* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download AP Biology
DNA-encoded chemical library wikipedia , lookup
History of biology wikipedia , lookup
Synthetic biology wikipedia , lookup
Chemical biology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biomolecular engineering wikipedia , lookup
Biochemistry wikipedia , lookup
Expanded genetic code wikipedia , lookup
Introduction to genetics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of RNA biology wikipedia , lookup
RNA-binding protein wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
From Gene to Protein SLIDE SHOW BY KIM FOGLIA (modified) All Blue edged slides are Kim’s (hyperlinks may have been added) How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication AP Biology RNA protein DNA gets all the glory, but proteins do all the work! trait Section 17.1 Genes specify proteins via transcription and transaltion AP Biology Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product PKU (phenylketonuria) lack of an enzyme Dysfunctional enzyme Tay-Sachs Albinism metabolic pathway A AP Biology enzyme 1 disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 ARCHIBALD GARROD 1902 1st to suggest genes dictate phenotypes through enzymes that catalyze specific chemical reactions Postulated that the symptoms of an inherited disease are due to inability to make a specific enzyme Coined term “inborn errors of metabolism” to describe such diseases Beginning of “One gene-one enzyme” hypothesis ALCAPTONURIA- “black urine” disease- defect in enzyme that breaks down amino acid tyrosine http://www.personal.psu.edu/faculty/w/x/wxm15/Online/Molecular%20Biology/media/phenylalanine.gif http://www.nature.com/bjp/journal/v147/n1s/images/0706466f5.jpg 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" George Beadle and Edward Tatum exposed bread mold to X-rays, creating mutants that were unable to survive on minimal medium as a result of inability to synthesize certain molecules AP Biology Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations asexual spores Minimal medium spores Growth on complete medium positive control Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium Minimal media supplemented only with… experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control amino acid p-Amino Niacin Inositol acid Folic supplements acid Thiamine benzoic acid AP Biology Fig. 17-2 EXPERIMENT No growth: Mutant cells cannot grow and divide Growth: Wild-type cells growing and dividing Minimal medium RESULTS Classes of Neurospora crassa Wild type Class I mutants Class II mutants Class III mutants Condition Minimal medium (MM) (control) MM + ornithine MM + citrulline MM + arginine (control) CONCLUSION Wild type Gene A Precursor Precursor Precursor Precursor Enzyme A Enzyme A Enzyme A Enzyme A Ornithine Gene B Gene C AP Biology Class I mutants Class II mutants Class III mutants (mutation in (mutation in (mutation in gene B) gene A) gene C) Ornithine Ornithine Ornithine Enzyme B Enzyme B Enzyme B Enzyme B Citrulline Citrulline Citrulline Citrulline Enzyme C Enzyme C Enzyme C Enzyme C Arginine Arginine Arginine Arginine The Products of Gene Expression: A Developing Story Some proteins aren’t enzymes, so researchers later revised the hypothesis: one gene–one protein Many proteins are composed of several polypeptides, each of which has its own gene Therefore, Beadle and Tatum’s hypothesis is now restated as the one gene–one polypeptide hypothesis Note that it is common to refer to gene products as proteins rather than polypeptides AP Biology Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA under the direction of DNA Transcription produces messenger RNA (mRNA) Translation is the synthesis of a polypeptide, which occurs under the direction of mRNA Ribosomes are the sites of translation AP Biology Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… DNA AP Biology transcription RNA 3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS RIBOSOMAL RNA (rRNA): Most abundant type Made in nucleolus 2 subunits (large & small) Combine with proteins to form ribosomes Bacterial ribosomes different size than eukaryotic ribosomes Medically significant-some antibiotics target bacterial ribosomes w/o harming host rRNA and t-RNA images from Image from: Biology; Miller and Levine; Pearson Education publishing as Prentice Hall; 2006 mRNA image from http://wps.prenhall.com/wps/media/tmp/labeling/1140654_dyn.gif 3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS TRANSFER RNA (tRNA): Interpretor between nucleic acids And proteins ANTICODON sequence matches CODON on mRNA to add correct amino acids during protein synthesis http://www-math.mit.edu/~lippert/18.417/lectures/01_Intro/ AMINOACYL-tRNA SYNTHETASE Enzyme attaches a specific amino acid using energy from ATP 3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS MESSENGER RNA (mRNA): carries code from DNA to ribosomes •Transcription Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand synthesis of complementary RNA strand same sequence as RNA transcription bubble enzyme RNA polymerase 5 C DNA G 3 AP Biology build RNA coding strand A G T A T C T A A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA 53 G 5 RNA polymerase template strand During transcription, one of the two DNA strands called the template strand provides a template for ordering the sequence of nucleotides in an RNA transcript During translation, the mRNA base triplets, called codons, are read in the 5 to 3 direction Each codon specifies the amino acid to be placed at the corresponding position along a polypeptide AP Biology Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Cracking the Code All 64 codons were deciphered by the mid-1960s Of the 64 triplets, 61 code for amino acids; 3 triplets are “stop” signals to end translation The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid Codons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced AP Biology Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Concept 17.2 Transcription is the DNA-directed synthesis of RNA: a closer look AP Biology RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes AP Biology Molecular Components of Transcription RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides RNA synthesis follows the same base-pairing rules as DNA, except uracil substitutes for thymine AP Biology Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH AP Biology Transcription Factors •Transcription Initiation complex transcription factors bind to promoter region AP Biology suite of proteins which bind to DNA turn on or off transcription trigger the binding of RNA polymerase to DNA Matching bases of DNA & RNA A Match RNA bases to DNA bases on one of the DNA strands G C U A G G U U C A AG C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Transcription animation AP Biology Section 17.3 Eukaryotic cells modify RNA after transcription AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology mRNA’s require EDITING before use Message in NOT CONTINUOUS INTRONS are removed Image by Riedell mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 base spliced mRNA Discovery of exons/introns Richard Roberts CSHL Philip Sharp MIT beta-thalassemia AP Biology 1977 | 1993 adenovirus common cold Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AP Biology Met|Arg|Val|Arg|STOP| RNA splicing enzymes snRNPs (small ribonucleoproteins) small nuclear RNA plus exon Proteins 5' Recognize splicing sites Spliceosome several snRNPs plus proteins joined together recognize splice site sequence cut & paste gene AP Biology mature mRNA snRNPs snRNA intron exon 3' spliceosome 5' 3' lariat 5' exon 5' 3' exon 3' excised intron RIBOZYMES-RNA molecules that function as enzymes (In some organisms pre-RNA can remove its own introns) More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein 3' mRNA 5' AP Biology P G P P A Section 17.4 Translation is the RNA-directed synthesis of a polypeptide: a closer look AP Biology Translation from nucleic acid language to amino acid language AP Biology 2007-2008 How does mRNA code for proteins? DNA 4 ATCG TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC 4 AUCG protein ? Met Arg Val Asn Ala Cys Ala 20 AP Biology How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids AP Biology created artificial UUUUU… mRNA found that UUU coded for phenylalanine Marshall Nirenberg 1960 | 1968 Har Khorana •Determining the code AP Biology The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AP Biology AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA 3 5 5 3 TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC 3 codon 5 UAC tRNA amino acid AP Biology GCA anti-codon CAU Met Arg Val a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome aa trait AP Biology Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Protein synthesis/quiz Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits AP Biology large small E P A Ribosomes A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) Protein synthesis 2 holds tRNA carrying growing polypeptide chain Met E site (exit site) AP Biology empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' How translation works Building a polypeptide Initiation Elongation brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination 3 2 1 end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C U GA A U mRNA A U G 3' E P A AP Biology 5' UAC GAC A U G C U GA A U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C UG 3' A CC U GG U A A 3' Translation animation AP Biology Destinations: Protein targeting Signal peptide address label start of a secretory pathway AP Biology secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail large ribosomal subunit polypeptide 5' small ribosomal subunit AP Biology tRNA E P A ribosome 3' Bioflix: Protein Synthesis AP Biology The Transcriptional unit (gene?) enhancer 1000+b 20-30b 3' RNA TATA polymerase translation start TAC translation stop exons transcriptional unit (gene) 5' DNA ACT DNA UTR promoter UTR introns transcription start transcription stop 5' pre-mRNA AP Biology 5' GTP mature mRNA 3' 3' AAAAAAAA Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed AP Biology SEE PROCESSING VIDEO Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes AP Biology takes eukaryote ~1 hour from DNA to protein no RNA processing COMPLETING PROTEINS POLYRIBOSOMES (POLYSOMES) Numerous ribosomes translate same mRNA at same time 3-D folding (1’, 2’, 3’ structure) Chaparonins POST-TRANSLATIONAL MODIFICATIONS Some amino acids modified by addition of sugars, lipids, phosphate groups, etc Enzymes can modify ends, cleave into pieces join polypeptide strands (4’ structure) Ex: Made as proinsulin then cut Final insulin hormone made of two chains connected by disulfide bridges http://www.vivo.colostate.edu/hbooks/pathphys/endocrine/pancreas/insulin.html Section 17.5 Point mutations can affect protein structure and function AP Biology Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon Slide from Explore Biology by Kim Foglia Point mutation leads to Sickle cell anemia What kind of mutation? Slide from Explore Biology by Kim Foglia Sickle cell anemia Slide from Explore Biology by Kim Foglia Mutations Frameshift shift in the reading frame insertions adding base(s) deletions changes everything “downstream” losing base(s) More damaging at beginning of gene than at end Slide modified from: Explore Biology by Kim Foglia DNA → DNA ____________ DNA → RNA ____________ RNA→ Protein ___________ WHAT IS A “GENE”? Mendel’s factors determine phenotype T.H. Morgan- genes located on specific chromosomes Beadle and Tatum’s “one gene-one enzyme” Became “One gene-one polypeptide” - Some proteins made of more than one polypeptide chain Ex: hemoglobin has 4 polypeptide chains Now: “one gene – one polypeptide or RNA” - Not all genes code for proteins Can you tell the story? AP Biology Any Questions?? What color would a smurf turn if he held his breath? AP Biology 2007-2008