Download Non-cell-autonomous regulation of root hair patterning genes by

Plant Physiology Preview. Published on March 27, 2014, as DOI:10.1104/pp.113.233775
Running Head:
WRKY75 – a root hair patterning factor
Corresponding Author:
Martin Hülskamp
Botanical Institute
Biocenter
Cologne University
Cologne 50674
tel: -49-221-4702473
email: [email protected]
Research Area:
Genes, Development and Evolution
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Copyright 2014 by the American Society of Plant Biologists
Non-cell-autonomous regulation of root hair patterning genes by WRKY75 in Arabidopsis thaliana
Louai Rishmawi1,2, Martina Pesch,1,4, Christian Juengst3, Astrid C. Schauss3, Andrea Schrader1,4, Martin
Hülskamp1,2,4
1
Biocenter, Cologne University, Botanical Institute, Zülpicher Straße 47b, 50674 Cologne
2
Cluster of Excellence on Plant Sciences (CEPLAS)
3
CECAD Forschungszentrum, Joseph-Stelzmann-Str. 26, 50931 Cologne
4
Authors contributed equally to the work.
Summary:
WRKY75 is expressed in the pericycle and vascular tissues of the root and regulates root hair patterning in a
non-cell autonomous manner. WRKY75 regulates the expression of CPC and binds to its promoter sequences.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Footnotes:
Financial sources:
This work was supported by CEPLAS EXC 1028 to M.H. and an IMPRS fellowship to L.R.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
ABSTRACT
In Arabidopsis thaliana, root hairs are formed in cell files over the cleft of underlying cortex cells. This pattern
is established by a well-known gene regulatory network of transcription factors. In this study, we show that
WRKY75 suppresses root hair development in non-root hair files and that it represses the expression of TRY
and CPC. The WRKY75 protein binds to the CPC promoter in a yeast one-hybrid assay. Binding to the
promoter fragment requires an intact WRKY protein binding motif, the W box. A comparison of the spatial
expression of WRKY75 and the localization of the WRKY75 protein revealed that WRKY75 is expressed in the
pericycle and vascular tissue and that the WRKY75 RNA or protein moves into the epidermis.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
INTRODUCTION
The establishment of a pattern of files forming root hairs and non-root hairs in the root epidermis is a wellstudied developmental model system (Schiefelbein et al., 2009; Tominaga-Wada et al., 2011; Grebe, 2012).
Root hair cells (H-cells) develop from cell files over the cleft of two underlying cortical cells, whereas all other
cells develop into non-root hair cells (N-cells) (Dolan et al., 1993; Dolan et al., 1994; Galway et al., 1994). The
genetic dissection of the underlying pathway has enabled the isolation of essential genes and subsequently their
molecular characterization (Schiefelbein, 2000; Pesch and Hulskamp, 2004; Ishida et al., 2008). Mutations in
four genes lead to the formation of extra root hairs in N-positions indicating their importance in the repression
of root hair formation. These include TRANSPARENT TESTA GLABRA1 (TTG1), GLABRA3 (GL3),
ENHANCER OF GLABRA3 (EGL3), and WEREWOLF (WER) (Galway et al., 1994; Masucci and Schiefelbein,
1996; Lee and Schiefelbein, 1999; Bernhardt et al., 2003). In addition a number of positive regulators of root
hair formation have been identified including CAPRICE (CPC), TRIPTYCHON (TRY), ENHANCER OF
TRIPTYCHON AND CAPRICE 1,2, and 3 (ETC 1, 2, and 3). (Wada et al., 1997; Schellmann et al., 2002; Kirik
et al., 2004a; Kirik et al., 2004b; Simon et al., 2007; Wester et al., 2009). Current models explain root hair
patterning by a lateral inhibition scenario with feedback loops: The R2R3MYB protein WER (Lee and
Schiefelbein, 1999), the bHLH protein GL3 and EGL3 (Bernhardt et al., 2003), and the WD40 domain protein
TTG1 (Walker et al., 1999) are considered to form a trimeric complex (MBW complex) that activates
GLABRA2 (GL2) expression in N-cells (Schiefelbein, 2003; Pesch and Hulskamp, 2004) which in turn
represses the root hair cell fate (Masucci et al., 1996). In addition the R3MYB genes CPC, TRY, ETC1, ETC2,
and ETC3 are activated and are thought to suppress the activity of the MBW complex by binding to
GL3/EGL3 protein, thereby replacing WER in a competitive manner (Esch et al., 2003; Kirik et al., 2004a;
Kirik et al., 2004b; Kurata et al., 2005; Ryu et al., 2005; Tominaga et al., 2007). Cross talk between the cells is
mediated by the R3MYB proteins. These are expressed predominantly in the N-files and move to H-file cells.
Recently it was shown that CPC can freely move in the root meristematic region and that it is trapped by EGL3
in H-file cells (Kang et al., 2013). In addition, GL3 that is expressed in H-cells moves in the opposite direction
into the N-cells (Bernhardt et al., 2005). The position with respect to the underlying cortical cells is governed
by the leucine-rich repeat receptor-like kinase (LRR-RLK), SCRAMBLED (SCM) and JACKDAW (JKD)
(Kwak et al., 2005; Hassan et al., 2010). It is postulated that JKD expression in the cortex differentially
regulates SCM activity because the size of the contact areas are different between epidermal cells overlying
cortex cells and epidermal cells over the cleft of two underlying cortex cells (Hassan et al., 2010). SCM in turn
represses WER in N-cells. Mathematical models have been developed to analyse the interaction schemes and
highlight the importance of the reciprocal movement behaviour of the R3MYBs and GL3 proteins (Savage et
al., 2008). In addition to this gene regulatory network, the plant hormones ethylene and auxin are involved in
root hair development. Genetic and expression analyses suggest that both hormones promote root hair
formation downstream of TTG1 and GL2 (Masucci and Schiefelbein, 1996).
One additional regulator of root hair initiation is the WRKY75 gene. In WRKY75 RNAi lines the number of root
hairs is markedly increased indicating that it is a negative regulator of root hair formation (Devaiah et al.,
2007). A root hair-specific function of WRKY75 is unlikely as it has been implicated also in phosphate
starvation, pathogen responses and senescence (Dong et al., 2003; Guo and Gan, 2004; Devaiah et al., 2007;
Encinas-Villarejo et al., 2009). The WRKY75 gene encodes a WRKY protein containing a single WRKY
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
domain and a C2H2 zinc finger motif at the C-terminus. WRKY proteins act as transcription factors through
direct interaction of the WRKY domain to the W box cis-regulatory elements in target promoter sequences
(Rushton et al., 1995; Eulgem et al., 1999; Ciolkowski et al., 2008). Consistent with this, the WRKY75 protein
localizes to the nucleus and regulates the expression of other phosphate response-genes (Devaiah et al., 2007).
Whether WRKY75 dependent regulation of root hair formation involves the root hair patterning genes or acts
at the level of hormonal regulation has not been studied. In this work we aimed to unravel the molecular
mechanism by which WRKY75 regulates the initiation of root hairs in more detail.
RESULTS
WRKY75 represses root hair development
The previous finding that a WRKY75RNAi line produces extra root hairs (Devaiah et al., 2007) raises the
question whether WRKY75 acts on the root hair patterning network, directly on GL2 or even later in the
hormonal control of root hair formation. To address this question, we first analysed the root hair pattern in
wrky75 mutants and WRKY75 overexpression lines.
In our work we used two mutant lines: the previously described WRKY75 RNAi line (Devaiah et al., 2007) and
the T-DNA insertion line N121525 called wrky75-25 (Encinas-Villarejo et al., 2009). We confirmed that the
wrky75-25 is a null mutant by RT-PCR (Fig. S1). Next, we cloned the T-DNA flanking region to map the TDNA insertion. The T-DNA insertion maps 143 bp downstream of the stop codon (Fig. S2). This suggests that
the 3’region is essential for the expression of WRKY75.
Our analysis of the root hair pattern showed that both wrky75 mutants exhibited ectopic root hairs in non-hair
files (Fig. 1 B, C; Table 1). This suggested to us that WRKY75 is a negative regulator of root hair formation.
To test this, we generated lines expressing WRKY75 under the ubiquitous 35S promoter (p35S:WRKY75). In
these lines significantly less root hairs were found in the hair files (Fig. 1 D; Table 1). In p35S:WRKY75, the
WRKY75 expression was 14.9±3.9 times higher than the wild type in quantitative real time (qRT) PCR
experiments (Fig. S3). Together these phenotypes suggest that WRKY75 acts on the root hair patterning
network by suppressing root hair fate in the non-hair files and by promoting root hair production in the root
hair files.
Transcriptional regulation of root hair patterning genes by WRKY75
To determine whether WRKY75 regulates the expression of patterning genes, we studied the expression levels
of selected candidates by real time PCR (Fig. 2; Table S2). We focused our expression analyses on the
patterning process by isolating the RNA from the root hair initiation zone. We observed a significant increase
in the expression levels of CPC and TRY in both wrky75 mutants and reduced expression levels in the
35S:WRKY75 line. Consistently, we found the corresponding changes in the expression levels of the non-root
hair marker GL2 (Szymanski et al., 1998) and the root hair marker RSL4 (Yi et al., 2010). In wrky75 mutants,
the expression levels of RSL4 were increased whereas GL2 expression levels were reduced. In the WRKY75
overexpression line, the RSL4 expression levels were reduced and those of GL2 were increased. Together
these data indicate that WRKY75 regulates the expression of the root hair patterning genes.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Changes in the expression levels can be explained by higher but spatially correct expression or by
temporal/spatial changes. To distinguish between these two possibilities we focused on the spatial expression
of CPC and GL2 in roots using established promoter:GUS marker lines (Fig. 3). In the wild type, CPC was
expressed in the non-root hair files that can be recognized as continuous GUS-labelled stretches of cells and
weakly expressed in the stele (Wada et al., 2002). In wrky75 mutants we noted three differences (Fig. 3).
First, we found up to four adjoining cell files with CPC expression indicating that CPC is expressed in hair
and non-root hair files. Second, we noted that non-root hair files showed discontinuous labelling indicating
that not all cells in N-positions express CPC. Third, CPC expression in the stele was increased in wrky75
mutants (Fig. S4). Together these data suggest that CPC expression is affected in both epidermal cell files
and the stele. In p35S:WRKY75 lines we found frequently that the CPC-expressing cell files were not
continuous. CPC expression in the stele was barely detectable (Fig. S4). The analysis of pGL2:GUS revealed
discontinous GUS expressing cell files in wrky75 mutants (Fig. 3 F,G). In p35S:WRKY75 we also found
pCPC:GUS expression in up to four immediately neigboring cell files (Fig. 3H).
WRKY75 protein binds to the CPC promoter through the W box
We tested the ability of WRKY75 protein to bind to the CPC promoter using a yeast one-hybrid assay. It is
well established that WRKY proteins can bind to six nucleotide long consensus sequences C/TTGACT/C
called the W box (Rushton et al., 1995; Eulgem et al., 1999; Ciolkowski et al., 2008). It was shown that the
region between –425 and –406 of the CPC promoter contains a binding site of WER (Ryu et al., 2005). We
therefore searched for W boxes near that region and chose an 80bp fragment (pCPC(-459 to -378) containing a
W box and the WER binding site (Fig. 4A).
In presence of WRKY75, the HIS3-reporter gene driven by three tandem repeats of pCPC(-459 to -378) was
transcribed as indicated by yeast growth on selective medium lacking histidine (Fig. 4 B). To test whether
binding occurs through the W box, we performed this experiment with a promoter fragment in which the W
box was mutated. This promoter fragment failed to mediate WRKY75 binding. Binding of WER was not
impaired indicating that the promoter fragment was generally accessible. Together our data show that
WRKY75 protein can bind directly to the CPC (-459 to -378) promoter fragment through the W box motif.
Genetic analysis of WRKY75
If extra root hair formation in wrky75 mutants is caused by the de-repression of CPC, one would expect that
the cpc mutant root hair phenotype is epistatic to wrky75. To test this hypothesis, we created the cpc-2 wrky7525 double mutant. This double mutant showed only few root hairs as observed in the cpc-2 mutant (Fig. 5,
Table 1). Overexpression of WRKY75 in cpc-2 caused a further reduction in root hair numbers. This is
essentially an additive phenotype suggesting that WRKY75 overexpression can further reduce root hair
number through additional targets. One possible target is the TRY gene as we observed a reduced expression of
TRY in p35S:WRKY75 lines.
WRKY75 is expressed in the inner part of the root
As WRKY75 represses CPC we expected it to be co-expressed with CPC in non-root hair files. As the T-DNA
insertion in the wrky75-25 allele was found in the 3’region of the WRKY75 gene we created a promoter:GUS
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
construct containing a 2.2 kb upstream region and a 627 bp 3’region (called pWRKY75:GUS:3’-WRKY75). The
characterisation of five lines in a Col-0 background revealed consistently expression in the inner region of the
root (Fig. 3 I,L). Typically, highest expression was observed close to the root tip and weaker expression in the
stele in upper root regions. GUS staining for 9, 12 and 24 hours revealed that WRKY75 is not expressed in the
early epidermal cells in the root cap (Fig. 3 J; Fig. S5). The same pattern was observed in lateral roots (Fig.
3K). Plants transformed with constructs containing only 2.2 kb upstream region (pWRKY75:GUS) showed no
GUS expression in 20 T1 seedlings.
WRKY75 protein / RNA moves from the inner part of the root to the epidermis
As the WRKY75 expression does not coincide with its biological function in the epidermis, we tested the
possibility that WRKY75 RNA or WRKY75 protein moves from the centre of the root to the epidermis. To test
whether WRKY75 is non-cell autonomous, we created two constructs: pWRKY75:YFP-GUS:3’-WRKY75 and
pWRKY75:YFP-WRKY75:3’-WRKY75. The pWRKY75:YFP-GUS:3’-WRKY75 was used to precisely locate the
expression of WRKY75 by YFP fluorescence and to avoid artificial GUS staining caused by GUS diffusion.
The pWRKY75:YFP-WRKY75:3’-WRKY75 construct was used to study the WRKY75 protein localization (Fig.
6). This construct rescued the wrky75 mutant root hair phenotype indicating that the promoter sequences are
sufficient for rescue and that the YFP-WRKY75 fusion protein is functional (Table S3). The WRKY75
transcript levels of plants carrying this construct in the wrky75-25 background are lower than in Col-0 (Fig.
S6). This excludes the possibility that artificially high expression levels lead to the rescue. The expression of
this construct in wild type Col-0 background did not cause a root hair phenotype (Table S4). In
pWRKY75:YFP-GUS:3’-WRKY75 plants YFP fluorescence (and GUS staining Fig. 3L) was found in the
pericycle and the vascular tissue of the root (Fig. 6B; Fig. S7) as observed with the pWRKY75:GUS:3’WRKY75 construct. In contrast, the YFP signal was also found in the neighbouring cell layers including the
epidermis in pWRKY75:YFP-WRKY75:3’-WRKY75 plants (Fig. 6A). This indicates that YFP-WRKY75 moves
from the centre to the epidermis of the primary root.
To independently confirm that WRKY75 can move between different tissue layers, we expressed the WRKY75
cDNA under the SCARECROW (SCR) promoter in the wrky75-25 mutant background (Helariutta et al., 2000).
As expected pSCR:GFPer (Fig. 7B; Fig. S 8C) showed expression in the cortical/endodermis initial cells and
in the endodermis (Fig. 7) (Laurenzio et al., 1996). In pSCR:YFP-WRKY75 the YFP signal was detected in all
cell layers (Fig. 7A; Fig. S8 A,B). Moreover, pSCR:YFP-WRKY75 was able to rescue the wrky75-25
phenotype (Table S5). These results confirm that WRKY75 can move between different tissue layers.
DISCUSSION
The previous finding that suppression of WRKY75 leads to an increased number of root hairs (Devaiah et al.,
2007) raised the question how WRKY75 is tied in the root hair patterning or differentiation machinery.
WRKY75 regulates the root hair patterning system through transcriptional regulation of CPC
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Our analysis of wrky75 mutants and WRKY75 overexpression lines revealed that WRKY75 acts as a repressor
of root hair formation. These genetic results are supported by changes in the expression of the non-root hair
marker GL2 (Szymanski et al., 1998) and the root hair marker RSL4 (Yi et al., 2010) such that GL2 expression
is decreased in wrky75 mutants and increased in p35S:WRKY75 lines whereas RSL4 expression shows the
opposite behaviour. Our data further indicate that these two markers are regulated by WRKY75 through the
regulation of known root hair patterning genes. Our expression analysis of positive and negative regulators of
root hair patterning pointed to a regulation of CPC and TRY. A temporal-spatial analysis of TRY was not
considered as the corresponding pTRY:GUS lines did not show expression in wild type roots (Schellmann et
al., 2002). The spatial analysis of CPC supported the findings. As compared to wild type, the typical
expression of pCPC:GUS in non-root hair cells (Wada et al., 2002) was reduced in p35S:WRKY75 lines and
ectopic expression in root hair cell files was found in wrky75 mutants. The regulation of CPC is likely to be
driven through direct binding of WRKY75 to the CPC promoter. This view is supported by our yeast one
hybrid data indicating that WRKY75 can bind to the CPC promoter. Binding specificity to the promoter is
suggested by the finding that mutations of the W-box abolish the binding.
Non-autonomous regulation of epidermal fate by WRKY75
Our finding that WRKY75 is transcriptionally expressed in the inner part of the root and that YFP-WRKY75 is
found in all tissue layers suggests that WRKY75 regulates root hair development in a non-cell autonomous
manner. The promoter regions chosen for these experiments are likely to reveal the correct expression pattern
as they are sufficient for rescue and as they contain the region in which a T-DNA insertion causes a wrky75
mutant phenotype. Thus it is conceivable that WRKY75 RNA or protein travels from the inner part of the root
to the epidermis. We confirmed this movement behavior by showing that also YFP-WRKY75 expressed under
an endodermis-specific promoter can move to the epidermis and that it can rescue the wrky75 root hair
phenotype. As two transcriptomic approaches studying systematically the expression of genes in different root
cell types found WRKY75 in the epidermis (Birnbaum et al., 2003; Lan et al., 2013) it is conceivable that
WRKY RNA can move between cells.
How does WRKY75 fit in the root hair patterning models?
The current models explain the positional regulation of root hair formation by regulatory feedback loops of
MBW proteins and their negative regulators, the R3MYBs (Schiefelbein et al., 2009; Tominaga-Wada et al.,
2011; Grebe, 2012). The relative position of H and N cells with respect to the cortical cells is controlled by a
repression of WER in H-positions by SCM. In addition the SCHIZORIZA gene had been implicated in
epidermal differentiation (Mylona et al., 2002; ten Hove et al., 2010). How does WRKY75 fit into this network?
Is WRKY75 involved in the positioning of H- and N- files possibly through JKD and SCM? We consider this to
be unlikely as the corresponding mutants show distortions of the overall radial pattern in the root. Our finding
that WRKY75 expression is rather unspecific in the inner part of the root and the movement of WRKY75 RNA/
WRKY75 protein to the epidermal layer provides no hint towards a biased regulation of H- or N-files. The
recent report by Kang and coworkers showing that expression of CPC in the stele can rescue the cpc mutant
phenotype suggest that epidermal cell differentiation can be controlled by the inner part of the root through the
known patterning genes (Kang et al., 2013). It is possible that WRKY75 operates in an analogous manner by
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
regulating gene expression in the epidermis in a non-cell autonomous manner. In this scenario WRKY75
regulates CPC expression at two levels. First, in the stele where both genes are expressed and second in the
epidermis through moving RNA/protein. WRKY75 seems to regulate root hair patterning by regulating only a
subset of the patterning genes. CPC and TRY are clearly repressed whereas other tested patterning genes
remain unaffected. Moreover, the binding of WRKY75 to the CPC promoter in yeast one hybrid assays
suggests a direct regulation rather than an indirect control through JKD/SCM. This idea is supported by our
finding that the levels of WER expression are not changed in wrky75 mutants or WRKY75 overexpression lines.
We speculate that WRKY75 functions as a modulator of root hair formation through the direct regulation of
CPC and possibly GL2. In wild type, WRKY75 contributes to the balance of the expression levels of the two
genes and thereby the number of root hairs. In wrky75 mutants the balance is shifted and the number of root
hairs increases in N-files. Also the reduction of root hairs in H-files in p35S:WRKY75 plants can be easily
explained by a reduction of CPC (and TRY) expression. In the light that WRKY75 mediates various
environmental responses including pathogen attack and phosphate starvation, this mechanism provides a
simple and effective way to modulate the root hair number in response to environmental stimuli.
MATERIAL and METHODS
Plant material, growth, root hair and cytological analysis
The following A. thaliana lines were used in this study: wrky75-25 (Encinas-Villarejo et al., 2009),
WRKY75RNAi (Devaiah et al., 2007) and cpc-2 (Kurata et al., 2005). Double mutants were created by crossing.
The homozygous lines were confirmed by PCR. The pGL2:GUS and pCPC:GUS lines (Pesch et al., 2013) in
p35S:WRKY75, WRKY75RNAi and wrky75-25 backgrounds were created by crossing with the respective Col
reporter lines. All lines are in Col-0 wild type background. Plants were transformed by the floral dip method
(Clough and Bent, 1998).
For root hair analyses, seeds were sterilized by adding 100% of ethanol followed by 4% HCL and washed 3
times with water, vernalized at 40C for 3 days in the dark, and planted on MS plates supplemented with 1%
sucrose. Seedlings were grown under long day conditions (16 hours light/ 8 hours dark) for 7 days. Plates were
positioned vertically to avoid root penetration in the media. Seedlings were fixed (50% methanol; 10% acetic
acid) at 4 0C for 24 hours, transferred to 80% ethanol for 2 hours, washed three times with water and analysed
by transmission light microscopy. The files were defined by their relative position to the cortical cells. For each
seedling, the number of root hairs was determined for 10 cells in the H-file and 10 cells in the N-position.
GUS staining was done as described previously (Vroemen et al., 1996).
Plasmid construction
The CDS of WRKY75 was cloned into pDONR201 amplified from Col-0 cDNA by Gateway® technology
(Invitrogen) using primers with attB sites (Table S1). The CDS of WER was amplified from Ler cDNA and
cloned with SalI and NotI restricion sites in pENTR1A. GUS-pDONR201 (Invitrogen, USA). The constructs
p35S:WRKY75 (pAMPAT-GW), pCPC:GUS (pCPC-pAMPAT), pGL2:GUS (pGL2-pAMPAT), WRKY75-pCACT2-attR, WER-pC-ACT2-attR, p35S:GUS (pAMPAT-GW), YFP-WRKY75 (pENSG-YFP), YFP-GUS
(pENSG-YFP) were created by LR recombination with the respective entry clones (Weinl et al., 2005; Wester
et al., 2009).
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
For pAMPAT-GW-pWRKY75:GUS:3’-WRKY75, the WRKY75 promoter was amplified using Asc1-pWRKY75
F and Xho1-pWRKY75 R primers (Table S1) and introduced in pJET1.2.b (Fermentas, USA). pWRKY75 was
recovered using Asc1/Xho1 and introduced to GUS-pAMPAT-GW to obtain pWRKY75:GUS (pAMPAT-GW).
The downstream 627 bps of WRKY75 were isolated with 3'WRKY75 F and 3'WRKY75 R (Table S1) and
introduced to pWRKY75:GUS (pAMPAT-GW) using Mss1.
For pWRKY75:YFP-WRKY75:3’-WRKY75 (pENSG) and pWRKY75:YFP-GUS:3’-WRKY75 (pENSG) the same
strategy was used to introduce pWRKY75 and 3’-WRKY75 in pENSG-YFP. The WRKY75 CDS and GUS CDS
were introduced in a second step by LR reaction (Clonetech, Japan).
For pSCR:GPFer (pAMPAT), first the SCR promoter was amplified using Asc1-pWRKY75 F and Xho1pWRKY75 R primers (Table S1) and introduced in pJET1.2.b (Fermentas, USA). pSCR was recovered using
Asc1/Xho1 and introduced to GFPer-pAMPAT-GW to obtain pSCR:GFPer (pAMPAT-GW).
The pSCR:YFP-GUS (pENSG) and pSCR:YFP-WRKY75 (pENSG) were created in a similar strategy to
pWRKY75:YFP-WRKY75:3’-WRKY75.
qRT-PCR
Using the stereomicroscope at 10X magnification, the root hair patterning zone (the area where the first root
hairs appear in the differentiation zone) was determined. Seedlings were cut using a sharp blade to collect the
root part containing the patterning zone including the root cap. RNA extraction and real time PCR were
performed as previously described (Kwon et al., 2006). Relative mRNA was normalized to the concentration of
EF1α mRNA. The expression levels of genes of wild type plants were set to one and subsequently used to
calculate the relative changes of genes in wrky75-25, WRKY75RNAi and p35S:WRKY75. The used primers are
listed in Table S1.
Yeast one-hybrid
Vectors containing the CPC promoter fragment "wild type" and "mutated W box" were created by sequentially
cloning of three equal promoter fragments differing in the attached restriction sites (EcoRI and KpnI, KpnI and
BamHI, BamHI and XbaI) in puc18. The fragments were either produced by PCR or ordered as long
oligonucleotides. The trimers were introduced in the EcoRI and XbaI sites in pHISi (Invitrogen).
Yeast one-hybrid analyses were carried out using the MATCHMAKER One-Hybrid System (Clontech, Japan).
First, the yeast strain YM4271 was transformed with pCPC(-459 to -378)-pHISi or pCPC(-459 to -378,
mutated)-pHISi, respectively. Second, the selected vectors expressing the GAL4-activation domain fusion
proteins were transformed into YM4271 carrying the promoter fragments and grown on medium without uracil
and leucine (-LU). Finally, the binding activities were determined by the ability of yeast to grow on selective
media –HLU (medium without histidine, leucine and uracil). Three single colonies from each combination
were tested. pC-ACT2-ccdB (EV) served as a negative control and was described before (Pesch et al., 2013).
Microscopy and image acquisition
Fluorescence microscopy and bright field DIC microscopy was done with a Leica DMRB 5500 microscope
equipped with the Leica Application Software AF (Leica Microsystems, Germany). Pictures of unstained roots
were generated by light microscopy as described previously (H. Failmezger, 2013) and GUS stained roots were
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
acquired using a Leica DMRA microscope (Leica Microsystems) equipped with DISKUS software (Carl H.
Hilgers-Technisches Büro).
Confocal laser-scanning microscopy (CLSM) was performed using a Leica TCS-SP8 confocal microscope
equipped with the Leica LAS AF software or Zeiss Meta 510 equipped with ZEN 2012 software (Germany).
For imaging a Leica 1.2 NA, 63x water objective was used. The propidium iodide staining was excited using a
white light laser (WLL) at 561 nm, the GFP/YFP signal was excited using an argon laser at 488/514 nm.
Pictures were analysed with Imaris 7.0 (Bitplane). For the protein localization, seedlings were stained with
100µg/ml of propidium iodide for 1 min followed by washing the samples with water. The analyses were done
by sequential scanning starting with the respective higher wavelength.
Accession numbers
TTG1 (AT5G24520, Tair accession locus 2153914), TRY (AT5G53200, Tair accession locus 2163766), GL2
(AT1G79840, Tair accession locus 2017874), CPC (AT2G46410, Tair accession locus 2005503), WER
(AT5G14750, Tair accession locus 2185470), WRKY75 (AT5G13080, Tair accession locus 2179862), SCR
(AT3G54220, Tair accession locus 2080345), RSL4 (AT1G27740, Tair accession locus 2199221).
ACKNOWLEDGEMENTS
We thank Birgit Kernebeck for excellent technical assistance. This work was supported by CEPLAS EXC
1028 to M.H. and an IMPRS fellowship to L.R.
AUTHOR CONTRIBUTIONS
L. R, M.P., C.J, A.C.S did the experiments, L.R., M.P., A.S and M.H: experimental design, L.R and M.H.
paper writing.
FIGURE LEGENDS
Fig. 1: Root hair phenotypes in wild type and mutants.
A) Wild type root. B) wrky75-25 root with ectopic root hairs in non-hair positions indicated by arrows. C)
WRKY75RNAi root displaying ectopic root hairs. D) p35S:WRKY75 lacking root hairs in hair positions
indicated by dashed arrows. Scale bar = 100 µm.
Fig. 2: Transcriptional regulation of root hair patterning genes by WRKY75.
The relative expression of patterning genes was compared by Real Time PCR (three biological samples, each
three technical repeats). Wild type was set to one and the expression changes in the mutants and
overexpression line plotted. Changes significantly different from wild type (Student’s t-test, P< 0.05) are
marked with “*”. Error bars represent the standard deviation.
Fig. 3: Histochemical GUS expression analysis of CPC, GL2 and WRKY75 in roots. Expression of CPC and
GL2 is monitored in pCPC:GUS (A-D), pGL2:GUS transgenic plants (E-H). The genetic background is
indicated below each image (A-H). Expression of WRKY75 is monitored in pWRKY75:GUS:3‘-WRKY75 (I,J)
and pWRKY75:YFP-GUS:3‘-WRKY75 wild type Col-0 background (K,L). Scale bar: 50 μm.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 4: Yeast one-hybrid studies showing WRKY75 binding to a CPC promoter fragment. A) 80 bp promoter
sequence of CPC used for the yeast one hybrid assay. W box is highlighted grey, WER binding site is
underlined. B) Yeast one hybrid assay. Yeast strain YM4271 carrying a prey construct with three tandem
repeats of an 80 bp (-459 to -378) of the CPC promoter was co-transformed with WER (positive control) and
WRKY75 fusions to GAL4 activation domain or with an empty vector (EV, negative control). Binding to wild
type sequence of the promoter fragment (W box) was compared to a fragment in which the W box was mutated
(mW box). –LU: media lacking leucine and uracil, –HLU: media lacking histidine, leucine and uracil.
Fig. 5: Genetic analysis of WRKY75
Light micrographs of roots in wild type (A), cpc-2 wrky75-25 (B), and cpc-2 p35S:WRKY75 (C). Scale bar =
50μm.
Fig. 6. Intercellular motility of WRKY75.
A) Root of a wrky75-25 plant carrying pWRKY75:YFP-WRKY75:3‘-WRKY75. B) Root of a Col-0 plant
carrying pWRKY75:YFP-GUS:3‘-WRKY75. Squares mark the region shown at a higher magnification. Black
stars mark lateral root cap cells, white stars label epidermal cells, red stars mark cortical cells. Scale bar= 40
µm. Note: high laser intensity and high brightness/ contrast modifications were applied on images to allow the
visualization of the signal ,resulting in overexposure to the outer layers (lateral root cap cells).
Fig. 7: Movement of WRKY75 when expressed under the SCR promoter.
A) Root of a wrky75-25 plant carrying pSCR:YFP-WRKY75. B) Root of Col-0 plant carrying pSCR:GFPer.
Squares mark the region shown at a higher magnification. Black stars mark lateral root cap cells, white stars
label epidermal cells, red stars mark cortical cells. Scale bar=40 µm.
REFERENCES
Bernhardt, C., Zhao, M., Gonzalez, A., Lloyd, A., and Schiefelbein, J. (2005). The bHLH
genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell
patterning in the Arabidopsis root epidermis. Development 132, 291-298.
Bernhardt, C., Lee, M.M., Gonzalez, A., Zhang, F., Lloyd, A., and Schiefelbein, J.
(2003). The bHLH genes GLABRA3 (GL3) andENHANCER OF GLABRA3 (EGL3)
specify epidermal cell fate in the Arabidopsis root. Development 130, 6431-6439.
Birnbaum, K., Shasha, D.E., Wang, J.Y., Jung, J.W., Lambert, G.M., Galbraith, D.W.,
and Benfey, P.N. (2003). A gene expression map of the Arabidopsis root. Science
302, 1956-1960.
Ciolkowski, I., Wanke, D., Birkenbihl, R.P., and Somssich, I.E. (2008). Studies on DNAbinding selectivity of WRKY transcription factors lend structural clues into WRKYdomain function. Plant Mol Biol 68, 81-92.
Clough, S., and Bent, A. (1998). Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal 16, 735-743.
Devaiah, B.N., Karthikeyan, A.S., and Raghothama, K.G. (2007). WRKY75 transcription
factor is a modulator of phosphate acquisition and root development in Arabidopsis.
Plant Physiol 143, 1789-1801.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K., and
Scheres, B. (1993). Cellular organisation of the Arabidopsis thaliana root.
Development 119, 71-84.
Dolan, L., Duckett, C.M., Grierson, C., Linstead, P., Schneider, K., Lawson, E., Dean,
C., Poethig, S., and Roberts, K. (1994). Clonal relationships and cell patterning in
the root epidermis of Arabidopsis. Development 120, 2465-2474.
Dong, J., Chen, C., and Chen, Z. (2003). Expression profiles of the Arabidopsis WRKY
gene superfamily during plant defense response. Plant Mol Biol 51, 21-37.
Encinas-Villarejo, S., Maldonado, A.M., Amil-Ruiz, F., de los Santos, B., Romero, F.,
Pliego-Alfaro, F., Munoz-Blanco, J., and Caballero, J.L. (2009). Evidence for a
positive regulatory role of strawberry (Fragaria x ananassa) Fa WRKY1 and
Arabidopsis At WRKY75 proteins in resistance. J Exp Bot 60, 3043-3065.
Esch, J.J., Chen, M., Sanders, M., Hillestad, M., Ndkium, S., Idelkope, B., Neizer, J., and
Marks, M.D. (2003). A contradictory GLABRA3 allele helps define gene interactions
controlling trichome development in Arabidopsis. Development 130, 5885-5894.
Eulgem, T., Rushton, P.J., Schmelzer, E., Hahlbrock, K., and Somssich, I.E. (1999).
Early nuclear events in plant defence signalling: rapid gene activation by WRKY
transcription factors. Embo J 18, 4689-4699.
Galway, M.E., Masucci, J.D., Lloyd, A.M., Walbot, V., Davis, R.W., and Schiefelbein,
J.W. (1994). The TTG gene is required to specify epidermal cell fate and cell
patterning in the Arabidopsis root. Dev Biol 166, 740-754.
Grebe, M. (2012). The patterning of epidermal hairs in Arabidopsis--updated. Curr Opin
Plant Biol 15, 31-37.
Guo, Y., and Gan, S. (2004). Transcriptome of Arabidopsis leaf senescence. Plant Cell
Environ 27, 521–549.
H. Failmezger, B.J., A. Schrader, M. Hülskamp, A. Tresch. (2013). Semi-automated 3D
leaf reconstruction and analysis of trichome patterning from light microscopic images.
Plos computational biology.
Hassan, H., Scheres, B., and Blilou, I. (2010). JACKDAW controls epidermal patterning in
the Arabidopsis root meristem through a non-cell-autonomous mechanism.
Development 137, 1523-1529.
Helariutta, Y., Fukaki, H., Wysocka-Diller, J., Nakajima, K., Jung, J., Sena, G., Hauser,
M.T., and Benfey, P.N. (2000). The SHORT-ROOT gene controls radial patterning
of the Arabidopsis root through radial signaling. Cell 101, 555-567.
Ishida, T., Kurata, T., Okada, K., and Wada, T. (2008). A genetic regulatory network in
the development of trichomes and root hairs. Annu Rev Plant Biol 59, 365-386.
Kang, Y.H., Song, S.K., Schiefelbein, J., and Lee, M.M. (2013). Nuclear trapping controls
the position-dependent localization of CAPRICE in the root epidermis of Arabidopsis.
Plant Physiol 163, 193-204.
Kirik, V., Simon, M., Hulskamp, M., and Schiefelbein, J. (2004a). The ENHANCER OF
TRY AND CPC1 (ETC1) gene acts redundantly with TRIPTYCHON and CAPRICE
in trichome and root hair cell patterning in Arabidopsis. Dev Biol 268, 506-513.
Kirik, V., Simon, M., Wester, K., Schiefelbein, J., and Hulskamp, M. (2004b).
ENHANCER of TRY and CPC 2 (ETC2) reveals redundancy in the region-specific
control of trichome development of Arabidopsis. Plant Mol Biol 55, 389-398.
Kurata, T., Ishida, T., Kawabata-Awai, C., Noguchi, M., Hattori, S., Sano, R., Nagasaka,
R., Tominaga, R., Koshino-Kimura, Y., Kato, T., Sato, S., Tabata, S., Okada, K.,
and Wada, T. (2005). Cell-to-cell movement of the CAPRICE protein in Arabidopsis
root epidermal cell differentiation. Development 132, 5387-5398.
Kwak, S.H., Shen, R., and Schiefelbein, J. (2005). Positional signaling mediated by a
receptor-like kinase in Arabidopsis. Science 307, 1111-1113.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Kwon, C.S., Hibara, K., Pfluger, J., Bezhani, S., Metha, H., Aida, M., Tasaka, M., and
Wagner, D. (2006). A role for chromatin remodeling in regulation of CUC gene
expression in the Arabidopsis cotyledon boundary. Development 133, 3223-3230.
Lan, P., Li, W., Lin, W.D., Santi, S., and Schmidt, W. (2013). Mapping gene activity of
Arabidopsis root hairs. Genome Biol 14, R67.
Laurenzio, L.D., Wysocka-Diller, J., Malamy, J.E., Pysh, L., Helariutta, Y., Freshour,
G., Hahn, M.G., Feldmann, K.A., and Benfey, P.N. (1996). The SCARECROW
gene regulates an asymetric cell division that is essential for generating the radial
organization of the Arabidopsis root. Cell 86, 423-433.
Lee, M.M., and Schiefelbein, J. (1999). WEREWOLF, a MYB-related protein in
Arabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell 99,
473-483.
Masucci, J.D., and Schiefelbein, J.W. (1996). Hormones act downstream of TTG and GL2
to promote root hair outgrowth during epidermis development in the Arabidopsis root.
Plant Cell 8, 1505-1517.
Masucci, J.D., Rerie, W.G., Foreman, D.R., Zhang, M., Galway, M.E., Marks, M.D., and
Schiefelbein, J.W. (1996). The homeobox gene GLABRA 2 is required for positiondependent cell differentiation in the root epidermis of Arabidopsis thaliana.
Development 122, 1253-1260.
Mylona, P., Linstead, P., Martienssen, R., and Dolan, L. (2002). SCHIZORIZA controls
an asymmetric cell division and restricts epidermal identity in the Arabidopsis root.
Development 129, 4327-4334.
Pesch, M., and Hulskamp, M. (2004). Creating a two-dimensional pattern de novo during
Arabidopsis trichome and root hair initiation. Current Opinion in Genetics &
Development 14, 422–427.
Pesch, M., Schultheiss, I., Digiuni, S., Uhrig, J.F., and Hulskamp, M. (2013). Mutual
control of intracellular localisation of the patterning proteins AtMYC1, GL1 and
TRY/CPC in Arabidopsis. Development 140, 3456-3467.
Rushton, P.J., Macdonald, H., Huttly, A.K., Lazarus, C.M., and Hooley, R. (1995).
Members of a new family of DNA-binding proteins bind to a conserved cis-element in
the promoters of alpha-Amy2 genes. Plant Mol Biol 29, 691-702.
Ryu, K.H., Kang, Y.H., Park, Y.H., Hwang, I., Schiefelbein, J., and Lee, M.M. (2005).
The WEREWOLF MYB protein directly regulates CAPRICE transcription during cell
fate specification in the Arabidopsis root epidermis. Development 132, 4765-4775.
Savage, N.S., Walker, T., Wieckowski, Y., Schiefelbein, J., Dolan, L., and Monk, N.A.
(2008). A mutual support mechanism through intercellular movement of CAPRICE
and GLABRA3 can pattern the Arabidopsis root epidermis. PLoS Biol 6, e235.
Schellmann, S., Schnittger, A., Kirik, V., Wada, T., Okada, K., Beermann, A.,
Thumfahrt, J., Jurgens, G., and Hulskamp, M. (2002). TRIPTYCHON and
CAPRICE mediate lateral inhibition during trichome and root hair patterning in
Arabidopsis. Embo J. 21, 5036-5046.
Schiefelbein, J. (2003). Cell-fate specification in the epidermis: a common patterning
mechanism in the root and shoot. Curr. Opin. Plant Biol. 6, 74-78.
Schiefelbein, J., Kwak, S.H., Wieckowski, Y., Barron, C., and Bruex, A. (2009). The gene
regulatory network for root epidermal cell-type patterning. J. Exp. Bot 60, 1515-1521.
Schiefelbein, J.W. (2000). Constructing a plant cell. The genetic control of root hair
development. Plant Physiol 124, 1525-1531.
Simon, M., Lee, M.M., Lin, Y., Gish, L., and Schiefelbein, J. (2007). Distinct and
overlapping roles of single-repeat MYB genes in root epidermal patterning. Dev Biol
311, 566-578.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Szymanski, D.B., Jilk, R.A., Pollock, S.M., and Marks, M.D. (1998). Control of GL2
expression in Arabidopsis leaves and trichomes. Development 125, 1161-1171.
ten Hove, C.A., Willemsen, V., de Vries, W.J., van Dijken, A., Scheres, B., and Heidstra,
R. (2010). SCHIZORIZA encodes a nuclear factor regulating asymmetry of stem cell
divisions in the Arabidopsis root. Curr Biol 20, 452-457.
Tominaga, R., Iwata, M., Okada, K., and Wada, T. (2007). Functional analysis of the
epidermal-specific MYB genes CAPRICE and WEREWOLF in Arabidopsis. Plant
Cell 19, 2264-2277.
Tominaga-Wada, R., Ishida, T., and Wada, T. (2011). New insights into the mechanism of
development of Arabidopsis root hairs and trichomes. Int Rev Cell Mol Biol 286, 67106.
Vroemen, C.W., Langeveld, S., Mayer, U., Ripper, G., Jurgens, G., Van Kammen, A.,
and De Vries, S.C. (1996). Pattern Formation in the Arabidopsis Embryo Revealed by
Position-Specific Lipid Transfer Protein Gene Expression. Plant Cell 8, 783-791.
Wada, T., Tachibana, T., Shimura, Y., and Okada, K. (1997). Epidermal cell
differentiation in Arabidopsis determined by a Myb homolog, CPC. Science 277,
1113-1116.
Wada, T., Kurata, T., Tominaga, R., Koshino-Kimura, Y., Tachibana, T., Goto, K.,
Marks, M.D., Shimura, Y., and Okada, K. (2002). Role of a positive regulator of
root hair development, CAPRICE, in Arabidopsis root epidermal cell differentiation.
Development 129, 5409-5419.
Walker, A.R., Davison, P.A., Bolognesi-Winfield, A.C., James, C.M., Srinivasan, N.,
Blundell, T.L., Esch, J.J., Marks, M.D., and Gray, J.C. (1999). The
TRANSPARENT TESTA GLABRA1 Locus, Which Regulates Trichome Differentiation
and Anthocyanin Biosynthesis in Arabidopsis, Encodes a WD40 Repeat Protein. Plant
Cell 11, 1337-1349.
Weinl, C., Marquardt, S., Kuijt, S.J., Nowack, M.K., Jakoby, M.J., Hulskamp, M., and
Schnittger, A. (2005). Novel Functions of Plant Cyclin-Dependent Kinase Inhibitors,
ICK1/KRP1, Can Act Non-Cell-Autonomously and Inhibit Entry into Mitosis. Plant
Cell 17, 1704-1722.
Wester, K., Digiuni, S., Geier, F., Timmer, J., Fleck, C., and Hulskamp, M. (2009).
Functional diversity of R3 single-repeat genes in trichome development. Development
136, 1487-1496.
Yi, K., Menand, B., Bell, E., and Dolan, L. (2010). A basic helix-loop-helix transcription
factor controls cell growth and size in root hairs. Nat Genet 42, 264-267.
Table 1. Root hair numbers in the patterning zone of the primary roots. Ten 7-day old A. thaliana plants were
analysed for each treatment. Values represent three biological replicates (percentage ± s.d.). P value < 0.05
(Mann-Whitney test).
Root hair position
Genotype
wt (Col-0)
Non-root hair position
Root hair cell
Non-root hair
Root hair cell
Non-root hair
(%)
cells (%)
(%)
cells (%)
95 ± 6.0
5.0 ± 6.0
0.3 ± 1.5
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
99.7 ± 1.5
99 ± 3.6
1.0 ± 3.6
25 ± 9.6
75 ± 9.6
96 ± 5.8
4.0 ± 5.8
29 ± 6.4
71 ± 6.4
70 ± 9.7
30 ± 9.7
0.0 ± 100
100 ± 100
34 ± 11.0
66 ± 11.0
0.0 ± 100
100 ± 100
39 ± 6.4
61 ± 6.4
0.0 ± 100
100 ± 100
21 ± 8.5
79 ± 8.5
0.0 ± 100
100 ± 100
wrky75-25
WRKY75 RNAi
p35S:WRKY75
cpc-2
cpc-2 wrky75-25
p35S:WRKY75 cpc
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 1
A
B
C
D
Fig. 1: Root hair phenotypes in wild type and mutants.
A) Wild type root. B) wrky75-25 root with ectopic root hairs in non-hair
positions indicated by arrows. C) WRKY75RNAi root displaying ectopic
root hairs. D) p35S:WRKY75 lacking root hairs in hair positions indicated
by dashed arrows. Scale bar = 100 µm.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 2
wrky75-25
wt
WRKY75 RNAi
p35S:WRKY75
3.5
*
*
Relative mRNA amount
3
2.5
*
2
*
1.5
*
1
0.5
*
*
*
*
*
*
*
0
GL2
TTG1
WER
CPC
TRY
RSL4
Fig. 2: Transcriptional regulation of root hair patterning genes by WRKY75.
The relative expression of patterning genes was compared by Real Time PCR (three
biological samples, each three technical repeats). Wild type was set to one and the
expression changes in the mutants and overexpression line plotted. Changes
significantly different from wild type (Student’s t-test, P< 0.05) are marked with “*”.
Error bars represent the standard deviation.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
A
B
D
C
pCPC:GUS
Fig. 3
wt
WRKY75 RNAi
F
G
p35S:WRKY75
H
pGL2:GUS
E
wrky75-25
I
wrky75-25
J
WRKY75 RNAi
PWRKY75:YFP-GUS:
3‘-WRKY75
pWRKY75:GUS:
3‘-WRKY75
wt
p35S:WRKY75
K
L
Fig. 3: Histochemical GUS expression analysis of CPC, GL2 and WRKY75 in
roots. Expression of CPC and GL2 is monitored in pCPC:GUS (A-D), pGL2:GUS
transgenic plants (E-H). The genetic background is indicated below each image (AH). Expression of WRKY75 is monitored in pWRKY75:GUS:3‘-WRKY75 (I,J) and
pWRKY75:YFP-GUS:3‘-WRKY75 wild type Col-0 background (K,L). Scale bar: 50
µm.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 4
A
a
wild type CPC
AACGAGGAATTTTTACAACCGCAAGTCAAAGGATTTAAAATAAGTAGTTATGGTTGTATCTGTCGTTCTTCTTTCTCTAT
mutated WBOX
AACGAGGAATTTTTACAACCGCAACCCGGAGGATTTAAAATAAGTAGTTATGGTTGTATCTGTCGTTCTTCTTTCTCTAT
B
-LU
mWBOX
-HLU
WBOX
mWBOX
WBOX
WER
WRKY75
EV
Fig. 4: Yeast one-hybrid studies showing WRKY75 binding to a CPC promoter fragment.
A) 80 bp promoter sequence of CPC used for the yeast one hybrid assay. WBOX is
highlighted grey, WER binding site is underlined. B) Yeast one hybrid assay. Yeast strain
YM4271 carrying a prey construct with three tandem repeats of an 80 bp (-458 to -378) of
the CPC promoter was co-transformed with WER (positive control) and WRKY75 fusions
to GAL4 activation domain or with an empty vector (EV, negative control). Binding to wild
type sequence of the promoter fragment (WBOX) was compared to a fragment in which
the WBOX was mutated (mWBOX). –LU: media lacking leucine and uracil, –HLU: media
lacking histidine, leucine and uracil.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 5
A
B
C
Fig. 5: Genetic analysis of WRKY75
Light micrographs of roots in wild type (A), cpc-2 wrky75-25 (B), and cpc-2
p35S:WRKY75 (C). Scale bar = 50µm.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
pWRKY75:YFPGUS:3‘-WRKY75
pWRKY75:YFPWRKY75:3-‘WRKY75
Fig. 6
B
** *
* * *
*
*
*
Higher
magnification
Overlay
Propidium iodide /YFP
*
**
Cross section
Cross section
Higher
magnification
Overlay
Propidium iodide / YFP
A
* *
*
* *
*
Fig. 6. Intercellular motility of WRKY75.
A) Root of a wrky75-25 plant carrying pWRKY75:YFP-WRKY75:3‘-WRKY75. B)
Root of a Col-0 plant carrying pWRKY75:YFP-GUS:3‘-WRKY75. Squares mark the
region shown at a higher magnification. Black stars mark lateral root cap cells,
white stars label epidermal cells, red stars mark cortical cells. Scale bar= 40 µm.
Note: high laser intensity and high brightness/ contrast modifications were applied
on images to allow the visualization of the signal ,resulting in overexposure to the
outer layers (lateral root cap cells).
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Fig. 7
pSCR:YFP-WRKY75
pSCR:GFPer
*
* *
*
*
*
*
Higher
magnification
**
Overlay
Propidium iodide / GFP
B
Cross section
Cross section
Higher
magnification
Overlay
Propidium iodide / YFP
A
***
* * *
*
*
*
Fig. 7: Movement of WRKY75 when expressed under the SCR promoter.
A) Root of a wrky75-25 plant carrying pSCR:YFP-WRKY75. B) Root of Col-0
plant carrying pSCR:GFPer. Squares mark the region shown at a higher
magnification. Black stars mark lateral root cap cells, white stars label
epidermal cells, red stars mark cortical cells. Scale bar=40 µm.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.