Download Muscle Cells - Circulation Research

1353
Proliferating Cell Nuclear Antigen in
Developing and Adult Rat Cardiac
Muscle Cells
Thomas A. Marino, Subrata Haldar, Eileen C. Williamson, Katherine Beaverson,
Ruth Anne Walter, Deborah R. Marino, Christine Beatty, and Kenneth E. Lipson
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
During early development, rat cardiac muscle cells actively proliferate. Shortly after birth,
division of cardiac muscle cells ceases, whereas DNA synthesis continues for approximately 2
weeks at a progressively diminishing rate. Little DNA synthesis or cell division occurs in adult
cardiocytes. Thus, developing cardiac muscle cells are an ideal system in which to examine the
expression of cell cycle-regulated genes during development. We chose to examine proliferating
cell nuclear antigen (PCNA), a gene expressed at the G1IS phase boundary of the cell cycle.
Northern blots of RNA from cardiac muscle cells from 18-day-old rat fetuses and from day 0,
5, and 14 neonatal as well as adult rat hearts revealed that the PCNA mRNA was found in
cardiac muscle cells from all ages. However, because it was possible that this was a result of
fibroblast PCNA gene expression, we used reverse transcription followed by polymerase chain
reaction to see if it was possible to detect the message for PCNA in cardiac muscle cells from
all ages. Because of the great sensitivity of this technique, RNA was recovered from 25 isolated
adult cardiac muscle cells. Polymerase chain reaction amplification products for PCNA produced
from the RNA isolated from these cells conclusively demonstrated that mRNA for this gene, which
normally is associated with proliferating cells, is expressed in adult cardiac muscle cells that no
longer divide. Furthermore, Western blot analysis demonstrated that the PCNA protein was found
only in embryonic and neonatal cells and not in adult rat cardiac muscle cells. Therefore, it might
be inferred from these data that PCNA might be regulated at the posttranscriptional level in adult
cardiac muscle cells. (Circulation Research 1991;69:1353-1360)
C ardiac muscle cells proliferate throughout fetal development and into the early neonatal
period. Early studies have determined that
the labeling index of the rat cardiac muscle cell
declines from day 15 of gestation and approaches
zero by the end of the third postnatal week.' The
DNA synthesis that occurs after birth in the rat heart
is part of the process during which the muscle cells
become binucleate. Therefore, during the postnatal
period, there is an uncoupling of DNA replication
from cell division, and rapid polyploidization occurs
during the first postnatal week.23 After the third
From the Departments of Anatomy and Cell Biology (T.A.M.,
E.C.W., R.A.W., D.R.M.), Pathology (K.E.L.), and The Fels
Institute for Cancer Research and Molecular Biology (T.A.M.,
S.H., K.B., C.B.), Temple University School of Medicine, Philadelphia, Pa.
Supported in part by National Institutes of Health grant HL29351, grant 88-1147 from the American Heart Association, and
the American Heart Association, Pennsylvania Affiliate.
Address for reprints: Dr. Thimas A. Marino, Department of
Anatomy and Cell Biology, Temple University School of Medicine,
3400 North Broad Street, Philadelphia, PA 19140.
Received March 30, 1991; accepted June 25, 1991.
week, the heart still is able to respond to stress with
an increase in nuclear DNA and cellular hypertrophy.4 As aging continues, there is evidence to suggest
that myocyte hyperplasia is reinitiated.5 The aim of
the present study was to begin to examine genes that
are important for the cell to traverse the cell cycle
and determine whether they are expressed in cardiac
muscle cells of various ages and how these genes are
regulated.
The gene we chose to examine first was that for
proliferating cell nuclear antigen (PCNA, cyclin).
This gene has been characterized extensively. PCNA
is an auxiliary protein of DNA polymerase 86 and is
essential for DNA replication.7 The importance of
this gene for cell proliferation was demonstrated by
the inhibition of cell proliferation on exposure of
Balb/c3T3 cells to antisense oligodeoxynucleotides to
PCNA.8 The human PCNA gene is 4,961 base pairs
long, has six exons, and localizes to chromosome
20.9,10 PCNA expression is regulated transcriptionally
but has an important posttranscriptional component
as well. Of interest is the fact that at least part of the
transcriptional regulation appears to be mediated by
1354
Circulation Research Vol 69, No 5 November 1991
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
intron 4.11,12 In the rat, steady-state levels of PCNA
mRNA were detected in adult heart tissue as well as
other tissues.13
The basis for this study was to determine whether
a gene that is associated with the G1/S boundary of
the cell cycle14 was expressed in nondividing adult
cardiac muscle cells, as opposed to whole heart
muscle tissue. If PCNA mRNA was not expressed,
the goal was to determine how it was transcriptionally regulated. If the gene was expressed at the
mRNA level, it would be necessary to determine
whether the protein product was found in adult
cardiac muscle cells. Our data indicate that the
PCNA mRNA is expressed specifically in nondividing, adult rat cardiac muscle cells but that the
protein product is not translated in the majority of
adult cardiac muscle cells. Thus, the adult cardiac
muscle cell regulates this G1/S phase gene posttranscriptionally rather than transcriptionally. The
mechanism by which this regulation occurs currently is being investigated.
Materials and Methods
Isolation of Cardiac Muscle Cells
Our experiments were done on isolated heart
muscle cells from ventricular myocardium. Rat cardiocytes were isolated by techniques described previously.15-17 Eighteen-day-old fetal; 0-, 5-, and 14day-old neonatal; and adult rats were used. Aliquots
of 1 x 105 cells in M-199 medium supplemented with
0.2% bovine serum albumin, 10` M insulin, 2.5 x 10-4
M penicillin, and 2.5 x 10-4 M streptomycin with 10%
fetal bovine serum were plated onto culture dishes.
These cells were placed in culture dishes without
laminin for 3 hours to allow myocardial fibroblasts to
attach. Then, the remaining unattached cardiocytes
were used for our experiments. Most, if not all, of the
cells isolated by this procedure were cardiac muscle
cells rather than fibroblasts or endothelial cells.18
These relatively pure muscle cell preparations were
used to isolate total RNA.18
Autoradiography
Autoradiography was done on cardiac muscle cells
both in vivo and in vitro to determine the percentage of
[3H]thymidine-labeled cardiac muscle cells in hearts of
various ages. For whole hearts, we followed the procedures outlined previously.1 DNA synthesis in cardiac
muscle cells was measured from hearts of 18-day-old
fetuses; 0-, 5-, and 14-day-old neonates; and adult
Sprague-Dawley rats. Animals were treated for 1 hour
with [3Hlthymidine, were killed, and the hearts were
fixed, paraffin embedded, sectioned, and analyzed.
Only the nuclei that could be definitively identified as
ventricular, cardiac muscle cell nuclei by the presence
of striations were counted; interstitial cells that represent two thirds of the myocardial nuclei were not
included. For the isolated cells, we followed the procedures outlined below, except that the cells were replated in serum-supplemented medium with [3H]thymi-
dine for 24 hours. Subsequently, the cultures were
fixed, dehydrated, and prepared for autoradiography.
In all studies, more than 800 cells were counted for
each animal or slide, and at least five animals or slides
were used for each group.
Northern Blot Analysis
RNA extracted from cardiac muscle cells19 was
used to prepare RNA blots as previously described.19,20 32P-labeled probes were prepared by the
random priming method.21 To evaluate the amounts
of RNA that were placed in each lane, we used a
cDNA probe for glyceraldehyde-3-phosphate dehydrogenase (GAD) that has been shown to be expressed identically in cardiac muscle cells during
different stages of development.18 This experiment
was repeated four times.
Each blot was hybridized with each of the probes
for 18 hours. Stringent washing of the blots was done
in the same way after each blot was hybridized.
Exposure times also were identical for each of the
probes used on a particular blot. After exposure for 18
hours, the blot was stripped and reprobed. GAD was
the last probe hybridized to a blot. Densitometric
measurements were done to determine the relative
amounts of PCNA thymidine kinase (TK) and histone
3 (H3) to GAD. In all cases, the optical density of each
spot was within the linear range of absorbance.
Four probes were used to study steady-state
mRNA levels: The TK probe was isolated from
pTK11, which is an Okayama-Berg vector that contains the human TK cDNA.14 A GAD cDNA containing plasmid (pHcGAD) was obtained from the
American Type Culture Collection, Rockville, Md.
The probe contains 31 bp of the 5' untranslated end,
1,008 bp of coding sequence, and 216 bp of the 3'
noncoding region of the human GAD gene.18 The
PCNA probe is a cDNA isolated from a human
cDNA library of SV40 transformed fibroblasts.14 The
H3 probe14 also was used to detect cells entering the
G1/S boundary of the cell cycle.13
Detection of Proliferating Cell Nuclear Antigen mRNA
by Reverse Transcription and Polymerase
Chain Reaction
In four separate experiments, cellular RNA was
reverse transcribed with 400 units of Moloney murine
leukemia virus reverse transcriptase for 60 minutes at
370C.21 In each experiment, identical amounts of
RNA were used for each of the age groups examined.
The quality of RNA as measured by the ratio of the
260/280 optical density readings and as assessed by
gel electrophoresis also was identical for all ages
examined. For PCNA sense mRNA detection, the
antisense (3') primer used as a template corresponded to nucleotides 518-540 of rat PCNA cDNA
(TCACCACAGCATCTCCAATATG). The cDNA
fragment generated then was amplified by polymerase chain reaction (PCR) using a 20-base sense
primer that corresponded to nucleotides 241-261
Marino et al PCNA in Rat Heart Muscle Cells
1355
TABLE 1. Percentage of Labeled Cardiac Muscle Cells After 1 Hour of [3H]Thymidine Labeling In Vivo
%Labeled cardiac
Neonatal day 0
Adult
muscle cells
Embryonic day 18
Neonatal day 5
Neonatal day 14
...
In vitro
32.5± 1.5
12.5±0.9
In vivo
13.3±0.08
5.8 +0.2
3.9±0.21
1.5 ±0.08
0.45±0.08
Values determined by autoradiographic techniques. Pregnant mothers or neonatal or adult rats were injected with
1 gCi/g body weight of [3H]thymidine. After 1 hour, animals were killed and hearts fixed. For in vitro studies, cells were
plated on laminin-coated dishes in the presence of serum and [3Hjthymidine for 24 hours and then fixed and processed
for autoradiography.
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
(ACCGCTGCGATCGCAACCTG), the 3' primer,
and 5 units of Taq polymerase. After 40 cycles
of amplification, 10 gl of the reaction mixture was
run on a 4% agarose gel. The gel was blotted onto a
nylon membrane and then prehybridized and hybridized with an oligonucleotide probe that corresponded
to nucleotides 291-311 (GCATCTTTACTACGCAGCTGT). For antisense mRNA detection, the
sense primer described above was used as a template.
In three experiments, the RNA was reverse transcribed and amplified, and the reaction mixture was
run on a 4% gel and blotted. These blots were
hybridized with the full-length PCNA cDNA probe.14
H3, GJ/S phase genes, as well as GAD, a constituitively expressed gene, were analyzed. In Figure 1, it
can be seen that PCNA, H3, and TK steady-state
mRNA levels can be detected at all ages examined.
The levels remain constant throughout development
when compared with GAD steady-state mRNA levels. This is particularly evident when densitometric
measurements are made on the same filter for the
different probes. The PCNA to GAD, TK/GAD, and
-J
0
LU
:
LL
Western Blot Analysis
Cells from hearts at the different ages of development were isolated as described above, harvested, and
washed, and cellular proteins were extracted as described previously for Western blot analysis.22 In each
of three experiments, 50 gig protein was size fractionated on a sodium dodecyl sulfate gel and transferred to
nitrocellulose sheets. The sheets were preblocked and
incubated with the PCNA antibody and '251-protein A
(41 mCi/mg) (Amersham Corp., Arlington Heights,
Ill.). The PCNA antibody (American Biotechnical,
Plantation, Fla.) we used has been described previously15716 for studies on cardiac muscle cells.
Results
The labeling index of the cardiac muscle cells
decreased from 13.3% in the fetal hearts to less than
0.5% in the adult, ventricular myocardium (Table 1).
This result is consistent with previously published
datal2 and demonstrates that the level of DNA
synthesis was minimal for normal cardiac muscle cells
in the adult heart and much greater in cardiac muscle
cells in the fetal heart. In vitro, similar results were
obtained. Although more than 30% of the fetal
cardiac muscle cells progressed through S phase of
the cell cycle over the course of 24 hours in culture,
there was a significant decrease in that number after
birth, with only 12.5% of the day 5 cardiac muscle
cells labeled with [3H]thymidine. Clearly, the rate of
DNA synthesis appears to be declining both in vitro
and in vivo as has been reported previously.
To examine the steady-state levels of PCNA, we
performed Northern blot analysis on RNA from day
18 fetal cardiac muscle cells; day 0, 5, and 18 neonatal
cardiac muscle cells; and adult cardiac muscle cells.
In addition to PCNA, steady-state levels of TK and
j-
Hj
<
C]
C]
<
Lr)
<
Q
PCNA
H3
_
TK
GAD
Mw
CARDIAC MUSCLE CELLS
o 3.0
LEGEND
F-A
[L PCNA/GAD
a TK/GAD
0 H3/GAD
Cc 2.5
2.0
z
ILl 1.5
C1
<( 1.0
U
'-.5
CLo
0
nS,.
Ebb
FETAL DAY 0 DAY 5 DAY 14 ADULT
FIGURE 1. Expression of cell cycle-regulated genes in cardiac muscle cell of various stages of development. Top panel:
Signals obtained from sequential hybridization of the same
blot; bottom panel: densitometric measurements. All measurements were made from the same filterprobed with each of
the probes separately. Hybridization intensity was measured by
linear densitometry. The glyceraldehyde-3-phosphate dehydrogenase (GAD) band was used as the reference band; the ratio
was based on a comparison of each of the other hybridization
bands to the GAD band. PCNA, proliferating cell nuclear
antigen; H3, histone 3; TK, thymidine kinase.
1356
Circulation Research Vol 69, No 5 November 1991
NT3 Adult Embryonic
Cells Cells Cells
A
-Jo toj
3
,L,LLui0C] Qa0)<1
<: m
_P'
PCNA
68kd
43kd
PCNA
CARDIAC MUSCLE CELLS
B
29kd
_
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
WJ
0
Hi
H
<
0
cc
1 8kd
0
CM
1 4kd
PCNA
*
FIGURE 2. Detection of proliferating cell nuclear antigen
(PCNA) mRNA from isolated cardiac muscle cells by reverse
transcription and polymerase chain reaction (RT-PCR). Panel
A: RNA from cells from fetal hearts, neonatal hearts from day
O and day S pups, and adults hearts were subjected to RT-PCR
as described in 'Materials and Methods. The expected 299 bp
fragment was demonstrated by subsequent hybridization with the
oligonucleotide probe described. Panel B: Detection of PCNA
mRNA from 25 isolated cardiac muscle cells. Again, the filter
was hybndized with the oligonucleotide probe for PCNA.
FIGURE 3. Immunoblot analysis by an antibody against
proliferating cell nuclear antigen (PCNA) done on NT3 cells
that are an actively dividing mouse fibroblast cell line, fetal
cardiac muscle cells that are dividing, and adult cardiac
muscle cells that have ceased dividing. PCNA is detected as a
36kDa protein only in those cells that are dividing.
"
H3/GAD levels remain similar for all ages (Figure 1,
bottom panel).
Although the methods used to isolate cardiac
muscle cells minimized fibroblast contamination, it
was possible that the signals detected by RNA blotting originated from fibroblast RNA. To avoid this
possible artifact, we turned to reverse transcription
and polymerase chain reaction (RT-PCR) to determine whether the message for PCNA was present in
a limited number of positively identified, adult cardiac muscle cells. First, to ensure that a signal for
PCNA mRNA could be detected by RT-PCR, RNA
was reverse transcribed with an antisense primer, and
the cDNA then was amplified. For all ages examined,
the expected PCNA amplification product was detected (Figure 2A). With the demonstration that
PCNA mRNA could be detected by RT-PCR, the
method was attempted with only a few cells. In
three different experiments, a total of 25, individually
chosen, adult cardiac muscle cells were isolated with
a micropipette and transferred to a microcentrifuge
tube, and the RNA was isolated. The RNA was
passed through a cesium chloride gradient and then
reversed transcribed and amplified. Again, as seen in
Figure 2B, the PCNA product was detected, indicating that PCNA mRNA is present in adult cardiac
muscle cells.
Because the message for PCNA was transcribed,
the next question was whether the protein product
was made. Immunofluorescent studies using the antibody against PCNA have demonstrated that virtually all fetal cardiac muscle cells contained this
protein.15 Although the levels were reduced, immunostaining revealed that more than 50% of the
neonatal cardiac muscle cells were labeled with antibodies against PCNA.16 However, PCNA has not
been detected in adult cardiac muscle cells. To
confirm these results, we analyzed PCNA protein
levels in rat cardiac muscle cells of the different ages
by immunoblotting (Figure 3). The PCNA protein
was identified by anti-PCNA antibodies as a band of
Marino et al PCNA in Rat Heart Muscle Cells
E O=
E
UC°
n
c
(0)
c0
LL
0]
C] C])
C1
E
WU
PCNA
Cardiac Muscle Cells
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
FIGURE 4. Reverse transcription and polymerase chain reaction offetal (Emb), neonatal day 0 and day 14, and adult
cardiac muscle cell RNA. RNA was reverse transcribed using
either the sense or antisense primers followed by polymerase
chain reaction amplification by both oligomers. The full-length
proliferating cell nuclear antigen (PCNA) probe was used to
probe these blots.
approximately 36,000 Da. It was found in the wholecell extract from NT3 cells, which are a dividing,
mouse fibroblast cell line, from fetal cardiac muscle
cells, from neonatal cardiac muscle cells (data not
shown), but not from adult cardiac muscle cells.
One method by which cells regulate the translation
of specific proteins is by transcription of antisense
messages.23 Because the mRNA for PCNA was detected in cardiac muscle cells from all ages, yet the
protein was not found in adult cardiac muscle cells,
we sought to determine whether an antisense message for PCNA was transcribed in cardiac muscle
cells. The 3' oligonucleotide was used again for
RT-PCR to confirm the presence of the sense message; for a second set of samples, the 5' amplimer was
used during the reverse transcription step to examine
the possibility that an antisense message was transcribed. As seen in Figure 4, both sense and antisense
products were found for all ages.
Discussion
Cell division ceases shortly after birth in cardiac
muscle cells, and factors that regulate this cessation
of cell proliferation are poorly understood. In this
study, we have begun to examine the regulatory
events that occur as the cardiac muscle cell withdraws from the cell cycle. The expression and regulation of cell cycle genes during the withdrawal of
cardiac muscle cells from the cell cycle can be
compared and contrasted to the regulatory events
that occur as fibroblasts in vitro can be manipulated
to exit or reenter the cell cycle.24-27
Numerous studies both in vivo and in vitro clearly
show that cardiac muscle cells can synthesize DNA
and divide during the fetal period.2'5,18,2831 Data
1357
presented here demonstrate that in fetal cardiocytes,
the percentage of labeled cardiac muscle cells after
24 hours of [jH]thymidine incorporation is identical
to that seen in vivo.11 Approximately 30% of the
cardiac muscle cells are labeled. However, at birth, in
vivo rat cardiocytes have approximately one half the
number of labeled nuclei as fetal cardiocytes.23 Cell
labeling declines for the first 2 weeks after birth3 and
is negligible by the end of the third week. During this
period, there is no increase in cell number but an
increase in binucleate cardiac muscle cells, leading to
the conclusion that there was DNA synthesis without
cell division.32 If newborn cardiac muscle cells are
left in culture in serum-free medium for 2 days and
then serum is added for 24 hours, there is an increase
in cell number and [3H]thymidine incorporation.
However, if the cells remain in serum-free culture for
7 days and then are labeled for 24 hours, [jH]thymidine incorporation occurs without an increase in cell
number. After 14 days, neither [3H]thymidine incorporation nor cell number increases with the addition
of serum.'8 Thus, isolated cardiac muscle cells undergo similar changes in vitro as observed in vivo.
However, it should be pointed out that although
the percentage of cardiac muscle cells from young
adult hearts that do synthesize DNA is extremely
low, the number of myocytes labeled with [3H]thymidine is approximately 17% of the number labeled at
birth. With a total of 13.3 x 106 muscle cells in the rat
ventricle at birth, 19.2x106 muscle cells in the rat
ventricle 5 days after birth, 22.3 x 10' muscle cells in
the rat ventricle 11 days after birth, and 28.9x 106
adult ventricular muscle cells,5,32 the number of
labeled cells would be 8.0 x 10i, 7.7 x 10', 3.3 x 105, and
1.4x 105, respectively. Because a small population of
ventricular muscle cells capable of dividing remains,
future studies will be important to determine if
regional differences within each ventricle as well as
differences between ventricles exist. So far, immunohistochemical analysis of ventricular muscle cells
from the rat or cat myocardium have not revealed any
PCNA immunolabeling of adult ventricular muscle
cells (data not shown), whereas in the fetal and
neonatal hearts, ventricular muscle cells do exhibit
PCNA labeling.
Most young adult heart muscle cells in vivo normally stop synthesizing DNA.'-3 However, as diseased hearts increase in size and age, the ploidy of
the cardiac muscle cells increases,33-38 suggesting
that DNA synthesis occurs in human cardiac muscle
cells. With aging, there is also evidence of myocyte
hyperplasia.5 The mechanism for an increase in
ploidy or cell number has not been explained2 but
generally occurs in cardiac muscle cells that have
undergone hypertrophy.34-36 The factors that limit
the ability of the adult cardiac muscle cell to divide
are not known. Clearly, with some cell division possible,5 the reason more cell proliferation does not
occur remains to be answered. In vitro, the ability of
the cardiac muscle cell to synthesize DNA is related
to the degree Of differentiation Of the cell.39,40 LeSS
1358
Circulation Research Vol 69, No 5 November 1991
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
differentiated cardiac muscle cells or amphibian cardiac muscle cells41-45 retain some capacity for DNA
synthesis.
Thus, it appears that although fetal cardiac muscle
cells progress through the cell cycle, neonatal cardiac
muscle cells progress only as far as DNA replication,
and normally, only a small number of adult cardiocytes traverse the cell cycle at all. One can ask how
the expression of cell cycle-associated genes is regulated under these different circumstances. One could
hypothesize that expression of early growth-related
genes would be found in only fetal and neonatal cells,
that expression of G1 and S phase genes would be
found in fetal and neonatal cardiac muscle cells, and
that expression of G2 and M phase genes would be
found in only fetal cardiac muscle cells. In the case of
cardiac hypertrophy, the increase in ploidy and DNA
synthesis would be the result of reexpression of the
early growth-related genes and the G1 and S phase
genes, but not the G2 and M phase genes. When the
limited cell division does occur in the aging hearts,
then the G2/M phase genes would be reexpressed.
Several studies have supported this hypothesis. For
example, studies on early growth-related genes demonstrated that the expression of c-myc and a fosrelated gene were dissociated.46,47 The disappearance of c-myc mRNA preceded that of c-fos or r-fos46
and occurred during the postnatal period. Little
information was available concerning the expression
of later cell cycle progression genes. However, it was
known that both TK and histone 4 mRNA have been
detected in samples of heart muscle tissue from
3-day-old neonatal hearts, whereas the mRNA from
histone 4 was not detected in adult hearts.48
Because PCNA is requisite for DNA synthesis6'7
and because approximately 0.5% of the ventricular
muscle cells are labeled with [3H]thymidine, PCNA
protein must be present in this small fraction of cells.
Our inability to detect PCNA protein by Western
blotting may be the result of several facts. First, only
a small fraction of cells contains this protein. Second,
in these adult cardiac muscle cells, the ratio of
cytoplasmic to nuclear proteins is extremely high.
Third, the number of cardiac muscle cell nuclei as a
percentage of total myocardial nuclei is low. Therefore, it will be necessary to turn to immunohistochemistry on a large number of cardiac muscle cells
to detect PCNA. However, even with this technique,
it would be necessary to examine more than 200,000
cells to detect any cell that contained PCNA protein.
Thus, our failure to detect PCNA protein by either of
these techniques is not unexpected. The consistent
finding that PCNA mRNA was present in only 25
adult cardiac muscle cells strongly suggests that a
majority of these cells transcribe the PCNA gene.
Therefore, it might be inferred from these data that
PCNA expression is regulated at the translational or
posttranslational level.
Other researchers have reported that the regulation of TK expression is predominantly at the posttranscriptional level in differentiating skeletal mus-
cle.4950 Our results suggest that a similar mode of
regulation could occur in developing cardiac muscle
cells and that several G1/S phase genes may be
regulated similarly. From these data, our hypothesis
can be modified. First, because early GQ-associated
genes are not expressed in adult cardiac muscle
cells46'47 and because these genes can be induced by
a number of factors, including a number of nonmitogenic factors, the transcripts from these genes may
very well be expressed in response to stimuli to
hypertrophy.47 In contrast, the later GI/S phase gene
mRNA may be present in these adult cardiac muscle
cells but may not be translated unless stimulated by
certain stimuli such as hemodynamic stress. This
would be reasonable in terms of the length of time
that would be needed to activate all the transcription
factors necessary for transcription of these G1JS
phase genes. In this way, the mRNA would be
available, and once the early growth-related genes
are stimulated and if DNA synthesis is to proceed,
then all that would be required is translation into the
protein product. It will be necessary to determine
how the hemodynamic events result in cell surface
changes that then can mediate second messenger
pathways to result in any substantial reinitiation of
myocyte DNA synthesis.
The observation of an antisense message for
PCNA in cells from rat hearts of different ages is
intriguing. In another system, it has been suggested
that the stability of basic fibroblast growth factor
mRNA in Xenopus oocytes may be controlled by its
antisense transcript.23 In the case of the basic fibroblast growth factor mRNA, it is thought that the
antisense messages may be involved in mRNA stability. The importance of the antisense message in
cardiac muscle cells awaits further study, and the
presence of such an antisense message in all the ages
examined is difficult to interpret. To our knowledge,
no other investigators have looked for the PCNA
antisense message in other cellular systems. Therefore, it is uncertain whether this is a general phenomenon or is restricted to cardiac muscle cells.
In summary, it appears that the early G1 genes, or
growth-related genes such as myc andfos,46'47 may be
transcriptionally regulated in cardiac muscle cells,
though even basal levels of these genes may be found
in cardiac muscle cells. In contrast, the later cell cycle
genes such as PCNA actually may have their regulatory step at the posttranscriptional rather than the
transcriptional level. The goal of our future studies
will be to determine the factors that regulate the
production of critical cell cycle genes such as PCNA
in an attempt to determine how cardiac muscle cells
regulate their ability to divide. In this way, PCNA
becomes an important model gene for developing our
understanding of the regulation of DNA synthesis
and cell division in cardiac muscle cells.
Acknowledgments
The authors would like to thank Dr. R. Baserga for
providing us with the PCNA and H3 probes. We also
Marino et al PCNA in Rat Heart Muscle Cells
greatly appreciate his guidance and help during both
the course of this work and the preparation of the
manuscript. We also would like to thank Dr. Carlo
Croce for his assistance. Finally, we would like to
thank Dr. Stuart Moss for his help during the preparation of this manuscript.
References
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
1. Peterson RO, Baserga R: Nucleic acid and protein synthesis in
cardiac muscle of growing and adult mice. Esp Cell Res
1965;40:340-352
2. Rumayantsev PP: Interrelations of the proliferation and differentiation processes during cardiac myogenesis and regeneration. Int Rev Cytol 1977;51:187-273
3. Clubb FJ Jr, Bishop SP: Formation of binucleated myocardial
cells in the neonatal rat. Lab Invest 1984;50:571-577
4. Anversa P, Palackal T, Sonnenblick EH, Olivetti G, Capasso
JM: Hypertensive cardiomyopathy. J Clin Invest 1990;85:
994-997
5. Anveras P, Palackal T, Sonnenblick EH, Olivetti G, Meggs
LG, Capasso JM: Myocyte cell loss and myocyte cellular
hyperplasia in the hypertrophied aging rat heart. Circ Res
1990;67:871-885
6. Bravo R, Frank R, Blundell PA, MacDonald-Bravo H: Cyclin/
PCNA is the auxiliary protein of DNA polymerase-gamma.
Nature 1987;326:515-517
7. Prelich G, Kostura M, Marshak DR, Mathews MB, Stillman
B: The cell-cycle regulated proliferating cell nuclear antigen is
required for SV40 replication in vitro. Nature 1987;326:
471-475
8. Jaskulski D, DeReil JK, Mercer WE, Calabretta B, Baserga R:
Inhibition of cellular proliferation by antisense oligodeoxynucleotides to PCNA cyclin. Science 1988;240:1544-1546
9. Travali S, Ku DH, Rizzo MG, Ottavio L, Baserga R, Calabretta B: Structure of the human gene for the proliferating cell
nuclear antigen. J Biol Chem 1989;264:7466-7472
10. Ku DH, Travali S, Calabretta B, Huebner K, Baserga R:
Human gene for proliferating cell nuclear antigen has pseudogenes and localizes to chromosome 20. Somat Cell Mol
Genet 1989;15:297-307
11. Chang CD, Ottavio L, Travali S, Lipson KE, Baserga R:
Transcriptional and post-transcriptional regulation of the proliferating nuclear antigen gene. Mol Cell Biol 1990;10:
3289-3296
12. Ottavio L, Chang CD, Rizzo MG, Travali S, Casadevall C,
Baserga R: Importance of introns in the growth regulation of
mRNA levels of proliferating cell nuclear antigen gene. Mol
Cell Biol 1990;10:303-309
13. Liu YC, Bambara RA: Gene expression of PCNA/cyclin in
adult tissues and the R3230AC mammary tumor of rat.
Biochem -Riophys Res Commun 1989;161:873-882
14. Jaskulski D, Gatti C, Travali S, Calabretta B, Baserga R:
Regulation of the proliferating cell nuclear antigen cyclin and
thymidine kinase mRNA levels by growth factors. JBiol Chem
1988;263:10175-10179
15. Marino TA, Walter RA, D'Ambra K, Mercer WE: Effects of
catecholamines on fetal rat cardiocytes in vitro. Am J Anat
1989;186:127-132
16. Marino TA, Walter RA, Cobb E, Palasiuk M, Parsons T,
Mercer WE: Effects of norepinephrine on neonatal rat cardiocyte growth and differentiation. In Vitro Cell Dev Biol 1990;26:
229-236
17. Cooper G IV, Mercer WE, Hoober JK, Gordon PR, Kent RL,
Lauva lK, Marino TA: Load regulation of the properties of
adult feline cardiocytes. Circ Res 1986;58:692-705
18. Ueno H, Perryman MB, Roberts R, Schneider MD: Differentiation of cardiac myocytes after mitogen withdrawal exhibits
three sequential states of the ventricular growth response. J
Cell Biol 1988;107:1911-1918
19. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 1987;162:156-159
1359
20. Lipson KE, Chen ST, Koniecki J, Ku D, Baserga R: S-phase-specific regulation by deletion mutants of the human thymidine
kinase promoter. Proc Natl Acad Sci USA 1989;86:6848-6852
21. Lipson KE, Baserga R: Transcriptional activity of the human
thymidine kinase gene determined by a method using the
polymerase chain reaction and an intron-specific probe. Proc
Natl Acad Sci US A 1989;86:1-4
22. Haldar S, Beatty C, Tsujimoto Y, Croce CM: The bcl-2 gene
encodes a novel G protein. Nature 1989;342:195-198
23. Kimelman D, Kirschner MW: An antisense mRNA directs the
covalent modification of the transcript encoding fibroblast
growth factor in xenopus oocytes. Cell 1989;59:687-696
24. Baserga R, Calabretta B, Travali S, Jaskulski D, Lipson KE,
DeRiel JK:. Regulation of the expression of cell cycle genes.
Ann N YAcad Sci 1988;551:283-289
25. Rittling SR, Brooks KM, Cristofalo VJ, Baserga R: Expression
of cell cycle-dependent genes in young and senescent WI-38
fibroblasts. Proc Natl Acad Sci U S A 1986;83:3316-3320
26. Rittling SR, Baserga R: Regulatory mechanisms in the expression of cell cycle dependent genes. Anticancer Res 1987;7:
541-552
27. Coppock DL, Pardee AB: Control of thymidine kinase mRNA
during the cell cycle. Mol Cell Biol 1987;7:2925-2932
28. Clark WA Jr, Fischman DA: Analysis of population cytokinesis of chick myocardial cells in tissue culture. Dev Biol 1983;
97:1-9
29. Polinger IS: Growth and DNA synthesis in embryonic chick
heart cells, in vivo and in vitro. Exp Cell Res 1973;76:253-262
30. Masse MJO, Harary I: The use of fluorescent antimyosin and
DNA labeling for the estimation of the myoblast and myocyte
population of primary rat heart cell cultures. J Cell Physiol
1981;106:165-172
31. Nag AC, Ingland M, Cheng M: Factors controlling embryonic
heart cell proliferation in serum-free synthetic media. In Vitro
Cell Dev Biol 1985;21:553-562
32. Anversa P, Olivetti G, Loud AV: Morphometric study of early
postnatal development in the left and right ventricular myocardium of the rat. Circ Res 1980;46:495-502
33. Brodsky WY, Arefyeva AM, Uryvaeva IV: Mitotic polyploidization of mouse heart myocytes during the first postnatal
week. Cell Tissue Res 1980;210:133-144
34. Adler CP, Costabel U: Cell number in human heart in
atrophy, hypertrophy, and under the influence of cytostatics,
in Fleckenstein A, Rona G (eds): Recent Advances in Studies
on Cardiac Structure and Metabolism. Baltimore, Md, University Park Press, 1975, vol 6, pp 343-355
35. Staiger J, Stolze H, Adler CP: Nuclear deoxyribonucleic acid
content in congenital cardiac malformations, in Fleckenstein
A, Rona G (eds): Recent Advances in Studies on Cardiac
Structure and Metabolism. Baltimore, Md, University Park
Press, 1975, vol 6, pp 357-363
36. Sandritter W, Scomazzoni G: Deoxyribonucleic acid content
(Feulgen photometry) and dry weight (interference microscopy) of normal and hypertrophic heart muscle fibres. Nature
1984;202:100-101
37. Sandritter W, Adler CP: Numerical hyperplasia in human
heart hypertrophy. Specialia 1971;15:1435-1437
38. Katzberg AA, Farmer BB, Harris RA: The predominance of
binucleation in isolated rat heart myocytes. Am J Anat 1977;
149:489-500
39. Libby P: Long-term culture of contractile mammalian heart
cells in a defined serum-free medium that limits non-muscle
cell proliferation. J Mol Cell Cardiol 1984;16:803-811
40. Piper HM, Jacobson SL, Schwartz P: Determinants of cardiomyocyte development in long-term primary culture. JMol Cell
Cardiol 1988;20:825-835
41. Tate JM, Oberpriller JO, Oberpriller JC: Analysis of DNA
synthesis in cell cultures of the adult newt cardiac myocyte.
Tissue Cell 1989;21:335-342
42. Claycomb WC, Moses RL: Growth factors and TPA stimulate
DNA synthesis and alter the morphology of cultured terminally differentiated adult rat cardiac muscle cells. Dev Biol
1988;127:257-265
1360
Circulation Research Vol 69, No
5
November 1991
43. Claycomb WC, Bradshaw HD Jr: Acquisition of multiple
nuclei and the activity of DNA polymerase alpha and reinitiation of DNA replication in terminally differentiated adult
cardiac muscle cells in culture. Dev Biol 1983;99:331-337
44. Claycomb WC: Long-term culture and characterization of the
adult ventricular and atrial cardiac muscle cell. Basic Res
Cardiol 1985;80:171-174
45. Nag AC, Cheng M: DNA synthesis of adult mammalian cardiac
muscle cells in long-term culture. Tissue Cell 1986;18:491-497
46. Schneider MD, Payne PA, Ueno H, Perryman MB, Roberts R:
Dissociated expression of c-myc and a fos-related competence
gene during cardiac myogenesis. Mol Cell Biol 1986;6:
4140-4143
47. Komuro I, Kurabayashi M, Takaku F, Yazaki Y: Expression of
cellular oncogenes in the myocardium during the developmental stage and pressure-overloaded hypertrophy of the rat
heart. Circ Res 1988;62:1075-1079
48. Claycomb WC, Lanson NA Jr: Proto-oncogene expression in
proliferating and differentiating cardiac and skeletal muscle.
Biochem J 1987;247:701-706
49. Gross MK, Merrill GF: Regulation of thymidine kinase protein levels during myogenic withdrawal from the cell cycle is
independent of mRNA regulation. Nucleic Acids Res 1988;16:
11625-11643
50. Gross MK, Merrill GF: Thymidine kinase synthesis is
repressed in nonreplicating muscle cells by a translational
mechanism that does not affect the polysomal distribution of
thymidine kinase mRNA. Proc Natl Acad Sci U S A 1989;86:
4987-4991
KEY WORDS * heart development * cell proliferation
proliferating cell nuclear antigen * cardiac muscle cell growth
.
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Proliferating cell nuclear antigen in developing and adult rat cardiac muscle cells.
T A Marino, S Haldar, E C Williamson, K Beaverson, R A Walter, D R Marino, C Beatty and K
E Lipson
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Circ Res. 1991;69:1353-1360
doi: 10.1161/01.RES.69.5.1353
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 1991 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/69/5/1353
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/