 2173 bp in the promoter of
Fig. 4. Competition gel shift analysis of
nuclear extracts from fibroblasts. A: all shifted
bands seen in lane 2 were abolished in lane 3
by cold 100–58 fragment (see Table 1 for
description of competitors). Band shifted in
fibroblast (indicated by arrow for lane 2) was
attenuated by the C1(25) inhibitor (lane 4) but
not by other 25-mer competitors (lanes 5–7).
B: competition gel shift analysis of nuclear
extract from fibroblasts using mutated competitors. Band shifted in fibroblasts (indicated
by arrow, in lane 2) was competed out, not
only by intact C1(25) (lane 3) but also by
mutated C1(25) competitors, M1–1, -2, -4, and
-5 (lanes 4, 5, 7, and 8, respectively). In
contrast, mutated competitor M1–3 did not
attenuate this shifted band (lane 6).
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
Fig. 3. Gel shift of 3T3 (fibroblast) and MCT (tubular epithelium)
nuclear extracts. 100–58 probe (see Table 1 for description of competitors) was incubated with 3T3 (lanes 2–6) or MCT (lanes 7–11)
nuclear extracts with varying amounts of poly-d(I-C) ( 0, 1, 3, 6, and
10 µg, respectively). Free probe showed no shifted bands (lane 1).
Band seen in fibroblasts but not epithelium, is indicated by the arrow.
FSP1. Tandem repeats of fragment 2182 to 2168 were
cloned into 58 sites in front of various heterologous
promoters. This tandem repeat region as well as cisfragment 2187 to 287 was unable, however, to enhance heterologous promoter function in fibroblasts
compared with native promoter, pF-187.IntL (data not
shown), suggesting the candidate elements were promoter dependent.
A methylation interference assay was then performed using a gel cutout of this specific, shifted band
as template (data not shown). The 2177 to 2173 region
is AT-rich and only contains one potential interference
site. No interference was observed for the G at 2175
and other Gs flanking this core sequence, suggesting
they are not important for local protein-DNA binding.
Another shifted band from that region containing an
Ets-like site 58 TCTGGGAA 38, which was detected in
gel shift assays under different conditions but proved
not to be functional in fibroblast transfections, produced a positive interference reaction as control. Single
base mutations of the G at 2175 did not inhibit
competition in the gel shift further, suggesting that the
G base was not critical (data not shown).
To further address the authenticity of the putative
cis-acting element defined by M1–3, an identical mutation was introduced into the luciferase reporter construct (pF-187.M1IntL), and a new set of transient
transfections were carried out. In Fig. 5, the fibroblastspecific transcriptional activity of pF-187.M1–3IntL
was reduced back to the level of the minimal promoter
pF-87.IntL compared with the native construct, pF187.IntL (P # 0.001). A mutation at 2151 bp, which did
not compete for gel shift, also did not affect the luciferase activity (pF-187.M2IntL).
A REGULATORY ELEMENT IN THE FSP1 GENE
F311
A larger pF-2500.M1–3IntL construct containing the
M1–3 mutation also reduced transcription by 30%
compared with wild-type sequence (data not shown).
Putative regulatory elements of the FSP1 gene are
active in transgenic mice. The FSP1 gene fragment
containing the promoter and intronic elements used in
the pF-2500.IntL minigene (Fig. 1; around 22500 to
11222 bp) were next used to drive Hsv TK cDNA
(pFSP1.tk) in transgenic mice. The distribution of Hsv
TK was concordant with FSP1 expression in all tissue
examined (data not shown; unpublished observations).
Kidney tissue harvested from transgenic progeny was
stained by immunohistochemistry (Fig. 6); interstitial
cells staining for Hsv TK were also positive for FSP1
protein using a serial section analysis. Two lines of
transgenic mice demonstrated the same result in kidney, although data from only one of the two are shown.
Sections from the nontransgenic littermates stained
positive for FSP1 protein, but were negative for Hsv TK
amplicons, and did not stain for Hsv TK protein (data
not shown).
DISCUSSION
The mechanisms regulating the bidirectional transformation of epithelium and mesenchyme are not fully
known, although a number of processes have been
proposed (34). It is likely that a combination of morphogenic cues including adhesion, matrix, and paracrine
stimulation work in combination to activate genes that
alter and then stabilize cell phenotype (34, 77). We have
approached this issue by looking at the regulation of
the FSP1 gene in fibroblasts (65). The FSP1 gene was
isolated by subtractive hybridization between murine
renal fibroblasts and isogenic epithelium (65). The
expression of the FSP1 gene in nonmalignant cells in
Fig. 6. Immunohistochemistry with polyclonal anti FSP1 antibodies,
anti-thymidine kinase antibodies, and ABC-peroxidase method on
serial sections of the kidney of transgenic mice bearing pFSP1.tk. In
these animals, thymidine kinase (TK) is expressed under the control
of the FSP1 regulatory cassette. A: arrows indicate FSP1-positive cells in the renal interstitium. B: arrowheads indicate TKpositive cells in the next section to the one shown in A, suggesting
that same renal interstitial fibroblasts expressed FSP1 as well as
TK in these animal. Magnification, 3150. Counterstained with
hematoxylin.
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
Fig. 5. Effects of discrete mutations in
the 2187 to 288 bp proximal regulatory region on the native 58 minimal
promoter (287 to 167 bp) plus the 1st
intron in fibroblasts and tubular epithelium. Whereas the luciferase minigene
reporter with mutations between 2151
to 2146 bp (pF-187M2.IntL) demonstrated activity in fibroblasts comparable to that of the native construct
pF-187.IntL, a mutation in the putative
consensus sequence (2177 to 2173 bp)
in pF-187.M1–3IntL dropped the luciferase activity in 3T3 cells to the level of
pF-87.IntL (P # 0.001). Activities of
each construct in MCT tubular epithelium were similar (P 5 NS). Luciferase
activity of each reporter in all experiments was normalized for transfection
efficiency using b-galactosidase activity
and then expressed as relative percentage of control pGL2c activity.
F312
A REGULATORY ELEMENT IN THE FSP1 GENE
perhaps the parallel processes in mature cells from
adult tissues (32, 34, 44, 53, 76). The future identification of trans-acting factors that bind to elements like
FTS-1 should bring us even closer to understanding the
plasticity of cell transformation, the modular control of
mesenchymal phenotypes, and the gating necessary to
selectively engage tissue fibroblasts during organ fibrosis. FSP1 is a critical part of this fibrogenic program,
and its role in renal fibrosis is gradually unfolding (52).
This work was supported in part by National Institute of Diabetes
and Digestive and Kidney Diseases Grants DK-07006, DK-30280,
DK-41110, DK-02334, and DK-45191 and by administrative/educational funds from the DCI RED Fund. H. Okada was a recipient of a
fellowship from Eli-Lilly Japan and received financial support from
Takeda Science Foundation. F. Strutz was supported by Deutsche
Forschungsgemeinschaft Str 388/1–1. A. Fischer was a recipient of a
grant from the Swiss National Foundation for Scientific Research
and received support from Roche Research Foundation, Ciba-Geigy
Jubilaeumsstiftung, and Janggen-Poehn Foundation.
Address for reprint requests: E. G. Neilson, C. Mahlon Kline
Professor of Medicine, Penn Center for Molecular Studies of Kidney
Diseases, 700 Clinical Research Bldg., Univ. of Pennsylvania, 415
Curie Boulevard, Philadelphia, PA 19104-6144.
Received 21 July 1997; accepted in final form 30 April 1998.
REFERENCES
1. Albert, S. E., F. Strutz, K. Shelton, T. Haverty, M. J. Sun, S.
Li, A. Denham, R. A. Maki, and E. G. Neilson. Characterization of a cis-acting regulatory element which silences expression
of the class II-A beta gene in epithelium. J. Exp. Med. 180:
233–240, 1994.
2. Alvarez, R. J., M. J. Sun, T. P. Haverty, R. V. Iozzo, J. C.
Meyers, and E. G. Neilson. Biosynthetic and proliferative
characteristics of tubulointerstitial fibroblasts probed with paracrine cytokines. Kidney Int. 41: 14–23, 1992.
3. Barraclough, R., R. Kimbell, and P. S. Rudland. Increased
abundance of a normal cell mRNA sequence accompanies the
conversion of rat mammary cuboidal epithelial cells to elongated
myoepithelial-like cells in culture. Nucleic Acids Res. 21: 8097–
8114, 1984.
4. Birchmeier, C., and W. Birchmeier. Molecular aspects of
mesenchymal-epithelial interactions. Annu. Rev. Cell Biol. 9:
511–540, 1993.
5. Bohinski, R. J., J. A. Huffman, J. A. Whitsett, and D. L.
Lattier. Cis-active elements controlling lung cell-specific expression of human pulmonary surfactant protein B gene. J. Biol.
Chem. 268: 11160–11166, 1993.
6. Calabretta, B., R. Battini, L. Kaczmarek, J. K. de Riel, and
R. Baserga. Molecular cloning of the cDNA for a growth
factor-inducible gene with strong homology to S-100, a calciumbinding protein. J. Biol. Chem. 261: 12628–12632, 1986.
7. Davies, B. R., M. P. A. Davies, F. E. M. Gibbs, R. Barraclough, and P. S. Rudland. Induction of the metastatic phenotype by transfection of a benign rat mammary epithelial cell line
with the gene for p9Ka, a rat calcium-binding protein, but not
with the oncogene EJ-ras-1. Oncogene 8: 999–1008, 1993.
8. Davies, M., S. Harris, P. Rudland, and R. Barraclough.
Expression of the rat, S-100-related, calcium-binding protein
gene, p9Ka, in transgenic mice demonstrates different patterns
of expression between these two species. DNA Cell Biol. 14:
825–832, 1995.
9. De, Leon, M., L. J. Van Eldik, and E. M. Shooter. Differential
regulation of S100 beta and mRNAs coding for S100-like proteins
(42A and 42C) during development and after lesion in rat sciatic
nerve. J. Neurosci. Res. 29: 155–162, 1991.
10. Donato, R., F. Battaglia, and D. Cocchia. Characteristics of
the effect of S-100 proteins on the assembly-disassembly of brain
microtubule proteins at alkaline pH in vitro. Cell Calcium 8:
299–313, 1986.
11. Dorin, J. R., E. Emslie, and V. van Heyningen. Related
calcium-binding proteins map to the same subregion of chromo-
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
mice is exclusively observed in fibroblasts (26, 37, 65).
However, the expression of FSP1 homologs in other
species or in malignant cells may have a different
distribution (8, 12, 15, 23, 28, 48, 74).
Although it has recently been suggested that the
58-flanking fragments of the FSP1 gene play no part in
its expression in tumor cells (69, 71), their control in
cultured fibroblasts has not been explored. In the
current study using several murine fibroblasts and
nonfibroblast cells, we observed that the 58 cis-acting
element 58 TTGAT 38 between 2177 and 2173 bp is
critical in fibroblast-specific transcription of the FSP1
gene. Consequently, we refer to this position and promoter-dependent proximal element as FTS-1 (fibroblast transcription site-1). FTS-1 activity is greatly
augmented by universal activity located in the first
intron (between 1777 and 1964 bp). Our findings are
consistent with the observation that promoter sequences in other members of S100 superfamily contain
their own cell-specific regulatory elements (38). There
seems to be a difference in the pattern of expression of
the FSP1 gene in two closely related species, mouse and
rat (8). Although 58-flanking sequence of the rat FSP1
gene is not reported, we surmise that differences in the
controlling regions may explain why they are differentially expressed in the two rodent species.
Finally, a reporter minigene containing the native
FTS-1 element as well as other control regions of the
FSP1 gene coexpressed only in FSP11 tissue fibroblasts
in transgenic mice. A further search of genomic databases with the novel FTS-1 sequence identified identical sites in the early promoter regions of other fibroblastrelevant genes such as a1 and a2(I), and a1(III)
procollagens, as well as the aSM-actin gene. These
latter genes are typically engaged with some exclusivity by activated fibroblasts (27, 56, 64). Although the
presence of FTS-1 sequence in the regulatory regions of
these genes only promotes speculation, it is of interest
that two FTS-1 sites are present at positions 21707
and 2954 bp in the cis-acting cassette required for
cell-specific transcription of a1(I) procollagen in skin
and tendon fibroblasts in transgenic mice (36, 59).
Similar findings were observed in transgenic mice
expressing a2(I) procollagen minigenes, where the promoter region between 22000 and 2350 bp was required for expression in most type I collagen-containing
cells (51); an FTS-1 site is also present in that gene at
position 2752 bp. Finally, an FTS-1 site was not
observed in the a1(I) procollagen promoter region (21656
to 21540 bp) that confers high level, specific expression
in osteoblasts (58). These findings are all consistent
with the special effect of FTS-1 sites on the definition of
a fibroblast.
Phenotypic conversions between epithelium and mesenchyme follow a bidirectional pathway during early
pattern formation as well as later during the specialization and development of organ tissue (4, 13, 14, 32–34).
The dedifferentiation of somatic cells during oncogenesis (19, 44, 59) or the mesenchymalization of epithelium during episodes of fibrogenesis (65) following
wounding (51, 64) or inflammation (27, 53, 56) are
A REGULATORY ELEMENT IN THE FSP1 GENE
12.
13.
14.
15.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31. Haverty, T. P., C. J. Kelly, W. H. Hines, P. S. Amenta, M.
Watanabe, R. A. Harper, N. A. Kefalides, and E. G. Neilson.
Characterization of a renal tubular epithelial cell line which
secretes the autologous target antigen of autoimmune experimental interstitial nephritis. J. Cell Biol. 107: 1359–1367, 1988.
32. Hay, E. D. Epithelial-mesenchymal transitions. Semin. Dev.
Biol. 1: 347–356, 1990.
33. Hay, E. D. Extracellular matrix alters epithelial differentiation.
Curr. Opin. Cell Biol. 5: 1029–1035, 1993.
34. Hay, E. D., and A. Zuk. Transformations between epithelium
and mesenchyme: normal, pathological, and experimentally induced. Am. J. Kidney Dis. 26: 678–690, 1995.
35. Hendrickson, W., and R. Schleif. A dimer of AraC protein
contacts three adjacent groove regions of the araI DNA site. Proc.
Natl. Acad. Sci. USA 82: 3129–3133, 1985.
36. Houglum, K., M. Buck, J. Alcorn, S. Contreras, P. Bornstein, and M. Chojkier. Two different cis-acting regulatory
regions direct cell-specific transcription of the collagen alpha 1(I)
gene in hepatic stellate cells and in skin and tendon fibroblasts.
J. Clin. Invest. 96: 2269–2276, 1995.
37. Jackson-Grusby, L. L., J. Swiergiel, and D. I. H. Linzer. A
growth-related mRNA in cultured mouse cells encodes a placental calcium binding protein. Nucleic Acids Res. 15: 6677–6690,
1987.
38. Jiang, H., S. Shah, and D. C. Hilt. Organization, sequence, and
expression of the murine S100beta gene. J. Biol. Chem. 268:
20502–20511, 1993.
39. Karp, S. L., T. Kieber-Emmons, M. J. Sun, G. Wolf, and E. G.
Neilson. Molecular structure of a cross-reactive idiotype on
autoantibodies recognizing parenchymal self. J. Immunol. 150:
867–879, 1993.
40. Keech, C. A., and A. Gutierrez-Hartmann. Analysis of rat
prolactin promoter sequences that mediate pituitary-specific and
38,58-cyclic adenosine monophosphate-regulated gene expression
in vivo. Mol. Endocrinol. 3: 832–839, 1989.
41. Kligman, D., and D. N. Hilt. The S100 protein family. Trends
Biochem. Sci. 13: 437–443, 1988.
42. Lakshmi, M. S., C. Parker, and G. V. Sherbet. Metastasis
associated mts1 and nm23 genes affect tubulin polymerisation in
B16 melanomas: a possible mechanism of their regulation of
metastatic behaviour of tumours. Anticancer Res. 13: 299–304,
1993.
43. Liebhaber, S. A., Z. Wang, F. E. M. Cash, B., and J. E.
Russell. Developmental silencing of the embryonic g-globin
gene: region combined with stage-specific silencing by the transcribed segment. Mol. Cell Biol. In press.
44. Liotta, L. A., P. S. Steeg, and W. G. Stetler-Stevenson.
Cancer metastasis and angiogenesis: an imbalance of positive
and negative regulation. Cell 64: 327–336, 1991.
45. Liu, J. K., C. M. DiPersio, and K. S. Zaret. Extracellular
signals that regulate liver transcription factors during hepatic
differentiation in vitro. Mol. Cell. Biol. 11: 773–84, 1991.
46. Maestrini, E., A. P. Monaco, J. A. McGrath, A. IshidaYamamoto, C. Camisa, A. Hovnanian, D. E. Weeks, M.
Lathrop, J. Uitto, and A. M. Christiano. A molecular defect in
loricrin, the major component of the cornified cell envelope,
underlies Vohwinkel’s syndrome. Nat. Genet. 13: 70–77, 1996.
47. Marks, A., D. Petsche, D. O’Hanlon, P. C. Kwong, R. Stead,
R. Dunn, R. Baumal, and S. K. Liao. S100 protein expression
in human melanoma cells: comparison of levels of expression
among different cell lines and individual cells in different phases
of the cell cycle. Exp. Cell Res. 187: 59–64, 1990.
48. Masiakowski, P., and E. M. Shooter. Nerve growth factor
induces the genes for two proteins related to a family of calciumbinding proteins in PC12 cells. Proc. Natl. Acad. Sci. USA 85:
1277–1281, 1988.
49. McPherson, C. E., R. Horowitz, C. L. Woodcock, C. Jiang,
and K. S. Zaret. Nucleosome positioning properties of the
albumin transcriptional enhancer. Nucleic Acids Res. 24: 397–
404, 1996.
50. Murao, S. Two calcium-binding proteins, MRP8 and MRP14: a
protein complex associated with neutrophil and monocyte activation. Acta Histochem. Cytochem. 27: 108–116, 1994.
51. Niederreither, K., R. N. D’Souza, and B. De Crombrugghe.
Minimal DNA sequences that control the cell lineage-specific
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
16.
some 1q and to an extended region of synteny on mouse chromosome 3. Genomics 8: 420–426, 1990.
Ebralidze, A., E. Tulchinsky, M. Grigorian, A. Afanasyeva,
V. Senin, E. Revazova, and E. Lukanidin. Isolation and
characterization of a gene specifically expressed in different
metastatic cells and whose deduced gene product has a high
degree of homology to a Ca21-binding protein family. Genes Dev.
3: 1086–1093, 1989.
Ekblom, P. Developmentally regulated conversion of mesenchyme to epithelium. FASEB J. 3: 2141–2150, 1989.
Ekblom, P., M. Ekblom, L. Fecker, G. Klein, H. Zhang, Y.
Kodoya, M. L. Chu, U. Mayer, and R. Timpl. Role of mesenchymal nidogen for epithelial morphogenesis in vitro. Development
20: 2003–2014, 1994.
Engelkamp, D., B. W. Schaefer, P. Erne, and C. W. Heizmann. S100alpha, CAPL, and CACY: molecular cloning and
expression analysis of three calcium-binding proteins from human heart. Biochemistry 31: 10258–10264, 1992.
Engelkamp, D., B. W. Schaefer, M. G. Mattei, P. Erne, and
C. W. Heizmann. Six S100 genes are clustered on human
chromosome 1q21: Identification of two genes coding for the two
previously unreported calcium-binding proteins S100D and
S100E. Proc. Natl. Acad. Sci. USA 90: 6547–6551, 1993.
Evans, T., G. Felsenfeld, and M. Reitman. Control of globin
gene transcription. Annu. Rev. Cell Biol. 6: 95–124, 1990.
Fano, G., S. Biocca, S. Fulle, M. A. Mariggio, S. Belia, and P.
Calissano. The S-100: a protein family in search of a function.
Prog. Neurobiol. 46: 71–82, 1995.
Ford, H. L., M. M. Salim, R. Chakravarty, V. Aluiddin, and
S. B. Zain. Expression of Mts1, a metastasis-associated gene,
increases motility but invasion of a nonmetastatic mouse mammary adenocarcinoma cell line. Oncogene 10: 2067–2075, 1995.
Ford, H. L., and S. B. Zain. Interaction of metastasis associated
Mts1 protein with nonmuscle myosin. Oncogene 10: 1597–1605,
1995.
Friend, W. C., S. Clapoff, C. Landry, L. E. Becker, D.
O’Hanlon, R. J. Allore, I. R. Brown, A. Marks, J. Roder, and
R. J. Dunn. Cell-specific expression of high levels of human
S100beta in transgenic mouse brain is dependent on gene
dosage. J. Neurosci. 12: 4337–4346, 1992.
Gerke, V. A. K. W. The regulatory chain in the p36-kd substrate
complex of viral tyrosine-specific protein kinases is regulated in
sequence to the S-100. EMBO J. 4: 2917–2920, 1985.
Gibbs, F. E., R. Barraclough, A. Platt-Higgins, P. S. Rudland, M. C. Wilkinson, and E. W. Parry. Immunocytochemical
distribution of the calcium-binding protein p9Ka in normal rat
tissue: variation in the cellular location in different tissues. J.
Histochem. Cytochem. 43: 169–180, 1995.
Gibbs, F. E. M., M. C. Wilkinson, P. S. Rudland, and R.
Barraclough. Interaction in vitro of p9Ka, the rat s-100-related,
metastasis-inducing, calcium-binding protein. J. Biol. Chem.
269: 18992–18999, 1994.
Glenney, J. R., M. S. Kindy, and L. Zokas. Isolation of a new
member of the S100 protein family: amino acid sequence, tissue,
and subcellular distribution. J. Cell Biol. 108: 569–578, 1989.
Goto, K., H. Endo, and T. Fujiyoshi. Cloning of the sequences
expressed abundantly in established cell lines: identification of a
cDNA clone highly homologous to S-100, a calcium binding
protein. J. Biochem. 103: 48–53, 1988.
Gressner, A. M. Transdifferentiation of hepatic stellate cells (Ito
cells) to myofibroblasts: a key event in hepatic fibrogenesis.
Kidney Int. 49: S39–345, 1996.
Grigorian, M., E. Tulchinsky, O. Burrone, S. Tarabykina,
G. Georgiev, and E. Lukanidin. Modulation of mts1 expression in mouse and human normal and tumor cells. Electrophoresis 15: 463–468, 1994.
Grigorian, M. S., E. M. Tulchinsky, S. Zain, A. K. Ebralidze,
D. A. Kramerov, M. V. Kriajevska, G. P. Georgiev, and E. M.
Lukanidin. The mts1 gene and control of tumor metastasis.
Gene 135: 229–238, 1993.
Hagiwara, M., M. Ochiai, K. Owada, T. Tanaka, and H.
Hidaka. Modulation of tyrosine phosphorylation of p36 and
other substrates by the S100 protein. J. Biol. Chem. 263:
6438–6411, 1988.
F313
F314
52.
53.
54.
55.
56.
58.
59.
60.
61.
62.
63.
64.
65.
expression of the pro a2(I) collagen promoter in transgenic mice.
J. Cell Biol. 119: 1361–1370, 1992.
Okada, H., T. M. Danoff, R. Kalluri, and E. G. Neilson. The
early role of FSP1 in epithelial-mesenchymal transformation.
Am. J. Physiol. 273 (Renal Physiol. 42): F563–F574, 1997.
Okada, H., F. Strutz, T. M. Danoff, R. Kalluri, and E. G.
Neilson. Possible mechanisms of renal fibrosis. Contrib. Nephrol.
118: 147–154, 1996.
Parker, C., M. S. Lakshmi, B. Piura, and G. V. Sherbet.
Metastasis-associated mts1 gene expression correlates with increased p53 detection in the B16 murine melanoma. DNA Cell
Biol. 13: 343–351, 1994.
Parker, C., P. A. Whittaker, B. A. Usmani, M. S. Lakshmi,
and G. V. Sherbet. Induction of 18A2/mts1 gene expressin and
its effects on metastasis and cell cycle control. DNA Cell Biol. 13:
1021–1028, 1994.
Phan, S. H. Role of the myofibroblast in pulmonary fibrosis.
Kidney Int. 49: S46–S48, 1996.
Pinkert, C. A., D. M. Ornitz, R. L. Drinster, and R. D.
Palmiter. An albumin enhancer located 10 Kb upstream functions along with its promoter to direct efficient, liver-specific
expression in transgenic mice. Genes Dev. 1: 268–276, 1987.
Rossert, R. A., S. S. Chen, H. Eberspaecher, C. N. Smith,
and B. De Crombrugghe. Identification of a minimal sequence
of the mouse pro-a1(I) collagen promoter that confers high-level
osteoblast expression in transgenic mice and that binds a protein
selectively present in osteoblasts. Proc. Natl. Acad. Sci. USA 93:
1027–1031, 1996.
Rossert, R. A., H. Eberspaecher, and B. De Crombrugghe.
Separate cis-acting DNA elements of the mouse pro-a1(I) collagen promoter direct expression of reporter genes to different type
I collagen-producing cells in transgenic mice. J. Cell Biol. 129:
1421–1432, 1995.
Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory, 1989.
Schlaeger, T. M., Y. Qin, Y. Fujiwara, J. Magram, and T. N.
Sato. Vascular endothelial cell lineage-specific promoter in transgenic mice. Development 121: 1089–98, 1995.
Sen, R., and D. Baltimore. Factors regulating immunoglobulin
gene transcription. In: Immunoglobulin Genes, edited by T.
Honjo, F. W. Alt and T. H. Rabbits. London: Academic, 1989, p.
327–344.
Strickland, S., K. K. Smith, and K. R. Marotti. Hormonal
induction of differentiation in teratocarcinoma stem cells: generation of parietal endoderm by retinoic acid and dibutyl cAMP. Cell
21: 347–355, 1980.
Strutz, F., and E. G. Neilson. Transdifferentiation: a new angle
on renal fibrosis. Exp. Nephrol. 4: 267–270, 1996.
Strutz, F., H. Okada, C. W. Lo, T. M. Danoff, R. L. Carone,
J. E. Tomaszewski, and E. G. Neilson. Identification and
characterization of a fibroblast marker: FSP1. J. Cell Biol. 130:
393–405, 1995.
66. Takenaga, K., Y. Nakamura, and S. Sakiyama. Cellular
localization of pEL98 protein, an S100-related calcium binding
protein, in fibroblasts and its tissue distribution analyzed by
monoclonal antibodies. Cell Struct. Funct. 19: 133–141, 1994.
67. Takenaga, K., Y. Nakamura, S. Sakiyama, Y. Hasegawa, K.
Sato, and H. Endo. Binding of pEL98 protein, an S100-related
calcium-binding protein, to nonmuscle tropomyosin. J. Cell Biol.
124: 757–768, 1994.
68. Tjian, R., and T. Maniatis. Transcriptional activation: a complex puzzle with a few easy pieces. Cell 77: 5–8, 1994.
69. Tulchinsky, E., H. L. Ford, D. Kramerov, E. Reshetnyak, M.
Grigorian, S. Zain, and E. Lukanidin. Transcriptional analysis of the mts1 gene with specific reference to 58 flanking
sequences. Proc. Natl. Acad. Sci. USA 89: 9146–9150, 1992.
70. Tulchinsky, E., M. Grigorian, T. Tkatch, G. Georgiev, and E.
Lukanidin. Transcriptional regulation of the mts1 gene in
human lymphoma cells: the role of DNA-methylation. Biochim.
Biophys. Acta 1261: 243–248, 1995.
71. Tulchinsky, E., D. Kramerov, H. L. Ford, E. Reshetnyak, E.
Lukanidin, and S. Zain. Characterisation of a positive regulatory element in the mts1 gene. Oncogene 8: 79–86, 1993.
72. Tulchinsky, E. M., M. S. Grigorian, A. K. Ebralidze, N. I.
Milshina, and E. M. Lukanidin. Structure of gene mts1,
transcribed in metastatic mouse tumor cells. Gene 87: 219–223,
1990.
73. Volz, A., B. P. Korge, J. G. Compton, A. Ziegler, P. M.
Steinert, and D. Mischke. Physical mapping of a functional
cluster of epidermal differentiation genes on chromosome 1q21.
Genomics 18: 92–99, 1993.
74. Watanabe, Y., R. Kobayashi, T. Ishikawa, and H. Hidaka.
Isolation and characterization of a calcium-binding protein derived from mRNA termed p9Ka, pEL-98, 19A2, or 42A by the
newly synthesized vasorelaxant W-66 affinity chromatography.
Arch. Biochem. Biophys. 292: 563–569, 1992.
75. Watanabe, Y., N. Usada, H. Minami, T. Morita, S. Tsugane,
R. Ishikawa, K. Kohama, Y. Tomida, and H. Hidaka. Calvasculin, as a factor affecting the microfilament assemblies in rat
fibroblasts transfected by src gene. FEBS Lett. 324: 51–55, 1993.
76. Weidner, K. M., N. Arakaki, G. Hartmann, J. Vandekerckhove, S. Weingart, H. Rieder, C. Fonatsch, T. H. Tsubouchi,
Y. Daikuhara, and W. Birchmeier. Evidence for the identity of
human scatter factor and human hepatocyte growth factor. Proc.
Natl. Acad. Sci. USA 88: 7001–7005, 1991.
77. Werb, Z., J. Sympson, C. M. Alexander, N. Thomasset, L. R.
Lund, A. MacAuley, J. Ashkenas, and M. J. Bissell. Extracellular matrix remodeling and the regulation of epithelial-stromal
interactions during differentiation and involution. Kidney Int.
49: S68–S74, 1996.
78. Yuh, C.-H., and E. H. Davidson. Modular cis-regulatory organization of endo-16, a gut-specific gene of the sea urchin embryo.
Development 122: 1069–1082, 1996.
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on August 3, 2017
57.
A REGULATORY ELEMENT IN THE FSP1 GENE