Download Molecular Bio Questions1

Chapter 7 Genes and Genomes
Multiple Choice
Identify the choice that best completes the statement or answers the question.
____ 1. Bacteria are capable of __________ transmission—the transfer of genetic
information from one cell to another.
a. vertical
d. transformation
b. horizontal
e. pseudogene
c. recombination
____ 2. The smallest cellular genomes identified thus far are those of:
a. E. coli
d. Mycoplasma
b. Staphylococcus
e. yeast
c. Streptococcus
____ 3. __________ in the DNA helix provide DNA-binding proteins access to base
sequences buried in the center of the molecule, so that proteins can interact
with the bases without the strands being separated.
a. Cohesive ends
d. Attractions
b. Grooves
e. Repulsions
c. Nicks
____ 4. A nucleoid gently released from E. coli appears as 30–100 tightly wound loops,
each defined by anchoring:
a. histones
d. gyrase
b. histone-like proteins
e. topoisomerase
c. supercoils
____ 5. Supercoiling in bacteria is typically introduced by an enzyme called:
a. gyrase
d. polymerase
b. helicase
e. endonuclease
c. ligase
____ 6. Which of the following is NOT true about the two strands of DNA in a double
helix?
a. The base pairs of one strand interact with the base pairs of the
other.
b. They are antiparallel.
c. They are complementary.
d. They have equal amounts of adenine and guanine.
e. They have base-stacking interactions.
____ 7. The semiconservative mechanism of replication provides for each daughter duplex
to be checked for __________, based on its parent strand.
a. pseudogenes
d. redundancy
b. introns
e. accuracy
c. plasmids
____ 8. Enzymes that synthesize DNA or RNA can synthesize in a __________ direction.
a. forward
b. 3'-to-5'
c. 5'-to-3'
d. reverse
e. 5'-to-3' or 3'-to-5'
____ 9. Which of the following is NOT true of DNA replication in E. coli?
a. DnaA triggers initiation
b. It is bidirectional.
c. One new strand is synthesized discontinuously.
d. It is conservative.
e. Synthesis occurs in the 5'-to-3' direction.
____ 10. What type of bonds does DNA polymerase form?
a. aminoacyl bonds
d. hydrogen bonds
b. peptide bonds
e. disulfide bonds
c. phosphodiester bonds
____ 11. Accidental errors during replication are corrected by the DNA proofreading
activity intrinsic to:
a. DNA polI
d. DNA polIV
b. DNA polII
e. DNA polV
c. DNA polIII
____ 12. Which molecule is responsible for removing torsional stress during DNA
replication?
a. DNA primase
d. DNA gyrase
b. single-stranded binding protein e. DNA ligase
c. RNase H
____ 13. Which of the following terms refers to gene duplications that have decayed into
nonfunctional entities?
a. introns
d. pseudogenes
b. contigs
e. Okazaki fragments
c. orthologs
____ 14. Agarose gel electrophoresis separates pieces of linear DNA based on:
a. size
d. supercoiling
b. charge
e. methylation
c. sequence
____ 15. Pieces of DNA that have been cut with restriction enzymes can then be “grafted”
together using the enzyme:
a. DNA gyrase
d. RNA polymerase
b. DNA ligase
e. reverse transcriptase
c. DNA primase
____ 16. The primer in DNA replication is:
a. an RNA primer with a free 3' OH group
b. an RNA primer with a free 5' OH group
c. a DNA primer with a free 3' OH group
d. a DNA primer with a free 5' OH group
e. a telomere with a free 5' phosphate
____ 17. The sliding clamp is used to __________ and
a. open the helix; clamp loader complex
b. open the helix; DNA polIII
c. tether the polymerase to the chromosome;
d. tether the polymerase to the chromosome;
e. tether the polymerase to the chromosome;
is loaded by ___________.
clamp loader complex
DNA polI
DNA primase
____ 18. Okazaki fragments in E. coli are approximately how many bases in length?
a. 10
d. 1,000
b. 50
e. 2,000
c. 100
____ 19. __________ are bicyclic bases and __________ are monocyclic.
a. Pyrimidines; purines
d. Thymines; uracils
b. Adenines; guanines
e. Purines; pyrimidines
c. Thymines; cytosines
____ 20. The lagging strand is synthesized __________ , while the leading strand can be
synthesized __________.
a. continuously; discontinuously
d. 3'-to-5'; 5'-to-3'
b. discontinuously; continuously
e. quickly; slowly
c. 5'-to-3'; 3'-to-5'
____ 21. Initiation of DNA replication is controlled by DNA __________ and by the binding
of a specific initiator protein to the origin sequence.
a. restriction
d. methylation
b. ligase
e. gyrase
c. helicase
____ 22. When the chromosome replicates, how is the newly made strand related to its
template strand?
a. The two strands have identical sequences and are parallel to each
other.
b. The two strands have complementary sequences and are parallel to
each other.
c. The two strands have identical sequences and are antiparallel to
each other.
d. The two strands have complementary sequences and are antiparallel
to each other.
e. The two strands have identical sequences and are antiparallel to
each other, except that U replaces T.
Short Answer
1. A genome is referred to by its length. If a genome is said to be 5 kb, what does
that mean? If it were 5 kb, what would that tell you?
2. Describe how the name of a gene and its gene product are denoted.
3. Describe the similarities and differences between DNA and RNA.
4. It takes 40 minutes for E. coli chromosome replication but only 20 minutes for
cell division. How is this possible?
5. Why is replication of the lagging DNA strand a problem, and how is this problem
overcome?
6. Describe three functions of DNA polymerase III.
7. How has the study of metagenomics allowed discovery of so many new species? How
is it possible to know about these organisms without being able to grow them in
a laboratory?
2. Why, specifically, are the 5’-phosphate and the 3’-hydroxyl groups of a deoxyribonucleotide absolutely necessary for DNA synthesis? The drug AZT is a triphosphate form of a deoxyribonucleotide with an azide group (-N3) at the 3’position. What function would it have in terms of slowing HIV infection?
14. The proteins in the DNA proofreading system can distinguish different strands
of DNA because
A) the parental strand is methylated.
B) the newly synthesized strand is methylated.
C) MutS recognizes the mismatched base pair.
D) MutH recognizes the mismatched base pair.
E) MutL recognizes the mismatched base pair.
16.
A)
B)
C)
D)
E)
Which of the following is mismatched?
oriC—site on DNA where replication starts
DNA polymerase—forms DNA from deoxynucleotide triphosphates
DNA polymerase III—exhibits 5’-to-3’ exonuclease activity
Okazaki fragments—DNA synthesized from an RNA primer
DNA gyrase—unwinds DNA
17. A deletion mutation affecting the DnaA binding sites of the oriC site is
likely to prevent
A) DNA repair.
B) DNA replication.
C) transcription.
D) translation.
E) All of the above
35. Which of the following enzymes carries out the elongation stage of DNA synthesis?
A) DNA Pol I
B) DNA Pol II
C) DNA Pol III
D) DNA Pol IV
E) DNA Pol V
37. The mismatch repair system involving MutS, MutH, and MutL is takes advantage
of the fact that
A) mutations result in a nick in the DNA strand, which is recognized by the MutSHL system.
B) MutL has DNA polymerase activity and can be used to fill in the correct DNA
sequence.
C) MutS protein can recognize methylated DNA.
D) the parental DNA strand is methylated, but the daughter strand is not.
E) the daughter DNA strand is methylated, but the parental strand is not.
25. Imagine that you are designing an artificial chromosome to carry a large set
of genes that encode proteins that can convert lead to gold. Your first task is
to make an OriC region that will allow the chromosome to be replicated. Which
of the following sequences would be your best choice for the region of your new
OriC that will separate during the open-complex-formation step of replication?
A.
5’ GATCGATCGATCGATCGATC 3’
3’ CTAGCTACCTAGCTAGCTAG 5’
B.
5’ GGCACGAATCGCGGGCAATC 3’
3’ CCGTGCTTAGCGCCCGTTAG 5’
C.
5’ GGATTTTATTAAATCAATCA 3’
3’ CCTAAAATAATTTAGTTAGA 5’
D.
5’ TCGATCGATCGATCGATCGA 3’
3’ AGCTAGCTAGCTAGCTAGCA 5’
E.
5’ GCGCGGGCGCGCCGCGGCGC 3’
3’ CGCGCCCGCGCGGCGCCGCG 5’
31. The normal mutation rate for most bacteria is on the order of 10-9 mutations
per base pair. However, one can often isolate “mutator” strains of bacteria
which mutate at a rate of about 10-6 muations per base pair. Suppose that you
have isolate a bacterial species which converts gold to lead (Leadto goldus),
and you were interested in finding a mutant which did the reverse reaction. If,
with wild-type L. goldus (average 10-9 mutations per base pair) you found the mutant you wanted once in every million colonies, how often you find the same type
of mutant if you used a “mutator” strain with a mutation rate of 10-6 muations
per base pair?