Download View - OhioLINK Electronic Theses and Dissertations Center

MIAMI UNIVERSITY
The Graduate School
Certificate for Approving the Dissertation
We hereby approve the Dissertation
of
Kuntal De
Candidate for the Degree:
Doctor of Philosophy
__________________________________________
Christopher A. Makaroff, Advisor
__________________________________________
Michael Kennedy, Reader
__________________________________________
Carole Dabney-Smith, Reader
__________________________________________
David Tierney, Reader
__________________________________________
Richard Moore, Graduate School Representative
ABSTRACT
ARABIDOPSIS WAPL IS ESSENTIAL FOR THE PROPHASE REMOVAL OF
COHESIN DURING MEIOSIS AND ANTAGONIZES THE ROLE OF CTF7
by Kuntal De
Sister chromatid cohesion, which is mediated by the cohesin complex, is essential for the
proper segregation of chromosomes in mitosis and meiosis. The establishment of stable
sister chromatid cohesion occurs during DNA replication and involves acetylation of the
complex by the acetyltransferase CTF7. The majority of cohesin complexes are typically
removed from the chromosomes during prophase. Studies in fly, human and yeast have
shown that this process involves the WAPL and PDS5 mediated opening of the cohesin
ring at the junction between the SMC3 ATPase domain and the N-terminal domain of
cohesin’s -kleisin subunit. We report here the isolation and detailed characterization of
WAPL in Arabidopsis thaliana. We show that Arabidopsis contains two WAPL genes,
which share overlapping functions. Analysis of plants in which both WAPL genes have
been inactivated by T-DNA insertions showed that unlike the situation in flies and
vertebrate cells, WAPL is not an essential protein in plants. Inactivation of Arabidopsis
WAPL has little effect on plant growth, but does result in a significant reduction in male
and female fertility. The removal of cohesin from chromosomes during meiotic prophase
is blocked in Atwapl mutants resulting in chromosome bridges, broken chromosomes and
uneven chromosome segregation. We further show that inactivation of both Arabidopsis
WAPL proteins rescued Atctf7 sterility. Inactivation of both WAPL and CTF7 restores
the cohesin release during prophase, but prolonged heterochromatin association is still
abnormal in Atwapl1.1wapl2ctf7 meiocytes. However, pairing and synapsis is fully
recovered in Atwapl1.1wapl2 plants. Our results demonstrate that WAPL is important
for the timely release of cohesion during meiosis and that inactivation of WAPL
eliminates the requirement for SMC3 acetylation by CTF7
In contrast, while subtle mitotic alterations are observed in some somatic cells, cohesin
complexes appear to be removed normally in wapl double homozygous mutant and
waplctf7 triple homozygous mutant plants. Taken together, our results demonstrate that
WAPL plays a critical role in meiosis and suggests that mechanisms involved in the
prophase removal of cohesin may vary between mitosis and meiosis in plants.
Meiosis involves a number of highly coordinated events that are regulated by
transcriptional and checkpoint control mechanisms. A large number of Arabidopsis
meiotic mutants have been studied, but very little is known about the regulation of
meiosis in plants. The characterization of the male meiocyte death1 (mmd1) mutant in
which male meiocytes undergo apoptosis during prophase I was previously reported.
MMD1 is a PHD (Plant Homeo Domain) containing protein. In addition to MMD1 there
are three other MMD-like genes in Arabidopsis, which also contain PHD fingers. MS1
(male sterility 1) is required for pollen development and appears to be a transcription
factor. Two other MMD1-like proteins MMDL1 and MMDL2 had yet to be
characterized. In order to better understand the role of MMD1 in meiosis, we have
investigated the role(s) of MMDL1 and MMDL2. Plants homozygous for mutations in
either gene show no phenotype, but interestingly plants heterozygous for each mutation
and double heterozygous plants exhibit defects in seed development and pollen abortion.
In double heterozygous plants there is no sign of endosperm or embryo development.
Therefore, proper levels of MMDL-1 and MMDL-2 and potentially the ratio of MMDL1
and MMDL2 appear to be essential for pollen,female gametophyte and embryo
development.
ARABIDOPSIS WAPL IS ESSENTIAL FOR THE PROPHASE REMOVAL OF
COHESIN DURING MEIOSIS AND ANTAGONIZES THE ROLE OF CTF7
A DISSERTATION
Submitted to the Faculty of
Miami University in partial
fulfillment of the requirements
for the degree of
Doctor of Philosophy
Department of Chemistry and Biochemistry
by
Kuntal De
Miami University
Oxford, Ohio
2014
Dissertation Director: Christopher A. Makaroff
Table of Contents
1.1 Overview of Mitosis and Meiosis
2
1.2 Homologous chromosome Pairing
4
1.3 Synapsis and Recombination
5
1.4 Cohesin Proteins
6
1.5 The Core Cohesin Complex
7
1.6 Cohesin Loading
9
1.7 Cohesion Establishment and Maintenance
10
1.8 Cohesion Removal
13
1.9 Cohesin in Double Strand Break Repair
16
1.10 PHD Finger Proteins
16
1.11 Sections of the dissertation
17
1.12 References
20
Chapter 2 Arabidopsis WAPL is Essential for the Prophase Removal of Cohesin
During Meiosis
36
2.1 Abstract
37
2.2 Introduction
37
2.3 Materials and Methods
39
2.4 Results
41
2.5 Discussion
69
2.6 References
75
Chapter 3 Arabidopsis CTF7 and WAPL1/2 interact during plant development and control
vegetative growth and chromosome condensation during meiosis
83
3.1 Abstract
84
3.2 Introduction
84
3.3 Materials and Methods
87
3.4 Results
89
3.5 Discussion
103
3.6 References
106
ii
Chapter 4 Characterization of MMD-like Genes and Their Roles in Chromosome
Biology
113
4.1 Abstract
114
4.2 Introduction
114
4.3 Materials and Methods
116
4.4 Results
119
4.5 Discussion
136
4.6 References
138
Chapter 5 Concluding Remarks
143
5.1
Arabidopsis WAPL is Essential for the Prophase Removal of Cohesin During
Meiosis
143
5.2 WAPL antagonizes the role of Arabidopsis CTF7
145
5.3 MMDL-1 and MMDL-2 encode PHD finger proteins and have overlapping
functions
147
5.4 References
148
iii
List of Tables:
Table 4.1 Percentage of seed abortion in different heterozygous lines
127
Table 4.1 Percentage of seed abortion in different double heterozygous lines
128
iv
List of Figures:
Figure 1.1 Overview of mitosis and meiosis
3
Figure 1.2 General model of homologous pairing in meiosis
4
Figure 1.3 Model of synaptonemal complex structure
6
Figure 1.4 The cohesin complex and proposed models for cohesin
establishment
11
Figure 1.5 Proposed model for release of cohesin during meiosis
14
Figure 2.1 Arabidopsis WAPL protein and gene structures
42
Figure 2.2 Atwapl1.1wapl2 plants exhibit reduced fertility
44
Figure 2.3 AtWAPL1 and AtWAPL2 show similar expression patterns
46
Figure 2.4 Construct is shown 35S promoter and restriction sites for enzyme cleavage
in 5941 plasmid
47
Figure 2.5 Female gametophyte development is altered in Atwapl1.1wapl2
plants
48
Figure 2.6 Atwapl1.1wapl2 plants exhibit defects during male meiosis
51
Figure 2.7 Atwapl1.1wapl2 meiocytes exhibit nonspecific association of
centromeres
53
Figure 2.8 Atwapl1.1wapl2 meiocytes exhibit alterations in homologous chromosome
pairing
55
Figure 2.9 Localization of ASY1 in wild type and Atwapl1.1wapl2
mutant meiocytes
56
Figure 2.10 Localization of ZYP1 in wild type and Atwapl1.1wapl2 mutant
meiocytes
57
Figure 2.11 Cohesin release is delayed in Atwapl1.1wapl2 meiocytes
59
Figure 2.12 WAPL is essential for proper meiotic spindle assembly and structure
61
Figure 2.13 Spindle abnormalities observed in Atwapl1.1wapl2 male meiocytes at
metaphase I
62
Figure 2.14 Embryonic patterning is defective in the seeds of Atwapl1.1wapl2
plants
63
Figure 2.15 Additional embryo alterations observed in Atwapl1.1wapl2 siliques
64
Figure 2.16 Atwapl1.1wapl2 plants show defects in mitosis
65
v
Figure 2.17 Cohesin is released normally in Atwapl1.1wapl2 root tip cells
66
Figure 2.18 Inactivation of AtWAPL rescues atctf7 mutants
68
Figure 3.1 Inactivation of WAPL rescues plant growth in ctf7 mutants
90
Figure 3.2 Alexander staining show severe defects in tetrad formation
91
Figure 3.3 Atwapl1.1wapl2ctf7 female gametophyte show severe defects at an early stage
in female gametophytes
93
Figure 3.4 Arabidopsis wapl1.1wapl2ctf7 plants exhibit defects during male meiosis 94
Figure 3.5 Male meiotic chromosomes from wapl1.1wapl2ctf7 show partial recovery of
centromere organization
96
Figure 3.6 Loading of synaptonemal complex proteins is normal in meiotic chromosomes
of the Atwapl1.1wapl2ctf7 mutant
99
Figure 3.7 Cohesin establishment is recovered in wapl1.1wapl2ctf7 meiocytes
100
Figure 3.8 The radial microtubule system is severely abnormal due to inactivation of
WAPL1/2 and CTF7
102
Figure 4.1 Gene Structure of AtMMDL1 and AtMMDL2
120
Figure 4.2 Genevestigator analysis of MMDL1 and MMDL2
121
Figure 4.3 Plant morphology
123
Figure 4.4 Alexander staining showing viable pollen (red) and aborted (green)
124
Figure 4.5 Alexander staining showing the pollen abortion rescued by dosage effect 126
Figure 4.6 Reciprocal backrossing MMD-L2-2+/- plant with wild type plants
127
Figure 4.7 Proper levels of MMDL2 is essential for embryo development
129
Figure 4.8 Construct is shown 35S promoter and restriction sites for enzyme cleavage in
pFGC plasmid
130
Figure 4.9 MMDL2 RNAi plants exhibit defects during male meiosis
131
Figure 4.10 The DMC1 promoter construct with restriction sites for enzyme cleavage
and Alexander staining on MMDL2 RNAi plants
133
Figure 4.11 Cloning and purification of MMD1PHD
135
Figure 4.12 MMD1-PHD finger proteins binds histone H2A
135
Figure 5.1: Proposed model of prophase pathway in plants
146
vi
Dedication
The dissertation is dedicated to my loving and supportive wife, Debjani Pal, to my always
encouraging and supportive parents Mrs. Raka De and Mr. Tapan Kumar De and to my
In-Laws Mr. Debesranjan Pal and Mrs. Shila Pal .
vii
Acknowledgments
Above all, I would like to thank my advisor Dr. Christopher A. Makaroff. The
dissertation would not have been possible without his help and support. His great advice,
support and constant encouragement have been invaluable on my academic level, for
which I am extremely grateful.
I would like to thank my wife Debjani for her personal support and patience at all times. I
would also like to thank my parents who provided me lots of support throughout my
doctoral degree. I would also like to thank Dr. John Hawes for his advice and guidance
on instrumentation at CBFG. Many thanks to Dr. Yuan Li for his technical assistance on
microscopy. I would like to thank my committee members, Dr. Mike Kennedy, Dr.
Carole Dabney Smith, Dr. David Tierney and Dr. Richard Moore for their constructive
criticism and time. I would like to thank my labmates for their assistance and friendship.
Lastly, I would like to acknowledge the financial and academic support of Miami
University.
viii
Chapter 1: Introduction
1
1.1 Overview of Mitosis and Meiosis
During the process of mitosis a single cell division produces two daughter cells from a single
parent cell and each daughter cell has the same genetic information as the parent cell (1, 2).
Mitosis produces a pair of sister chromatids from each chromosome. Meiosis is a unique type of
cellular division required for sexual reproduction in animals, plants and fungi. During meiosis
the number of chromosomes is reduced to half the original number and hence it is termed as a
reductional division. The diploid set of chromosomes is reduced to haploid. Meiosis is more
complicated than mitosis and the division happens in two stages, meiosis I and meiosis II. The
accurate replication and distribution of chromosomes during meiosis and mitosis ensures
genomic stability. Genomic stability is ensured by the accurate distribution of chromosomes
during mitosis and meiosis. Failure to correctly segregate chromosomes in animals gives rise to
infertility, aneuploidy and may cause cancer. An important aspect for proper chromosome
segregation is sister chromatid cohesion, which ensures the proper attachment of chromosomes
to the spindles and thereby regulates the segregation of chromosomes to opposite poles of the
cell (3-5). During S phase the chromosomes are duplicated and start to condense coupled with
the breakdown of the nuclear envelope. During prophase sister chromatids are held close
together by sister chromatid cohesin. The kinetochores of the sister chromatids attach to spindle
fibers which align the chromosomes in the center of the cell during metaphase. At the anaphase
stage of mitosis spindles shorten pulling sister chromatids apart. Chromosomes stay at opposite
poles during telophase. During cytokinesis a nuclear membrane forms around each copy of the
chromosomes, which generates two daughter cells (6).
During meiosis cohesin complexes load on the chromosomes during interphase.
Chromosomes are replicated and sister chromatid cohesion is established during premeiotic S
phase. Homologous chromosomes begin to pair starting at leptotene, followed by reciprocal
recombination at zygotene and pachytene where the chromosomes are fully synapsed. During
diplotene the chromosomes start to desynapse and condense to form bivalents at premetaphase I.
Spindles attach to the kinetochores of each pair of sister chromatids aligning them at the
equatorial plane of the cell during metaphase I. Segregation of chromosomes begins during
anaphase I, where homologous chromosomes are pulled by spindles and arrive at the opposite
poles of the cell at telophase I. In some organisms, including Arabidopsis, the cell proceeds
directly into meiosis II. In other organisms, nuclear envelopes surround the two separated groups
2
of chromosomes at during meiotic interphase II. At prophase II, chromosomes decondense and
then recondense followed by the attachment of the sister chromatids to the spindles at metaphase
II. Spindles pull the sister chromatids apart during anaphase II, allowing the generation of four
haploid cells after the process of cytokinesis (7, 8)
A.
B.
3
Figure 1.1 Overview of mitosis and meiosis
(A) In mitosis a cell divides into two cells which are replicates of each other, with an equal number of
chromosomes in the individual diploid cells. (B) Meiosis is a type of cellular division in which the
number of chromosomes is reduced by half through the separation of homologous chromosomes which in
turn produces four haploid cells.
1.2 Meiosis: Homologous Chromosome Pairing
During meiotic prophase I, the maternal and paternal homologous chromosomes come together
and exchange genetic information. It has been proposed that chromosome structure, specific
DNA sequences or meiosis specific proteins may promote the correct recognition and association
of homologous chromosomes (9). It is also widely believed that telomere clustering and bouquet
formation helps facilitate homologous chromosome pairing and synapsis (9-11). A bouquet
structure forms when the clustered telomeres attach to the nuclear membrane. In Arabidopsis,
telomeres cluster during leptotene stage before synapsis, but do not form a bouquet structure.
Instead paired telomeres associate then dissociate from the nucleolus without any bouquet
formation.
Figure 1.2 General model of homologous pairing in meiosis. Each pair of homologous chromosomes is
shown as a green or red continuous line. Same color is indicated in the pair of sister chromatids.
Homologous chromosomes are initially unpaired and distributed around the nucleus. During leptotene the
telomeres cluster and move to the nuclear envelope where they attach and facilitate the homologous
chromosome search process. Chromosomes are aligned through formation of a structure termed a "
bouquet", though in Arabidopsis there is no report of bouquet formation. During zygotene chromosome
4
alignment
begins and by pachytene
homologous chromosome synapsis occurs, which ultimately
produces fully synapsed chromosomes. The synaptonemal complex disassembles at diplotene and by
diakinesis chromosomes attain a further condensed state.
1.3 Meiosis: Synapsis and Recombination
The recognition between homologs is initiated during early leptotene when the homologs move
towards each other prior to synapsis (12, 13). Telomere clustering might be important for
homologous chromosome pairing in Arabidopsis. Pairing then progresses to homolog
juxtaposition, which is a homology-dependent process and refers to the coming together of
homologs (12). Homologs move closer together via a double strand break (DSB) dependent
process and the chromosomes are now referred to as being in presynaptic co-alignment. At this
stage each chromosome develops a proteinaceous structure called an axial element (AE). In
zygotene the homologous chromosomes synapse through the process of polymerization of a
central element (CE) between the two axial elements, which are then referred to as lateral
elements (LEs) (12, 14-16). The synaptonemal complex (SC) persists until diplotene. Normally,
the SC is formed between homologous chromosomes and is closely coupled with homolog
juxtapositioning; however in some mutants, an SC can also form between non-homologous
chromosomes (17, 18) suggesting that synapsis is not essential for SC formation. A homolog of
yeast HOP1, the Arabidopsis ASY1 protein, is required for chromosome synapsis and localizes
along the lateral elements (19). In yeast (ZIP1) and mammals (SCP1), transverse filament
proteins have been identified (20-22). Homologs are also present in C. elegans (SYP1) and
Drosophila (23). ZIP1 and SCP1 proteins do not share significant primary amino acid similarity,
but all the proteins contain coiled coil domains in the central region. The N-terminus interacts
with the central region of synaptonemal complex and C-terminus interacts with lateral elements
(12, 24, 25).
The localization pattern of Arabidopsis ZYP1 is similar to yeast ZIP1 (26). Arabidopsis ZYP1
RNAi lines show defects in recombination, which is consistent with a potential role of ZYP1 in
the synaptonemal complex of Arabidopsis (26). Interestingly, fluorescence in situ hybridization
(FISH) experiments in ZYP mutants revealed that nonhomologous chromosomes are closely
associated, suggesting that the homology search process in Arabidopsis requires ZYP1. These
important results support the idea that synapsis, pairing and recombination is tightly coupled in
5
plants during meiosis (27). After pachytene, chiasmata are formed between the homologous
chromosomes (28, 29). Recombination is critical for successful sexual reproduction as it
regulates homolog association until the metaphaseI /anaphase I transition and allows the proper
segregation of homologous chromosomes at anaphase I. Resolution of homologous
chromosomes and release of cohesin from the arm regions during anaphase I leads to the
separation and segregation of homologous chromosomes.
Figure 1.3 Model of synaptonemal complex structure
A schematic of a synaptonemal complex (SC) with axial elements (AE), transverse filaments central
element (CE), and central region is shown. A hypothetical arrangement of cohesin (red diamonds) and
lateral elements/axial elements (LE/AE) proteins are in brown bold line are shown. Based on results
discussed in (14).
1.4 Cohesin Proteins
Cohesin is a multi-subunit protein complex that holds sister chromatids together during mitosis
and meiosis. Cohesin complexes are important for the pairwise alignment of chromosomes on
6
the spindle. In eukaryotes, DNA faithfully duplicates during S-phase to produce sister
chromatids. Duplicated sister chromatids are maintained as pairs by the cohesin complex until
they are faithfully segregated into the daughter cells. At anaphase
cohesin degradation at
centromeres allows sister chromatids to separate. The cohesin complex also functions in DNA
double strand break repair and regulation of gene expression (30-33). The core cohesin complex
is conserved in eukaryotes and consists of six subunits: Structural maintenance of chromosome
proteins (Smc1) and (Smc3), sister chromatid cohesion protein 1 (Scc1), Scc3, Pds5 and Wapl.
The C- and N-termini of Scc1 interacts with the ATPase domains of Smc1 and Smc3
respectively (34) to form a tripartite ring. In some models, a single cohesin ring entraps the two
sister chromatids. Scc1 also directly or indirectly interacts with Scc3, Pds5 and Wapl. Sister
chromatid cohesion can be separated into several steps, including cohesin loading to the
chromatin, cohesion establishment, cohesion maintenance and cohesion resolution. At each step,
various factors are involved to mediate the structure and function of cohesin.
While a great deal of the available information on sister chromatid cohesion has come from
studies in yeast and frogs, orthologs of core cohesin subunits and the associated factors are
present in plants. The functions of plant cohesins are generally conserved (32). At the same time,
differences between plant cohesins and those of other organisms have also been identified. We
will focus primarily on the cohesion during meiosis in Arabidopsis here.
1.5 The Core Cohesin Complex:
In Arabidopsis, cohesion is mediated by the cohesin complex, which contains two subunits of the
structural maintenance of chromosomes (SMC) protein family, SMC1 and SMC3. Both SMC1
and SMC3 are present in the Arabidopsis genome as single copy genes. AtSMC1 and AtSMC3
share characteristic features with other SMC proteins: an N-terminal ATP binding domain, two
large antiparallel coiled coil regions, which are separated by a hinge region and a C-terminal DA
box. Plants homozygous for T-DNA insertions in AtSMC1 (titan8-1 and titan 8-2) and AtSMC3
(titan 7-1 and titan 7-2) show defects in both the embryo and the endosperm and arrest early in
seed development (35). Localization studies revealed that AtSMC3 is found in both the
cytoplasm and nucleus of somatic and generative cells. AtSMC3 is predominantly present on the
chromosomes and in the nuclear matrix (36). Immunolocalization studies revealed AtSMC3 is
localized with the sister chromatids from prophase until anaphase during both mitosis and
7
meiosis. Strikingly, the protein co-localized with meiotic and mitotic spindles from metaphase to
telophase. These results suggest that AtSMC3 may have additional roles in plant cells other than
sister chromatid cohesion. No reports have been published for Arabidopsis SMC1. Antibody to
tomato SMC1 and SMC3 labeled the axial elements from leptotene until diplotene (37). During
metaphase I, weak SMC1 and SMC3 signals were detected on chromosomes (37, 38). It is not
clear if tomato SMC1 or SMC3 localize in the cytoplasm and/or on the spindle because studies
were not conducted on whole cell mounts.
In Arabidopsis and rice four SCC1/REC8 orthologs have been found and several SCC1/REC8
genes are present in other plant species. The maize ortholog of REC8 is AFD1(39). AFD1 is
essential for the elongation of axial elements and immunolocalization studies reveal that AFD1
localizes to the axial and lateral elements of the synaptonemal complex. AFD1 is also required
for RAD51 distribution on chromosomes and is also important for homologous chromosome
pairing (39). Strikingly different afd1 alleles show slightly different phenotypes, which draws
attention to structural and functional relationships in AFD1. In Arabidopsis the REC8 ortholog is
SYN1/DIF1 (40-43). T-DNA mutants for SYN1 are sterile. Male meiocytes show severe defects
in sister chromatid cohesion, homologous chromosome pairing, and chromosome condensation
(40-42). A TEM analysis of syn1 mutants showed short stretches of SC surrounded by condensed
chromatin along with polycomplexes in late pachytene, which indicates that SYN1 is essential
for proper SC formation (44). In syn1 mutants the recombination machinery is partially
functional as some recombination nodules were seen. There is no obvious phenotype in the
vegetative growth of syn1 plants when compared to wild type. Immunolocalization studies with
SYN1 antibody showed signals along the developing chromosome axes at early leptotene. At
pachytene SYN1 signal lines the chromosome axes of paired chromosomes (42). By diplotene
and diakinesis a large portion of the SYN1 protein dissociates from the chromosome arms and by
metaphase I the signal is only associated with the centromeres. SYN1 signal is not typically
detected at late metaphase I and early anaphase I. OsRad21-4 is the REC8 ortholog in the rice
genome. Knockdown of OsRad21-4 mediated by a 35S driven RNAi construct resulted in
multiple alterations in male meiosis, which included severe chromosome condensation,
precocious segregation of homologous chromosomes and chromosome fragmentation (45).
8
AtSCC3 is present as a single copy gene in the Arabidopsis genome. The protein encoded by
Arabidopsis SCC3 is 1098 amino acids long and exhibits 21% sequence identity and 40%
sequence similarity to yeast ScSCC3. AtSCC3 is expressed strongly in roots, mature leaves, buds
and plantlets (46). Inactivation of SCC3 results in embryo lethality, while a weak allele, Atscc31, which expresses a putative truncated protein shows both mitotic and meiotic defects (47).
Homozygous Atscc3-1 mutants are dwarf and sterile. An analysis of root mitosis demonstrated
that Atscc3-1 roots contain fewer dividing cells, whereas male meiotic spreads demonstrated
defects in chromosome condensation, chromosome pairing and synapsis and early sister
chromatid separation. AtSCC3 localizes on the chromosome axes until anaphase I during meiosis
and is present on chromosomes throughout the mitotic cell cycle (48). SYN1 binding to the
chromosomes appeared normal in Atscc3-1 plants, but AtSCC3 failed to bind to meiotic
chromosomes in Atsyn1 mutant plants (47). Most of the information about plant core cohesion
proteins is related to meiocytes. However, a recent study showed sister chromatid alignment was
greatly reduced in leaf cells of either heterozygous or homozygous Atsyn1 mutants (49). The
authors found that plants homozygous for mutations in SYN1, SYN2, SYN4 and SWI1 showed a
decrease in sister chromatid alignment in somatic cells. Both SYN1 and SWI1 are expressed
primarily in meiocytes, so a role in somatic cells was unexpected.
1.6 Cohesin Loading
The Scc2/Scc4 complex recruits cohesin to the chromosomes prior to DNA replication (30, 31,
50-52). Large-scale mapping of cohesin proteins in several organisms demonstrated that the
cohesin complex and Scc2 bind non-randomly on the chromosomes and the binding sites of
cohesin and Scc2 may not overlap (43, 53-57). Increasing evidence indicates that Scc2/Scc4
facilitates cohesin binding at specific locations on chromosomes (58). The loaded cohesins are
then relocated by RNA polymerases to other sites (56, 59, 60). The exact function(s) of
Scc2/Scc4 in cohesin loading is not clearly defined. Scc2/Scc4 may activate SMC ATPase
activity to open cohesin rings to entrap the chromosomes (61-65) as mutations in the ATPase
domains of Smc1 or Smc3 interfere with the correct association of cohesin with chromosomes
and lead to similar phenotypes as Scc2/Scc4 mutants (62). Alternatively, Scc2/Scc4 may remodel
the chromatin to facilitate cohesin binding (66, 67).
9
Other factors have been identified in yeast which are necessary for proper cohesin loading.
Cdc7/Drf1 kinase (DDK), a component of pre-replication complexes (pre-RCs), associates with
Scc2/Scc4 to help with the cohesin loading (51, 68-70). In some instances, the kinetochore and
tRNA transcription factors are required to mediate Scc2/Scc4 and cohesin binding to the
chromosomes (71). Even though Scc2 and Scc4 are essential for cohesin loading, they are not
required for cohesin maintenance and resolution as they are dispensable at S and G2 stages in
yeast (50, 72). Scc2/Scc4 also helps in Smc5/Smc6 loading which is required for chromosome
condensation.
Orthologs of Scc2/Scc4 are present in the Arabidopsis genome (73). AtSCC2 has been shown to
play an important role in the establishment of sister chromatid cohesion. Downregulation of
AtSCC2 expression by AtSCC2-RNAi leads to chromosome mis organization and alterations in
AtSCC3 distribution during meiosis. A T-DNA knockout mutation in AtScc2 produces defects in
embryo and endosperm development (74). AtSCC2 contains the HEAT repeats and an extra
PHD finger that are not present in non-plant orthologs. Proteins containing PHD fingers are
thought to function in chromatin organization and gene regulation. Future investigations into the
interactions of cohesin with AtSCC2/AtSCC4, the localization of AtSCC2/AtSCC4 on the
chromosomes and the function(s) of the AtSCC2 PHD finger, should provide information about
how the protein complex functions in the plant cohesin pathway.
1.7 Cohesion Establishment and Maintenance
Sister chromatid cohesion is established during S phase by Eco1/Ctf7 in a series of complex
steps (30-32, 75, 76). Eco1/Ctf7 interacts with replication factor C (RFC) and proliferating cell
nuclear antigen (PCNA), which suggests that the establishment of the sister chromatid cohesion
and replication fork progression is tightly coupled (72, 77, 78). Interaction between the core
cohesin complex, the cohesin establishment factor Ctf7 and an anti-establishment factor which
consists of Wapl/Rad61 and Pds5 are critical for cohesin binding and establishment (79-81).
During cohesion establishment, Eco1/Ctf7 acetylates conserved lysine residues, which are close
to the SMC3 ATPase domain (82). Acetylation of Smc3 stabilizes the interaction of Smc3 with
Scc1 and counteracts Rad61/Wapl disassociating activity (82-86). Studies also suggested that the
acetylation of lysine residues in SMC3 by CTF7 acetylase actually inhibits the anti-establishment
10
function of Wapl-Pds5 complex and thus helps in the establishment of the cohesion on the
chromosomes (82-86).
Figure 1.4 The Cohesin Complex and Proposed Models for Cohesin Establishment
A. Cohesin Complex: SMC3 and SMC1 are connected at their hinge domains. The amino and carboxy
terminus of SCC1 which is a alpha-kleisin, binds SMC1 and SMC3. As SCC1 binds SMC proteins, SCC3
associates with the C-terminal region of SCC1.
B. Strong-ring model of cohesin binding: Sister chromatids are entrapped by a tripartite ring.
C. Weak-ring model of cohesin binding: Weak ring and handcuff model shown where a single sister
chromatid is associated with cohesin complex.
In some organisms, acetylated Smc3 recruits Sororin, which replaces Rad61/Wapl and forms a
complex with Pds5 to further stabilize cohesin binding (87, 88). The Arabidopsis genome
11
contains five putative PDS5 genes, which have similarity with the yeast and human orthologs
and could encode anti-establishment complex proteins. Plants homozygous for PDS5-1
(At1g77600), PDS5-2 (At5g47690), PDS5-3 (At1g80810), PDS5-4 (At4g31880), and PDS5-5
(At1g15940) have no phenotype in respect to fertility. However pds5-1 showed abnormally
small petiole development (De, Makaroff, unpublished). Plants double homozygous for PDS5-3
and PDS5-4 display an early flowering phenotype which suggests that these two genes might
have some function related to transcription (De, Auman, Vargo and Makaroff, unpublished).
Plants double homozygous for PDS5-5 and PDS5-1 and triple homozygous for PDS5-1, PDS5-3
and PDS5-5 show no obvious additional phenotypes (De, Auman, Vargo and Makaroff,
unpublished). 35S-PDS5-2 RNAi and meiosis specific DMC1-PDS5-2 RNAi constructs (De,
Auman, Vargo, Fischer and Makaroff, unpublished) were generated and transformed to wild
type, single homozygous, double homozygous and triple homozygous plants. The phenotype of
these plants is currently being investigated. Therefore the role of the five putative PDS5 (PDS51, PDS5-2, PDS5-3, PDS5-4 and PDS5-5) orthologs in Arabidopsis still needs to be investigated.
As discussed earlier ECO1/CTF7 is required to establish cohesion. ECO1/CTF7 interacts with
the DNA replication factors, PCNA (DNA polymerase processivity factor) (78), RFC
(Replication factor C) (89), DNA helicase (90) and the clamp loader subunits (8). Inactivation or
mutations in Eco1/Ctf7 lead to various defects such as chromosome mis-organization, cohesin
protein mis-distribution, cell cycle checkpoint activation and growth retardation (75, 76, 91)
Interestingly, deletions or mutations in Rad61/Wapl, Pds5, Smc3 and Scc3 may suppress
Eco1/Ctf7 deletion phenotypes (83, 84, 92-94).
Jiang et al (95)identified one copy of CTF7 in Arabidopsis genome; the protein can replace the
yeast ortholog (95). AtCTF7 lacks an N-terminal extension, but contains a PIP box, an
acetyltransferase domain and a C2H2 zinc finger motif. The vegetative growth of AtCtf7+/- plants
resembles wild type plants, however, the plants exhibit reduced fertility with defects in embryo
development (95, 96). Male meiocytes of Atctf7-/- plants exhibit premature loss of sister
chromatid cohesion during meiosis and the localization of cohesin proteins are dramatically
reduced (97). Homozygous Atctf7-/- plants are typically inviable (95-97). However, 4% of the
expected Atctf7-/- progeny from AtCtf7+/- plants can survive; they are severely dwarf and exhibit
12
developmental defects (97). The expression of genes involved in DNA repair and cell division
are significantly altered in Atctf7-/- homozygous plants. Recent studies have found similar defects
in Dex-inducible AtCTF7-RNAi plants (97).
1.8 Cohesion Removal
In eukaryotes the removal of cohesin occurs in a series of steps. During prophase the majority of
cohesin is removed from chromosome arms, but centromeric cohesin is maintained (98, 99)
(100). The prophase release of cohesin from chromosome arms, is dependant on WAPL and the
phosphorylation of arm associated SCC3 by polo like kinase 1(Plk1) (101-104). Centromeric
cohesion is protected by Sgo1 (Shugoshin1) which recruits PP2A (phosphatase 2A) to
centromeres to protect cohesin from phosphorylation and therefore protect it from release (105107). Haspin (a histone H3 kinase) and PHB2 (Prohibitin 2) are also involved in the process of
protecting cohesin at centromeres (108). Studies on Wapl in different species has shown that it is
an important protein, which controls mitotic sister chromatid cohesion, and helps facilitate the
removal of cohesin from chromosomes. Wapl was first identified in Drosophila where it was
shown to be
important for heterochromatin organization (109). WAPL proteins contain a
conserved C-terminus, which may be important for binding of other cohesin subunits and
effectors and helps in releasing cohesin (110, 111), and divergent N-terminal domains of variable
lengths. Recently it has been shown the N-terminus of human WAPL contains the PDS5 binding
domain (111). Smc3 acetylation helps sororin to bind to the chromosomes and stabilizes cohesin
by inactivating Wapl (79, 87, 88, 112-114). Phosphorylation of Sororin by Cdk1/cyclin B, which
results in it's replacement by Wapl to form a stable complex with Pds5. Cohesin is released from
chromosome arms by the action of the Pds5-Wapl complex (87, 88, 115).
At anaphase, centromeric cohesin is removed by the protease separase (ESP1 in S.
cerevesiae/CUT1 in S. pombe and AESP in Arabidopsis) which cleaves SCC1/Rad21 and helps
in the opening of the tripartite ring. This then allows the separation of sister chromosomes (98,
100, 103, 116, 117). Before the onset of anaphase, Securin and Cyclin B inhibit separase (115,
118, 119). The two spindle assembly checkpont complexes, Mad2 and BubR1 bind to the
Cyclosome or Anaphase Promoting Complex (APC/C), which keeps ubiquitin ligase in its
inactive state. At anaphase, the separation of chromosomes is initiated by activation of the
13
APC/C by activator Cdc20, which thereby degrades securin through a ubiquitin dependent
process, allowing the activation of separase, which in turn cleaves SCC1 (5, 120-123).
Figure 1.5 Proposed model for release of cohesin during meiosis
In eukaryotes a considerable amount of cohesin along the chromosome arms is released during prophase
in a polo like kinase and Wapl dependent process(101-104). At the metaphase I/anaphase I transition
ubiquitination of securin by APC/CCdc20 results in securin degradation and the activation of separase
which cleaves residual arm associated REC8/SYN1 and helps with the separation of homologous
chromosomes. Shugosin (SGO1) a protein which protects centromeric REC8 from cleavage and
maintains centromeric cohesion. As the cell enters meiosis II kinetochores form a bipolar orientation and
separase is again inactivated by securin. In meiosis II SGO1 dissociation takes place by the same
ubiquitination mechanism of securin. As SGO1 dissociates the centromere region becomes accessible for
separase cleavage. After separase cleavage the sister chromatids move to opposite poles.
14
Studies on cohesin removal during mitosis in plants has not yet been published. However,
cohesin removal during meiosis has been studied in Arabidopsis. In Arabidopsis thaliana, SYN1
signals are found along the chromosome axes during prophase, but during diplotene and
diakinesis, a large portion of SYN1 is dissociated from the chromosomes and by anaphase I little
to no cohesin signals can be detected on the meiotic chromosomes (42). This suggested that the
removal of cohesin from plant chromosomes during meiosis may resemble the situation in
animals.
AtESP1 is significantly larger than ESP1 proteins in yeast, worm and fly, but is similar in size to
mammalian ESP1 (124). The greatest similarity between ESP1 proteins from different organisms
is found in the C-terminus, which has the C-50 peptidase domain. The AtESP1 peptidase domain
has approximately 20% sequence identity to the mammalian enzyme. However, the AtESP1 C50 peptidase domain is considerably larger (700 amino acids) than those found in other
organisms (400-470 amino acids) (124). Moreover, the AtESP1 peptidase domain consists of a
predicted 2Fe2S-Ferredoxin domain that is not present in the proteins of other organisms.
AtESP1 also contains an EF- hand calcium binding domain. A calcium binding domain is also
present in budding yeast ESP1, which is important for the initiation and/or maintenance of its
association with the spindle (125). It is possible that the EF- hand domain has a similar function
in plants. AtESP1 is an essential gene in Arabidopsis (124). Twenty-five percent of the seeds of
plants heterozygous for a T-DNA insertion in AtESP1 displayed mutant displayed enlarged
endosperm nuclei and nucleoli, and a failure in endosperm cellularization; embryos arrest at the
globular stage (124). Another study has shown that the radially swollen 4 (RSW4) temperature
sensitive mutant of Arabidopsis leads to a mis-sense mutation in AtESP1 (126). Replicated
chromosomes fail to disjoin in Atrsw4 mutant roots at restrictive temperatures. The roots of
Atrsw4 plants accumulate high levels of mitotic specific cyclin B1; 1 and showed disorganized
cortical microtubules. However, it still needs to be investigated how AtRSW4 regulates cyclin
B1; 1 levels in plants.
The role of AtESP1 in mitosis and meiosis was investigated using an RNAi construct driven by
the 35S and meiosis specific DMC1 promoters. The failure to obtain RNAi plants containing the
35S RNAi construct was consistent with the conclusion that AtESP1 is an essential gene.
15
Analysis of DMC1-AtESP1-RNAi plants demonstrated that AtESP1 is required for the release of
sister chromatid cohesion during meiosis I and meiosis II (124, 127). Entangled and stretched
chromosomes were observed in anaphase I and II. Chromosome bridges and DNA fragmentation
were also observed, which suggested that AtESP1 is required for homologous chromosome
segregation during meiosis I and sister chromatid segregation in meiosis II (124, 127). SYN1 and
SMC3 signals persisted along the chromosome arms and the centromeres throughout meiosis in
AtESP1 RNAi plants. Meiotic expression of AtESP1 RNAi also resulted in nonhomologous
centromere association and the disruption of the radial microtubule system after telophase II
(127). Thus AtESP1 functions beyond cohesion removal and has multiple roles in plant cells. In
yeast, and animals the anaphase- promoting complex or cyclosome (APC/C) together with its
activator Cdc20 promotes the ubiquitin- dependent destruction of securin, thereby activating
separase (5, 123). However, a putative plant securin has yet to be identified and it still needs to
be determined on how the separase pathway is activated in plants.
1.9 Cohesin in Double Strand Break Repair
Not much is known about the role of plant cohesins in DNA double strand break repair, although
Arabidopsis RAD21.1/SYN2 has been shown to play an important role in DSB repair (128)
(129). Increased AtRAD21.1 expression levels were seen after Arabidopsis plants were exposed
to ionizing radiation (-rays and x-rays), but not UV-B (129). A similar increase in AtRAD21.2,
or AtRAD21.3 expression was not observed. No vegetative phenotype was observed in Atrad21.
1 plants after treatment with x-rays or bleomycin. Therefore, preliminary studies confirm that
RAD21.1/SYN2 is important for DNA repair; however, additional studies are required to
establish this mechanism. Likewise recent studies have shown that Arabidopsis WAPL and
CTF7 are required DNA double strand break repair in somatic cells (De et al; unpublished,
(130); however it is not clear what role they play.
1.10 PHD Finger Proteins
The plant homeodomain motif (PHD) was first discovered in Arabidopsis thaliana in the
homeodomain protein HAT3 (131). PHD domains consist of a Cys4-His-Cys3 motif, which is
important for metal binding and is often termed a "RING" domain and/or FYVE domain (131).
The Cys4-His-Cys3 motif co-ordinates two zinc ions in a "cross-brace" configuration, where each
16
zinc ion is coordinated by alternate pairs of Cys/His ligands. There are approximately 150 PHD
domain containing genes in the human genome and most of them are nuclear proteins (132).
PHD domains can occur as a single unit, but often are found in clusters of two or three and/or
along with other domains like chromodomains and bromodomains. A subset of PHDs has been
shown to bind N-terminal histone tails, including the PHDs of bromodomain PHD finger and
ING2 (inhibitor of growth family 2), which can bind H3K4me3 (133). Other important examples
of proteins, that contain a PHD is are Polycomb like proteins (PcG), Trithorax group proteins
(trxG) and the Mi-2 complex, which is a part of histone deacetylation complex (HDAC) (134,
135) . A NMR structure of the human WSTF (William syndrome) PHD finger revealed that
cysteine and histidine coordinate two Zn+2 ions and that the PHD finger resembles a two
stranded beta sheet and an alpha helix (136). A number of possible roles have been proposed for
PHD's, including mediating protein-protein, protein-DNA and protein-RNA interactions (137).
Studies show that PHD domains can be associated with E3 ubiquitin ligase activity and several
viral proteins that contain a PHD domain are targeted to the cellular membrane (138).
In Saccharomyces cerevisiae, several PHD proteins have been identified. Two of them have
preference for binding H3 methylated at Lys36 (139). Eight others were found to recognize H3
methylated at Lys4 (H3K4me3) (140). In mammals, some PHD proteins can recognize the
methylation state of Lys9, which includes PHDs from KDM5C and UHRF1 and CHD4 (141).
The Makaroff Lab previously reported the characterization of the Male Meiocyte Death1 (mmd1)
mutant in which male meiocytes undergo apoptosis during prophase I (142). MMD1 encodes a
PHD (142). In addition to MMD1 there are three other MMD-like genes in Arabidopsis, which
also contain PHD fingers. They are: MS1 (Male Sterility 1) which is required for pollen
development (143), MMDL1 and MMDL2, which had not until now been characterized. The
specific role(s) of MMD1 or MS1 are not known. However, it has been proposed that MS1 acts
as a transcription factor to help control gene expression in the anther (143). Studies designed to
investigate the roles of MMDL1 and MMDL2 are part of this dissertation.
1.11 Sections of the dissertation
In this dissertation I present the characterization and functional analysis of Arabidopsis WAPL,
along with a detailed epistatic analysis of
the interaction between CTF7 and WAPL. A
17
preliminary characterization of male meiocyte-like genes MMDL1 and MMDL2
is also
described.
Chapter 2 describes a series of experiments involving the characterization of two WAPL genes in
the model organism Arabidopsis thaliana. We characterized T-DNA insertion lines for the two
WAPL genes that were available in the Arabidopsis Stock Center. Two lines were characterized
for AtWAPL1(AtWAPL1.1 and AtWAPL1.2) and one line was analyzed for AtWAPL2
(AtWAPL2). Plants homozygous for the individual insertion lines displayed normal vegetative
growth, development and fertility when compared with wild type plants. AtWAPL1 and
AtWAPL2 show a high degree of similarity raising the possibility that the two genes share
overlapping functions. Therefore, we crossed AtWAPL2 with both AtWAPL1.1 and AtWAPL1.2.
Plants double homozygous for both combinations (AtWAPL1.1WAPL2 and AtWAPL1.2WAPL2)
were isolated and studied. We show that WAPL1 and WAPL2 have a relatively minor role in
somatic cells, but both play a critical role in facilitating sister chromatid resolution during
meiosis. Inactivation of AtWAPL1 and AtWAPL2 had little effect on plant growth, but resulted in
a significant reduction in both male and female fertility. Further, approximately 23% of seeds in
double mutant plants display abnormal embryonic development. Meiotic defects, including
alterations in chromosome condensation and the separation of homologous chromosomes and
sister chromatids was observed. These results along with our observation of the prolonged nonspecific association of centromeres suggested that in some cells homologous chromosomes coalign, but may not synapse. This suggested that the mutant may also be defective in homologous
chromosome pairing and synapsis. The removal of cohesin from chromosomes during prophase
is also blocked in wapl mutants resulting in chromosome bridges, broken chromosomes and the
uneven segregation of chromosomes at anaphase I. Immunolocalization studies using β-tubulin
antibody showed that AtWAPL is essential for proper spindle attachment and assembly during
meiosis. We investigated the possible genetic interaction between Atwapl and AtCTF7 by
crossing Atwapl1.1wapl2 plants with plants heterozygous for a T-DNA insertion in AtCTF7 (95).
In particular, we were interested in determining if inactivation of WAPL can suppress the
dramatic affect of Atctf7 mutations. CTF7 is an essential gene with mutations causing female
gametophyte lethality (95). Plants homozygous for ctf7 mutations can however be recovered at
very low frequencies (97); the plants are dwarf, completely sterile and display multiple
18
developmental alterations. PCR genotyping was used to first identify plants triple heterozygous
for the three mutations and then Atwapl1.1wapl2ctf7+/- plants were identified in F2 populations
of several different crosses. Atwapl1.1wapl2ctf7+/- plants resembled Atwapl1.1wapl2 plants,
displaying relatively normal vegetative growth and reduced fertility. A manuscript describing
this work has been accepted at PLOS Genetics and is in press.
Chapter 3
We carried out an in-depth analysis of Atwapl1.1wapl2ctf7 plants. The frequency of female
gametophyte lethality was elevated in Atwapl1.1wapl2ctf7 plants. Meiotic chromosomes in
Atwapl1.1wapl2ctf7 plants showed some recovery relative to ctf7 meiocytes while mitotic
spreads show full recovery compared to ctf7 mutant root tips. Cohesin immunolocalization using
SYN1 antibody showed that
cohesin release during metaphaseI/anaphaseI is somewhat
recovered in wapl1wapl2ctf7 plants, but heterochromatin dissociation is still abnormal in
Atwapl1.1wapl2ctf7 meiocytes. Furthermore, immunolocalization studies using β-tubulin
antibody on Atwapl1.1wapl2ctf7 meiocytes showed severe abnormalities in spindle attachment
and assembly. However, ASY1 and ZYP1 immunolocalization suggested no obvious alterations
in pairing and synapsis in Atwapl1.1wapl2ctf7 plants. Our results demonstrate that WAPL is
important for the timely release of cohesion during meiosis and that inactivation of WAPL
eliminates the requirement for CTF7.
Chapter 4:
A preliminary characterization of two Arabidopsis MMD1-like proteins (MMDL-1 and MMDL2), which contain (PHD) domains is presented in Chapter 4. MMDL1 and MMDL2, which
exhibit 53% and 64% similarity with MMD1, respectively, are expressed at elevated levels in the
endosperm and sperm cells. Plants homozygous for single mutations in MMDL1 and MMDL2
appear normal, while inactivation of both genes results in lethality. Surprisingly, plants
heterozygous for the genes individually showed reduced male and female fertility. Interestingly,
mmdl1-/-mmdl2+/- plants are viable, but display a 20% seed abortion phenotype. Progeny from
mmdl1-/-mmdl2+/- plants were found to be maternal clones; PCR genotyping over 200 plants
confirmed they have the same genotype as the parent, a process known as apomixis or
apomeiosis. This phenomenon is extremely important in agriculture. In contrast, mmdl1+/-mmdl219
/-
plants are not viable. To better understand the roles of the proteins we generated transgenic
plants expressing a 35S-MMDL2 RNAi construct and a meiosis specific DMC1 promoter
MMDL2 RNAi construct. Expression of 35S-MMDL2 RNAi in mmdl1-/-mmdl2+/- plants causes
severe defects in male meiocytes, beginning at diakinesis, when they show improperly
condensed and resolved chromosomes. Interestingly, pollen is formed normally. Plants
containing the DMC1-MMDL2 RNAi construct showed a severe phenotype in a wild type
background, which indicates there may be dosage effect for this phenotype. Defects in embryo
and endosperm development, are also observed in the DMC1 RNAi plants. As part of
biochemical studies, we have also shown that the PHD domain of MMD1 is capable of binding
histone H2A. Therefore, the MMDL proteins may be important for controlling chromatin
structure and may play a role in transcriptional regulation.
Chapter 5 summarizes the results of this dissertation and provides concluding remarks about the
role of Arabidopsis WAPL1 and WAPL2 in meiosis and mitosis as well as its epistatic interaction
with AtCTF7. The future direction of the MMDL proteins in transcription regulation is also
discussed.
1.12 References
(1)
Cnudde, F., and Gerats, T. (2005) Meiosis: Inducing variation by reduction. Plant biol
(Stuttg) 7, 321-341.
(2)
Zickler, D., and Kleckner, N. (1998) The leptotene-zygotene transition of meiosis. Annu
Rev Genet 32, 619-697.
(3)
Lee, J., and Orr-Weaver, T. (2001) The molecular basis of sister-chromatid cohesion.
Annu Rev Cell Dev Biol 17, 753-777.
(4)
Uhlmann, F. (2004) The mechanism of sister chromatid cohesion. Experimental Cell
Research 296, 80-85.
(5)
Nasmyth, K., and Haering, C. H. (2005) The Structure and function of Smc and kleisin
complexes. Annual Review of Biochemistry 74, 595-648.
(6)
Andrew Murray and Tim Hunt, W.H. (1994) The cell cycle: An introduction . Mol Rep
Dev 39, 247-247.
20
(7)
Ross, K. E., and Cohen-Fix, O. (2003) The role of Cdh1p in maintaining genomic
stability in budding yeast. Genetics 165, 489-503.
(8)
Petronczki, M., Chwalla, B., Siomos, M. F., Yokobayashi, S., Helmhart, W.,
Deutschbauer, A. M., Davis, R. W., Watanabe, Y., and Nasmyth, K. (2004) Sisterchromatid cohesion mediated by the alternative RF-C- Ctf18/(Dcc1)/(Ctf8), the helicase
Chl1 and the polymerase- alpha-associated protein Ctf4 is essential for chromatid
disjunction during meiosis II. J Cell Sci 117, 3547-3559.
(9)
Dawe, R. K., Sedat, J. W., Agard, D. A., and Cande, W. Z. (1994) Meiotic chromosome
pairing in maize is associated with a novel chromatin organization. Cell 76, 901-912.
(10)
Scherthan, H., Weich, S., Schwegler, H., Heyting, C., Harle, M., and Cremer, T. (1996)
Centromere and telomere movements during early meiotic prophase of mouse and man
are associated with the onset of chromosome pairing. J Cell Biol 134, 1109-1125.
(11)
TrellesSticken, E., Loidl, J., and Scherthan, H. (1999) Bouquet formation in budding
yeast: initiation of recombination is not required for meiotic telomere clustering. J Cell
Sci 112, 651-658.
(12)
Zickler, D., and Kleckner, N. (1999) Meiotic chromosomes: Integrating structure and
function. Annu Rev Genet 33, 603-754.
(13)
Tesse, S., Storlazzi, A., Kleckner, N., Gargano, S., and Zickler, D. (2003) Localization
and roles of Ski8p protein in Sordaria meiosis and delineation of three mechanistically
distinct steps of meiotic homolog juxtaposition. Proc Natl Acad Sci USA100, 1286512870.
(14)
Heyting, C. (1996) Synaptonemal complexes: structure and function. Curr Opin Cell Biol
8, 389-396.
(15)
Page, S. L., and Hawley, R. S. (2004) The genetics and molecular biology of the
synaptonemal complex. Annu. Rev. Cell Dev. Biol. 20, 525-58.
(16)
Roeder, G. (1997) Meiotic chromosomes: it takes two to tangle. Genes Dev11, 26002621.
(17)
Leu, J. Y., Chua, P. R., and Roeder, G. S. (1998) The meiosis-specific HOP2 protein of S.
cerevisiae ensures synapsis between homologous chromosomes. Cell 94, 375-386.
21
(18)
Pawlowski, W. P., Golubovskaya, I. N., Timofejeva, L., Meeley, R. B., Sheridan, W. F.,
and Cande, W. Z. (2004) Coordination of meiotic recombination, pairing, and synapsis
by PHS1. Science 303, 89-92.
(19)
Caryl, A. P., Lacroix, I., Jones, G. H., and Franklin, F. C. H. (2000) An Arabidopsis
homologue of the Drosophila meiotic gene Pelota. Sex Plant Reprod 12, 310-313.
(20)
Dong, H. J., and Roeder, G. S. (2000) Organization of the yeast Zip1 protein within the
central region of the synaptonemal complex. J Cell Biol 148, 417-426.
(21)
Schmekel, K., Meuwissen, R. L. J., Dietrich, A. J. J., Vink, A. C. G., Vanmarle, J.,
Vanveen, H., and Heyting, C. (1996) Organization of SCP1 protein molecules within
synaptonemal complexes of the rat. Exp Cell Res 226, 20-30.
(22)
Liu, J. G., Yuan, L., Brundell, E., Bjorkroth, B., Daneholt, B., and Hoog, C. (1996)
Localization of the n-terminus of SCP1 to the central element of the synaptonemal
complex and evidence for direct interactions between the n-termini of SCP1 molecules
organized head-to-head. Exp Cell Res 226, 11-19.
(23)
MacQueen, A. J., Colaiácovo, M. n. P., McDonald, K., and Villeneuve, A. M. (2002)
Synapsis-dependent and -independent mechanisms stabilize homolog pairing during
meiotic prophase in C. elegans. Genes Dev16, 2428-2442.
(24)
Sym, M., Engebrecht, J., and Roeder, G. S. (1993) ZIP1 Is a Synaptonemal Complex
Protein Required for Meiotic Chromosome Synapsis. Cell 72, 365-378.
(25)
Page, S., and Hawley, R. (2002) c(3)G encodes a Drosophila synaptonemal complex
protein. Genes Dev 15, 3130-3143.
(26)
Higgins, J. D., Sanchez-Moran, E., Armstrong, S. J., Jones, G. H., and Franklin, F. C. H.
(2005) The Arabidopsis synaptonemal complex protein ZYP1 is required for
chromosome synapsis and normal fidelity of crossing over. Genes Dev 19, 2488-2500.
(27)
Ma, H. (2006) A Molecular Portrait of Arabidopsis Meiosis. The Arabidopsis Book,
e0095.
(28)
Hunter, N., and Kleckner, N. (2001) The single-end invasion: An asymmetric
intermediate at the double-strand break to double-holliday junction transition of meiotic
recombination. Cell 106, 59-70.
(29)
Mahadevaiah, S. K., Turner, J. M. A., Baudat, F., Rogakou, E. P., de Boer, P., BlancoRodriguez, J., Jasin, M., Keeney, S., Bonner, W. M., and Burgoyne, P. S. (2001)
22
Recombinational DNA double-strand breaks in mice precede synapsis. Nat Genet 27,
271-276.
(30)
Nasmyth, K., and Haering, C. H. (2009) Cohesin: Its Roles and Mechanisms. Annu Rev
Genet 43, 525-558.
(31)
Onn, I., Heidinger-Pauli, J. M., Guacci, V., Unal, E., and Koshland, D. E. (2008) Sister
Chromatid Cohesion: A Simple Concept with a Complex Reality. Annu Rev Cell Dev
Biol 24, 105-129.
(32)
Yuan, L., Yang, X., and Makaroff, C. A. (2011) Plant cohesins, common themes and
unique roles. Curr Prot Pept Sci12, 93-104.
(33)
Mehta, G. D., Rizvi, S. M. A., and Ghosh, S. K. (2012) Cohesin: A guardian of genome
integrity. Biochim. Biophys. Acta-Mol Cell Res 1823, 1324-1342.
(34)
Sonoda, E., Matsusaka, T., Morrison, C., Vagnarelli, P., Hoshi, O., Ushiki, T., Nojima,
K., Fukagawa, T., Waizenegger, I. C., Peters, J.-M., Earnshaw, W. C., and Takeda, S.
Scc1/Rad21/Mcd1 Is Required for Sister Chromatid Cohesion and Kinetochore Function
in Vertebrate Cells. Dev Cell 1, 759-770.
(35)
Liu, C., McElver, J., Tzafrir, I., Joosen, R., Wittich, P., Patton, D., Van Lammeren, A.,
and D, M. (2002) Condensin and cohesin knockouts in Arabidopsis exhibit a titan seed
phenotype. Plant J 29, 405-415.
(36)
Lam, W. S., Yang, X. H., and Makaroff, C. A. (2005) Characterization of Arabidopsis
thaliana SMC1 and SMC3: evidence that ASMC3 may function beyond chromosome
cohesion. J Cell Sci 118, 3037-3048.
(37)
Lohmiller, L. D., De Muyt, A., Howard, B., Offenberg, H. H., Heyting, C., Grelon, M.,
and Anderson, L. K. (2008) Cytological analysis of MRE11 protein during early meiotic
prophase I in Arabidopsis and tomato. Chromosoma 117, 277-288.
(38)
Lhuissier, F. G. P., Offenberg, H. H., Wittich, P. E., Vischer, N. O. E., and Heyting, C.
(2007) The mismatch repair protein MLH1 marks a subset of strongly interfering
crossovers in tomato. Plant Cell 19, 862-876.
(39)
Golubovskaya, I. N., Hamant, O., Timofejeva, L., Wang, C. J. R., Braun, D., Meeley, R.,
and Cande, W. Z. (2006) Alleles of afd1 dissect REC8 functions during meiotic prophase
I. J Cell Sci 119, 3306-3315.
23
(40)
Bai, X., Peirsion, B., Dong, F., Cai, X., and Makaroff, C. (1999) Isolation and
characterization of SYN1, a RAD21-like gene essential for meiosis in Arabidopsis. Plant
Cell 11, 417-430.
(41)
Peirson, B. N., Bowling, S. E., and Makaroff, C. A. (1997) A defect in synapsis causes
male sterility in a T-DNA-tagged Arabidopsis thaliana mutant. Plant J 11, 659-669.
(42)
Cai, X., Dong, F. G., Edelmann, R. E., and Makaroff, C. A. (2003) The Arabidopsis
SYN1 cohesin protein is required for sister chromatid arm cohesion and homologous
chromosome pairing. J Cell Sci 116, 2999-3007.
(43)
Bhatt, A. M., Lister, C., Page, T., Fransz, P., Findlay, K., Jones, G. H., Dickinson, H. G.,
and Dean, C. (1999) The DIF1 gene of Arabidopsis is required for meiotic chromosome
segregation and belongs to the REC8/RAD21 cohesin gene family. Plant J 19, 463-472.
(44)
Zhao, D. Z., Yang, X. H., Quan, L., Timofejeva, L., Rigel, N. W., Ma, H., and Makaroff,
C. A. (2006) ASK1, a SKP1 homolog, is required for nuclear reorganization, presynaptic
homolog juxtaposition and the proper distribution of cohesin during meiosis in
Arabidopsis. Plant Mol Biol 62, 99-110.
(45)
Zhang, L. R., Tao, J. Y., Wang, S. X., Chong, K., and Wang, T. (2006) The rice
OsRad21-4, an orthologue of yeast Rec8 protein, is required for efficient meiosis. Plant
Molecular Biology 60, 533-554.
(46)
Chelysheva, L., Diallo, S., Vezon, D., Gendrot, G., Vrielynck, N., Belcram, K., Rocques,
N., Marquez-Lema, A., Bhatt, A. M., Horlow, C., Mercier, R., Mezard, C., and Grelon,
M. (2005) AtREC8 and AtSCC3 are essential to the monopolar orientation of the
kinetochores during meiosis. J Cell Sci 118, 4621 - 4632.
(47)
Chelysheva, L., Diallo, S., Vezon, D., Gendrot, G., Vrielynck, N., Belcram, K., Rocques,
N., Marquez-Lema, A., Bhatt, A. M., Horlow, C., Mercier, R., Mezard, C., and Grelon,
M. (2005) AtREC8 and AtSCC3 are essential to the monopolar orientation of the
kinetochores during meiosis. J Cell Sci 118, 4621-4632.
(48)
Storlazzi, A., Tesse, S., Gargano, S., James, F., Kleckner, N., and Zickler, D. (2003)
Meiotic double-strand breaks at the interface of chromosome movement, chromosome
remodeling, and reductional division. Genes & Development 17, 2675-2687.
24
(49)
Schubert, V., Weissleder, A., Ali, H., Fuchs, J., Lermontova, I., Meister, A., and
Schubert, I. (2009) Cohesin gene defects may impair sister chromatid alignment and
genome stability in Arabidopsis thaliana. Chromosoma 118, 591-605.
(50)
Ciosk, R., Shirayama, M., Shevchenko, A., Tanaka, T., Toth, A., Shevchenko, A., and
Nasmyth, K. (2000) Cohesin's Binding to Chromosomes Depends on a Separate Complex
Consisting of Scc2 and Scc4 Proteins. Molecular Cell 5, 243-254.
(51)
Gillespie, P. J., and Hirano, T. (2004) Scc2 couples replication licensing to sister
chromatid chromatid in Xenopus egg extracts. Curr Biol 14, 1598-1603.
(52)
Watrin, E., Schleiffer, A., Tanaka, K., Eisenhaber, F., Nasmyth, K., and Peters, J. M.
(2006) Human Scc4 is required for cohesin binding to chromatin, sister-chromatid
cohesion, and mitotic progression. Current Biology 16, 863-874.
(53)
Bernard, P., Maure, J., Partridge, J., Genier, S., Javerzat, J., and RC, A. (2001)
Requirement of heterochromatin for cohesion at centromeres. Science 294, 2539-2542.
(54)
Nonaka, N., Kitajima, T., Yokobayashi, S., Xiao, G. P., Yamamoto, M., Grewal, S. I. S.,
and Watanabe, Y. (2002) Recruitment of cohesin to heterochromatic regions by
Swi6/HP1 in fission yeast. Nature Cell Biology 4, 89-93.
(55)
Glynn, E. F., Megee, P. C., Yu, H. G., Mistrot, C., Unal, E., Koshland, D. E., DeRisi, J.
L., and Gerton, J. L. (2004) Genome-wide mapping of the cohesin complex in the yeast
Saccharomyces cerevisiae. Plos Biology 2, 1325-1339.
(56)
Lengronne, A., Katou, Y., Mori, S., Yokobayashi, S., Kelly, G. P., Itoh, T., Watanabe,
Y., Shirahige, K., and Uhlmann, F. (2004) Cohesin relocation from sites of chromosomal
loading to places of convergent transcription. Nature 430, 573-578.
(57)
Schmidt, C., Brookes, N., and Uhlmann, F. (2009) Conserved features of cohesin binding
along fission yeast chromosomes. Genome Biology 10, R52.
(58)
Misulovin, Z., Schwartz, Y., Li, X.-Y., Kahn, T., Gause, M., MacArthur, S., Fay, J.,
Eisen, M., Pirrotta, V., Biggin, M., and Dorsett, D. (2008) Association of cohesin and
Nipped-B with transcriptionally active regions of the Drosophila melanogaster genome.
Chromosoma 117, 89-102.
(59)
Hu, B., Itoh, T., Mishra, A., Katoh, Y., Chan, K. L., Upcher, W., Godlee, C., Roig, M. B.,
Shirahige, K., and Nasmyth, K. (2011) ATP Hydrolysis Is Required for Relocating
25
Cohesin from Sites Occupied by Its Scc2/4 Loading Complex. Current Biology 21, 1224.
(60)
Fernius, J., Nerusheva, Olga O., Galander, S., Alves, Flavia de L., Rappsilber, J.,
and Marston, Adele L. Cohesin-Dependent Association of Scc2/4 with the Centromere
Initiates Pericentromeric Cohesion Establishment. Current Biology 23, 599-606.
(61)
Haering, C., Lowe, J., Hochwagen, A., and Nasmyth, K. (2002) Molecular architecture of
SMC proteins and the yeast cohesin complex. Mol Cell 9, 773-788.
(62)
Arumugam, P., Gruber, S., Tanaka, K., Haering, C. H., Mechtler, K., and Nasmyth, K.
(2003) ATP hydrolysis is required for cohesin's association with chromosomes. Curr Biol
13, 1941-1953.
(63)
Gruber, S., Haering, C. H., and Nasmyth, K. (2003) Chromosomal cohesin forms a ring.
Cell 112, 765-777.
(64)
Gruber, S., Arumugam, P., Katou, Y., Kuglitsch, D., Helmhart, W., Shirahige, K., and
Nasmyth, K. (2006) Evidence that loading of cohesin onto chromosomes involves
opening of its SMC hinge. Cell 127, 523-537.
(65)
Seitan, V. C., and Merkenschlager, M. (2012) Cohesin and chromatin organisation.
Current Opinion in Genetics & Development 22, 93-100.
(66)
Huang, J., Hsu, J. M., and Laurent, B. C. (2004) The RSC nucleosome-remodeling
complex is required for Cohesin's association with chromosome arms. Molecular Cell 13,
739-750.
(67)
Ritchie, K., Seah, C., Moulin, J., Isaac, C., Dick, F., and Bérubé, N. G. (2008) Loss
of ATRX leads to chromosome cohesion and congression defects. The Journal of Cell
Biology 180, 315-324.
(68)
Strom, L., Karlsson, C., Lindroos, H. B., Wedahl, S., Katou, Y., Shirahige, K., and
Sjogren, C. (2007) Postreplicative formation of cohesion is required for repair and
induced by a single DNA break. Science 317, 242-245.
(69)
Takahashi, T. S., Basu, A., Bermudez, V., Hurwitz, J., and Walter, J. C. (2008) Cdc7Drf1 kinase links chromosome cohesion to the initiation of DNA replication in Xenopus
egg extracts. Genes & Development 22, 1894-1905.
26
(70)
Takahashi, T. S., Yiu, P. Y., Chou, M. F., Gygi, S., and Walter, J. C. (2004) Recruitment
of Xenopus SCC2 and cohesin to chromatin requires the pre-replication complex. Nat
Cell Biol 6, 991-1001.
(71)
D'Ambrosio, C., Schmidt, C. K., Katou, Y., Kelly, G., Itoh, T., Shirahige, K., and
Uhlmann, F. (2008) Identification of cis-acting sites for condensin loading onto budding
yeast chromosomes. GENES & DEVELOPMENT 22, 2215-2227.
(72)
Lengronne, A., McIntyre, J., Katou, Y., Kanoh, Y., Hopfner, K. P., Shirahige, K., and
Uhlmann, F. (2006) Establishment of sister chromatid cohesion at the S. cerevisiae
replication fork. Mol Cell 23, 787-799.
(73)
Sebastian, J., Ravi, M., Andreuzza, S., Panoli, A. P., Marimuthu, M. P. A., and Siddiqi, I.
(2009) The plant adherin AtSCC2 is required for embryogenesis and sister-chromatid
cohesion during meiosis in Arabidopsis. Plant Journal 59, 1-13.
(74)
Sebastian, J., Ravi, M., Andreuzza, S., Panoli, A. P., Marimuthu, M. P. A., and Siddiqi, I.
(2009) The plant adherin AtSCC2 is required for embryogenesis and sister-chromatid
cohesion during meiosis in Arabidopsis. Plant J 59, 1 - 13.
(75)
Toth, A., Ciosk, R., Uhlmann, F., Galova, M., Schleiffer, A., and Nasmyth, K. (1999)
Yeast Cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion
between sister chromatids during DNA replication. Genes Dev 13, 320-333.
(76)
Skibbens, R., Corson, L., Koshland, D., and Hieter, P. (1999) Ctf7p is essential for sister
chromatid cohesion and links mitotic chromosome structure to the DNA replication
machinery. Genes & Dev 13, 307-319.
(77)
Kenna, M. A., and Skibbens, R. V. (2003) Mechanical link between cohesion
establishment and DNA replication: Ctf7p/Eco1p, a cohesion establishment factor,
associates with three different replication factor C complexes. Mol Cell Biol 23, 29993007.
(78)
Moldovan, G. L., Pfander, B., and Jentsch, S. (2006) PCNA controls establishment of
sister chromatid cohesion during S phase. Molecular Cell 23, 723-732.
(79)
Gandhi, R., Gillespie, P. J., and Hirano, T. (2006) Human Wapl Is a Cohesin-Binding
Protein that Promotes Sister-Chromatid Resolution in Mitotic Prophase. Current biology
: CB 16, 2406-2417.
27
(80)
Hartman, T., Stead, K., Koshland, D., and Guacci, V. (2000) Pds5p is an essential
chromosomal protein required for both sister chromatid cohesion and condensation in
Saccharomyces cerevisiae. J Cell Biol 151, 613-626.
(81)
Losada, A., and Hirano, T. (2005) Dynamic molecular linkers of the genome: the first
decade of SMC proteins. Genes Dev 19, 1269-1287.
(82)
Zhang, J. L., Shi, X. M., Li, Y. H., Kim, B. J., Jia, J. L., Huang, Z. W., Yang, T., Fu, X.
Y., Jung, S. Y., Wang, Y., Zhang, P. M., Kim, S. T., Pan, X. W., and Qin, J. (2008)
Acetylation of Smc3 by Eco1 is required for S phase sister chromatid cohesion in both
human and yeast. Molecular Cell 31, 143-151.
(83)
Ben-Shahar, T. R., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M., and Uhlmann,
F. (2008) Eco1-Dependent Cohesin Acetylation During Establishment of Sister
Chromatid Cohesion. Science 321, 563-566.
(84)
Rowland, B. D., Roig, M. B., Nishino, T., Kurze, A., Uluocak, P., Mishra, A., Beckouet,
F., Underwood, P., Metson, J., Imre, R., Mechtler, K., Katis, V. L., and Nasmyth, K.
(2009) Building Sister Chromatid Cohesion: Smc3 Acetylation Counteracts an
Antiestablishment Activity. Mol Cell 33, 763-774.
(85)
Unal, E., Heidinger-Pauli, J. M., Kim, W., Guacci, V., Onn, I., Gygi, S. P., and Koshland,
D. E. (2008) A molecular determinant for the establishment of sister chromatid cohesion.
Science 321, 566-569.
(86)
Woo, J.-S., Lim, J.-H., Shin, H.-C., Suh, M.-K., Ku, B., Lee, K.-H., Joo, K., Robinson,
H., Lee, J., Park, S.-Y., Ha, N.-C., and Oh, B.-H. Structural Studies of a Bacterial
Condensin Complex Reveal ATP-Dependent Disruption of Intersubunit Interactions. Cell
136, 85-96.
(87)
Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando,
M., Shirahige, K., Hyman, A. A., Mechtler, K., and Peters, J.-M. Sororin Mediates Sister
Chromatid Cohesion by Antagonizing Wapl. Cell 143, 737-749.
(88)
Schmitz, J., Watrin, E., Lenart, P., Mechtler, K., and Peters, J. M. (2007) Sororin is
required for stable binding of cohesin to chromatin and for sister chromatid cohesion in
interphase. Curr Biol 17, 630-636.
28
(89)
Mayer, M. L., Gygi, S. P., Aebersold, R., and Hieter, P. (2001) Identification of
RFC(Ctf18p, Ctf8p, Dcc1p): An alternative RFC complex required for sister chromatid
cohesion in S. cerevisiae. Mol Cell 7, 959-970.
(90)
Mayer, M. L., Pot, I., Chang, M., Xu, H., Aneliunas, V., Kwok, T., Newitt, R.,
Aebersold, R., Boone, C., Brown, G. W., and Hieter, P. (2004) Identification of Protein
Complexes Required for Efficient Sister Chromatid Cohesion. Molecular Biology of the
Cell 15, 1736-1745.
(91)
Milutinovich, M., Unal, E., Ward, C., Skibbens, R. V., and Koshland, D. (2007) A multistep pathway for the establishment of sister chromatid cohesion. Plos Genet 3.
(92)
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009) Budding Yeast
Wpl1(Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing
Reaction. Current Biology 19, 492-497.
(93)
Warren, C. D., Eckley, D. M., Lee, M. S., Hanna, J. S., Hughes, A., Peyser, B., Jie, C. F.,
Irizarry, R., and Spencer, F. A. (2004) S-phase checkpoint genes safeguard high-fidelity
sister chromatid cohesion. Mol Biol Cell 15, 1724-1735.
(94)
Chen, Z., McCroskey, S., Guo, W., Li, H., and Gerton, J. L. A Genetic Screen to
Discover Pathways Affecting Cohesin Function in Schizosaccharomyces pombe
Identifies Chromatin Effectors. G3: Genes|Genomes|Genetics 2, 1161-1168.
(95)
Jiang, L., Yuan, L., Xia, M., and Makaroff, C. A. (2010) Proper Levels of the
Arabidopsis Cohesion Establishment Factor CTF7 Are Essential for Embryo and
Megagametophyte, But Not Endosperm, Development. Plant Physiol 154, 820-832.
(96)
Singh, D., Andreuzza, S., Panoli, A., and Siddiqi, I. AtCTF7 is required for establishment
of sister chromatid cohesion and association of cohesin with chromatin during meiosis in
Arabidopsis. BMC Plant Biol 13, 117.
(97)
Bolaños-Villegas, P., Yang, X., Wang, H.-J., Juan, C.-T., Chuang, M.-H., Makaroff, C.
A., and Jauh, G.-Y. Arabidopsis CHROMOSOME TRANSMISSION FIDELITY 7
(AtCTF7/ECO1) is required for DNA repair, mitosis and meiosis. The Plant J, n/a-n/a.
(98)
Waizenegger, I. C., Hauf, S., Meinke, A., and Peters, J.-M. (2000) Two Distinct
Pathways Remove Mammalian Cohesin from Chromosome Arms in Prophase and from
Centromeres in Anaphase. Cell 103, 399-410.
29
(99)
Losada, A., Hirano, M., and Hirano, T. (1998) Identification of Xenopus SMC protein
complexes rerquired for sister chromatid cohesion. Genes Dev 12, 1986-1997.
(100) Sumara, I., Vorlaufer, E., Gieffers, C., Peters, B. H., and Peters, J. M. (2000)
Characterization of vertebrate cohesin complexes and their regulation in prophase. J Cell
Biol 151, 749-761.
(101) Gimenez-Abian, J. F., Sumara, I., Hirota, T., Hauf, S., Gerlich, D., de la Torre, C.,
Ellenberg, J., and Peters, J. M. (2004) Regulation of sister chromatid cohesion between
chromosome arms. Curr Biol 14, 1187-1193.
(102) Hauf, S., Roitinger, E., Koch, B., Dittrich, C. M., Mechtler, K., and Peters, J. M. (2005)
Dissociation of cohesin from chromosome arms and loss of arm cohesion during early
mitosis depends on phosphorylation of SA2. Plos Biol 3, 419-432.
(103) Losada, A., Hirano, M., and Hirano, T. (2002) Cohesin release is required for sister
chromatid resolution, but not for condensin-mediated compaction, at the onset of mitosis.
Genes Dev 23, 3004-3016.
(104) Sumara, I., Vorlaufer, E., Stukenberg, P., Kelm, O., Redemann, N., Nigg, E., and Peters,
J. (2002) The dissociation of cohesin from chromosomes in prophase is regulated by
polo-like kinase. Mol Cell 9, 515-525.
(105) Kitajima, T. S., Kawashima, S. A., and Watanabe, Y. (2004) The conserved kinetochore
protein shugoshin protects centromeric cohesion during meiosis. Nature 427, 510-517.
(106) Rivera, T., and Losada, A. (2006) Shugoshin and PP2A, shared duties at the centromere.
Bioessays 28, 775-779.
(107) Tang, Z. Y., Shu, H. J., Qi, W., Mahmood, N. A., Mumby, M. C., and Yu, H. T. (2006)
PP2A is required for centromeric localization of sgol and proper chromosome
segregation. Dev Cell 10, 575-585.
(108) Dai, J., Sullivan, B. A., and Higgins, J. M. G. (2006) Regulation of mitotic chromosome
cohesion by Haspin and Aurora B. Developmental Cell 11, 741-750.
(109) Verni, F., Gandhi, R., Goldberg, M. L., and Gatti, M. (2000) Genetic and Molecular
Analysis of wings apart-like (wapl), a Gene Controlling Heterochromatin Organization in
Drosophila melanogaster. Genetics 154, 1693-1710.
(110) Chatterjee, A., Zakian, S., Hu, X. W., and Singleton, M. R. (2013) Structural insights into
the regulation of cohesion establishment by Wpl1. Embo J 32, 677-687.
30
(111) Ouyang, Z., Zheng, G., Song, J., Borek, D. M., Otwinowski, Z., Brautigam, C. A.,
Tomchick, D. R., Rankin, S., and Yu, H. Structure of the human cohesin inhibitor Wapl.
Proc Natl Acad Sci 110, 11355-11360.
(112) Kueng, S., Hegemann, B., Peters, B. H., Lipp, J. J., Schleiffer, A., Mechtler, K., and
Peters, J. M. (2006) Wapl controls the dynamic association of cohesin with chromatin.
Cell 127, 955-967.
(113) Lafont, A. L., Song, J. H., and Rankin, S. (2011) Sororin cooperates with the
acetyltransferase Eco2 to ensure DNA replication-dependent sister chromatid cohesion.
Proc Natl Acad Sci USA 107, 20364-20369.
(114) Rankin, S., Ayad, N. G., and Kirschner, M. W. Sororin, a Substrate of the AnaphasePromoting Complex, Is Required for Sister Chromatid Cohesion in Vertebrates. Mol Cell
18, 185-200.
(115) Toyoda, Y., Furuya, K., Goshima, G., Nagao, K., Takahashi, K., and Yanagida, M.
(2002) Requirement of chromatid cohesion proteins Rad21/Scc1 and Mis4/Scc2 for
normal spindle-kinetochore interaction in fission yeast. Curr Biol 12, 347-358.
(116) Uhlmann, F., Lottspeich, F., and Nasmyth, K. (1999) Sister-chromatid separation at
anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400, 37-42.
(117) Tomonaga, T., Nagao, K., Kawasaki, Y., Furuya, K., Murakami, A., Morishita, J., Yuasa,
T., Sutani, T., Kearsey, S., Uhlmann, F., Nasmyth, K., and Yanagida, M. (2000)
Characterization of fission yeast cohesin: essential anaphase proteolysis of Rad21
phosphorylated in the S phase. Genes Dev 14, 2757-2770.
(118) Musacchio, A., and Salmon, E. D. (2007) The spindle-assembly checkpoint in space and
time. Nat Rev Mol Cell Biol 8, 379-393.
(119) Stemmann, O., Zou, H., Gerber, S., Gygi, S., and Kirschner, M. (2001) Dual inhibition of
sister chromatid separation at metaphase. Cell 107, 715-726.
(120) CohenFix, O., Peters, J. M., Kirschner, M. W., and Koshland, D. (1996) Anaphase
initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of
the anaphase inhibitor Pds1p. Genes Dev 10, 3081-3093.
(121) Ciosk, R., Zachariae, W., Michaelis, C., Shevchenko, A., Mann, M., and Nasmyth, K.
(1998) An ESP1/PDS1 complex regulates loss of sister chromatid cohesion at the
metaphase to anaphase transition in yeast. Cell 93, 1067-1076.
31
(122) Zou, H., McGarry, T., DBernal, T., and Krischner, M. (1999) Identification of a
vertebrate sister-chromatid separation inhibitor involved in transformation and
tumorigenesis. Science 285, 418-422.
(123) Uhlmann, F. (2003) Chromosome cohesion and separation: From men and molecules.
Curr Biol 13, R104-R114.
(124) Liu, Z., and Makaroff, C. A. (2006) Arabidopsis separase AESP is essential for embryo
development and the release of cohesin during meiosis. Plant Cell 18, 1213-1225.
(125) Jensen, S., Segal, M., Clarke, D. J., and Reed, S. I. (2001) A novel role of the budding
yeast separin Esp1 in anaphase spindle elongation: Evidence that proper spindle
association of Esp1 is regulated by Pds1. J Cell Biol 152, 27-40.
(126) Wu, S., Scheible, W. R., Schindelasch, D., Van Den Daele, H., De Veylder, L., and
Baskin, T. I. (2010) A conditional mutation in Arabidopsis thaliana separase induces
chromosome non-disjunction, aberrant morphogenesis and cyclin B1;1 stability.
Development 137, 953-961.
(127) Yang, X. H., Boateng, K. A., Strittmatter, L., Burgess, R., and Makaroff, C. A. (2009)
Arabidopsis Separase Functions beyond the Removal of Sister Chromatid Cohesion
during Meiosis. Plant Physiol 151, 323-333.
(128) Kozak, J., West, C. E., White, C., da Costa-Nunes, J. A., and Angelis, K. J. (2009) Rapid
repair of DNA double strand breaks in Arabidopsis thaliana is dependent on proteins
involved in chromosome structure maintenance. DNA Repair 8, 413-419.
(129) da Costa-Nunes, J. A., Bhatt, A. M., O'Shea, S., West, C. E., Bray, C. M., Grossniklaus,
U., and Dickinson, H. G. (2006) Characterization of the three Arabidopsis thaliana
RAD21 cohesins reveals differential responses to ionizing radiation. J Exp Bot 57, 971983.
(130) Bolanos-Villegas, P., Yang, X., Wang, H. J., Juan, C. T., Chuang, M. H., Makaroff, C.
A., and Jauh, G. Y. Arabidopsis Chromosome Transmission Fidelity 7 (AtCTF7/ECO1)
is required for DNA repair, mitosis and meiosis. Plant J.
(131) Schindler, U., Beckmann, H., and Cashmore, A. R. (1993) HAT3.1, a novel Arabidopsis
homeodomain protein containing a conserved cysteine-rich region. Plant J 4, 137-150.
(132) Bienz, M. (2006) The PHD finger, a nuclear protein-interaction domain. Trends
Biochemical Sci 31, 35-40.
32
(133) Li, H. T., Ilin, S., Wang, W. K., Duncan, E. M., Wysocka, J., Allis, C. D., and Patel, D. J.
(2006) Molecular basis for site-specific read-out of histone H3K4me3 by the BPTF PHD
finger of NURF. Nature 442, 91-95.
(134) Zhang, Y., LeRoy, G., Seelig, H.-P., Lane, W. S., and Reinberg, D. The
Dermatomyositis-Specific Autoantigen Mi2 Is a Component of a Complex Containing
Histone Deacetylase and Nucleosome Remodeling Activities. Cell 95, 279-289.
(135) Simon, J. A., and Tamkun, J. W. (2002) Programming off and on states in chromatin:
mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet Dev 12,
210-218.
(136) Pascual, J., Martinez-Yamout, M., Dyson, H. J., and Wright, P. E. (2000) Structure of the
PHD Zinc Finger from Human Williams-Beuren Syndrome Transcription Factor. J Mol
Biol 304, 723-729.
(137) Aasland, R., Gibson, T., and Stewart, F. (1995) The PHD finger: implications for
chromatin-mediated transcriptional regulation. Trends in Biochem Sci 20, 50-59.
(138) Cosoy, L., and Ganem, D. (2003) PHD domains and E3 ubiquitin ligases: viruses make
the conncetion. Trend. Cell Biol. 13, 7-12.
(139) Kim, T., and Buratowski, S. (2007) Two Saccharomyces cerevisiae JmjC Domain
Proteins Demethylate Histone H3 Lys36 in Transcribed Regions to Promote Elongation.
J Biol Chem 282, 20827-20835.
(140) Shi, X., Kachirskaia, I., Walter, K. L., Kuo, J.-H. A., Lake, A., Davrazou, F., Chan, S.
M., Martin, D. G. E., Fingerman, I. M., Briggs, S. D., Howe, L., Utz, P. J., Kutateladze,
T. G., Lugovskoy, A. A., Bedford, M. T., and Gozani, O. (2007) Proteome-wide Analysis
in Saccharomyces cerevisiae Identifies Several PHD Fingers as Novel Direct and
Selective Binding Modules of Histone H3 Methylated at Either Lysine 4 or Lysine 36. J
Biol Chem 282, 2450-2455.
(141) Musselman, C. A., and Kutateladze, T. G. (2009) PHD Fingers Epigenetic Effectors and
Potential Drug Targets. Molecular Interventions 9, 314-323.
(142) Yang, X., Makaroff, C. A., and Ma, H. (2003) The Arabidopsis male meiocyte death1
gene Is required for male meiosis and encodes a novel putative chromatin remodeling
factor. Plant Cell 15, 1281-1295.
33
(143) Wilson, Z., Morroll, S., Dawson, J., Swarup, R., and Tighe, P. (2001) The Arabidopsis
MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis,
with homology to the PHD-finger family of transcription factors. Plant J 28, 27-39.
34
Chapter 2
35
Arabidopsis WAPL is Essential for the Prophase Removal of
Cohesin During Meiosis
Kuntal De, Lauren Sterle*, Laura Krueger*, Xiaohui Yang, Christopher A. Makaroff
Author contributions: Kuntal De and Chris Makaroff contributed to data analysis and writing of
the manuscript; Kuntal De contributed to data collection; Kuntal De and Lauren Sterle
contributed to genotype wapl1-1wapl2, wapl1-1wapl2Ctf+/- plants; Laura Krueger contributed
for wapl1-2wapl2 and wapl1-1wapl2Ctf+/- plant genotyping; Xiaohui Yang provided Figure 2.7
(panel F, Q and V), Figure 2.8 panel (I, K and L), Figure 2.12 (panel D).
This paper is in press at PLOS Genetics
* Undergraduate author.
36
2.1 Abstract
Sister chromatid cohesion, which is mediated by the cohesin complex, is essential for the proper
segregation of chromosomes in mitosis and meiosis. The establishment of stable sister chromatid
cohesion occurs during DNA replication and involves acetylation of the complex by the
acetyltransferase CTF7. The majority of cohesin complexes are typically removed from the
chromosomes during prophase. Studies in fly, human and yeast have shown that this process
involves the WAPL and PDS5 mediated opening of the cohesin ring at the junction between the
SMC3 ATPase domain and the N-terminal domain of cohesin’s alpha-kleisin subunit. We report
here the isolation and detailed characterization of WAPL in Arabidopsis thaliana. We show that
Arabidopsis contains two WAPL genes, which share overlapping functions. Analysis of plants in
which both WAPL genes have been inactivated by T-DNA insertions showed that unlike the
situation in flies and vertebrate cells, WAPL is not an essential protein in plants. Inactivation of
Arabidopsis WAPL has little effect on plant growth, but does result in a significant reduction in
male and female fertility. The removal of cohesin from chromosomes during meiotic prophase is
blocked in Atwapl mutants resulting in chromosome bridges, broken chromosomes and the
uneven chromosome segregation. In contrast, while subtle mitotic alterations are observed in
some somatic cells, cohesin complexes appear to be removed normally. Taken together our
results demonstrate that WAPL plays a critical role in meiosis and suggests that mechanisms
involved in the prophase removal of cohesin may vary between mitosis and meiosis in plants.
2.2 Introduction
The timely establishment and dissolution of sister chromatid cohesion is essential for the proper
segregation chromosomes during cell division, as well as the repair of DNA damage and the
control of transcription (reviewed in(1-3)). Four proteins form the core cohesion complex:
Structural Maintenance of Chromosome (SMC) proteins 1 (SMC1) and 3 (SMC3), Sister
Chromatid Cohesion (SSC) protein 3 (SCC3), and an alpha-kleisin, either SCC1 which is part of
the mitotic cohesion complex, or REC8 that functions during meiosis. Studies in several
organisms have shown that cohesin complex components and the general mechanisms of cohesin
action are conserved across species; however variations in complex member composition and
37
mechanistic roles of some complex members have been observed between some species and
during mitosis and meiosis (reviewed in (3-6)).
Cohesin complexes are recruited to the chromatin by the Scc2/Scc4 complex throughout
the cell cycle, with most of the complexes loaded onto the chromosomes during telophase/G1 (79). Prior to S-phase cohesin association with the chromatin is dynamic and regulated in part by a
complex, which has been referred to by several names, including “releasin”, the
“antiestablishment” and/or ”antimaintenance” complex, which consists of the Wings Apart-like
protein (Wapl) and the Precocious Dissociation of Sisters protein 5 (Pds5)(10-15). In vertebrates
the sororin protein is also part of the complex (11, 15-17). Linkage of the cohesion complex to
the chromatin to form sister chromatid cohesion is established in a DNA replication coupled
process by the Ctf7/Eco1-dependent acetylation of the ATPase head domain of SMC3(18).
Cohesin is subsequently removed from the chromosomes in steps. While the specific
details vary somewhat depending on the organism being studied, the general process appears to
be relatively conserved. In higher eukaryotes, arm cohesin is removed during mitotic prophase
in a Polo-like kinase, cyclin-dependent kinase and Wapl dependent process that involves opening
of the cohesin ring at the junction between the SMC3 ATPase domain and the N-terminal
winged-helix domain (WHD) of SCC1 (17, 19-21). Centromeric cohesin is protected by the
Shugoshin (Sgo1)–protein phosphatase 2A (PP2A) complex, which binds and dephosphorylates
cohesin, protecting it from Wapl (22, 23). At the metaphase to anaphase transition the metalloproteinase separase is activated and cleaves the SCC1 subunit of centromere-localized cohesion
complexes, allowing the cohesin ring to open and the sister chromatids to disjoin (24). Meiotic
cohesin is removed in three steps: a prophase step, followed by the separase dependent cleavage
of chromosome arm associated REC8 at anaphase I, and then centromere associated REC8 at
anaphase II (25, 26).
The importance of Wapl in controlling mitotic sister chromatid cohesion has been known
for some time; however only recently have we begun to understand how specifically Wapl helps
facilitate the association cohesin with chromosomes. Wapl was first identified in Drosophila as a
protein involved in the regulation of heterochromatin organization, with mutant flies containing
parallel sister chromatids with loosened cohesion at their centromeres (27). More recently
structural studies on Wapl and its role(s) in sister chromatid cohesion during mitosis have been
conducted in several organisms, including fungi, fly and vertebrates (28-30). Wapl proteins from
38
different species contain a conserved C-terminus with divergent N-terminal domains of variable
lengths. Studies on fungal and human Wapl have provided insights into structural features
associated with the proteins (28, 29) . For example, the divergent N-terminus appears to be a
primary Pds5 binding region, while the C-terminus contains cohesion-binding determinants.
While a number of similarities are present between the yeast and vertebrate proteins, structural
and binding differences have also been identified. These results, along with the observation that
wapl mutants in different organisms can exhibit different phenotypes indicate that there is still
much we do not understand about Wapl and how its structure is related to its function.
Furthermore, while the effect of Wapl inactivation on mitosis has been studied in several
organisms, little is known about the role of the protein during meiosis.
In the current study, we have characterized WAPL in the model organism Arabidopsis
thaliana. We show that AtWAPL has a relatively minor role in somatic cells, but plays a critical
role in facilitating sister chromatid separation during meiosis. Inactivation of AtWAPL had little
effect on plant growth, but resulted in a significant reduction in both male and female fertility.
Meiotic defects, including alterations in chromosome condensation and the separation of
homologous chromosomes and sister chromatids was observed in most, but not all meiocytes.
The removal of cohesin from meiotic chromosomes during prophase was blocked in atwapl
mutants resulting in chromosome bridges, broken chromosomes and the uneven segregation of
chromosomes.
2.3 Materials and Methods
2.3.1 Plant material and growth conditions
Arabidopsis thaliana, Columbia ecotype, was used for crossing, transcript analysis and
microscopic studies. Plants were grown in Metro-Mix 200 soil (Scotts-Sierra Horticulture
Products; http://www.scotts.com) or on germination plates (Murashige and Skoog; Caisson
Laboratories; www.caissonlabs.peachhost.com) in a growth chamber at 22 oC with a 16-h-light/
8-h-dark cycle. Arabidopsis T-DNA lines were obtained from Arabidopsis Biological Resource
Center. Leaves were collected from rosette-stage plants grown on soil and used for DNA
isolation and genotyping. Approximately 24 d after germination, buds were collected and staged
for microscopy studies. For transcript analysis all samples were harvested, frozen in liquid N 2,
and stored at -80oC until needed.
39
2.3.2 Chromosome analysis and immunolocalization
Male meiotic chromosome spreads were performed on floral buds fixed in Carnoy's fixative
(ethanol: chloroform:acetic acid: 6:3:1) and prepared as described previously (31).
Chromosomes were stained with using DAPI, observed under Olympus BX51 epifluorescence
microscope system and images captured using Spot camera system and processed using Adobe
Photoshop.
In order to study mitosis Arabidopsis seeds were sterilized and plated on MS agar plates.
After 7days of plating the root tips from the seedlings were excised, fixed and digestion was
extended for 1 hr.
Immunolocalization studies were performed on 4% paraformaldehyde fixed cells as
previously described (32). Meiotic stages were assigned based on the chromosome structure and
morphology as well as the developmental stages of the surrounding anther cells. Primary
antibodies (1:500 dilutions) used in this study (SYN1, SMC3, ASY1, ZYP1, β-tubulin) have
been described (33-36). The slides were incubated overnight at 40C, and then washed for 2h with
eight changes of wash buffer. The slides were then incubated overnight with Alexa 488 labeled
goat anti- rabbit secondary antibody (1:500) or Alexa Fluor 594 labeled goat anti-mouse
secondary antibody (1:500) overnight at 40C and again washed and stained with DAPI.
FISH was conducted on inflorescences fixed in Carnoy's solution for 1 h at room
temperature after replenishing the fixative. FISH was performed on meiotic spreads as
previously described (37, 38) with the following change. Sample were treated with a solution of
freshly prepared 70% formamide in 2X SSC for 2min at 80 0C and dehydrated through a graded
ethanol series (70%, 90%, 100%) of 5min each incubation at -200C. The slides were then dried at
room temperature before adding the probe. The 180-bp pericentromeric repeat (39) was
amplified, purified, labeled with Roche High Prime fluorescein and was used at a concentration
of 5 ugml-1. Telomere-repeat sequences were detected by hybridization with the 5'-end
fluorescein isothiocyanate-labeled oligonucleotide probe, (CCCTAAA)6 at 5ugml-1. Slides were
counterstained with DAPI and observed under epifluorescence microscope as describe above.
2.3.3 Expression analyses
40
Total RNA was extracted from stems, buds, roots, leaves and siliques of wild-type plants to
examine WAPL expression patterns, and from inflorescencses of wild-type, atwapl1.1wapl2 and
Atwapl1.2wapl2 plants to measure WAPL transcript levels in mutant plants. Total RNA was
extracted from with the Plant RNeasy Mini kit (Qiagen, Hilden, Germany), treated with Turbo
DNase I (Ambion) and used for cDNA synthesis with an oligo (dt) primer and a First Strand
cDNA Synthesis Kit (Roche). Real time PCR was performed with SYBR-Green PCR Mastermix
(Clontech) and the amplification was monitored on a CFXsystems (Biorad). Expression was
normalized against β-tubulin-2. At least three biological replicates were performed, with two
technical replicates for each sample. Primers used in this study are presented in (Supplementary
Table 1)
2.3.4 Analysis of male and female gametophyte development and embryo
development
Whole-mount clearing was used to determine the embryo phenotypes (40, 41). Sliques from
wild-type and mutant plants were dissected and cleared in Herr's solution containing lactic acid:
chloral hydrate: phenol: clove oil: xylene ( 2:2:2:2:1, w/w). Embryo development was studied
microscopically with a Olympus BX51 microscope equipped with differential interference
contrast optics. Female gametophyte analysis was performed as described in (42).
2.3.5 Analysis of pollen
Whole anther morphology was analyzed by staining with Alexander staining(43).
2.4 Results
Analysis of the Arabidopsis genome identified two genes, which we have designated as
AtWAPL1 (At1g11060) and AtWAPL2 (At1g61030), which display high similarity to WAPL
genes characterized in other organisms. The predicted AtWAPL1 (930 amino acids) and
AtWAPL2 (840 amino acids) proteins are larger than those from yeast and worm, but shorter
than the vertebrate and fly proteins (Figure 1A). AtWAPL1 and AtWAPL2 share 82% amino
acid similarity with each other and 30-37% similarity with WAPL proteins from other organisms
(Figure S1). Both Arabidopsis proteins contain the conserved WAPL C-terminal domain. The Nterminus of vertebrate Wapl proteins contains FGF motifs that are involved in Pds5 binding (44).
41
FGF motifs are not present in AtWAPL1 and AtWAPL2, or the proteins from other
nonvertebrates.
42
Figure 2.1 Arabidopsis WAPL protein and gene structures. (A) WAPL proteins from
different organisms are shown. Yellow boxes represent the conserved WAPL domain. Black
lines in human Wapl represent FGF motifs, which have been shown to be involved in PDS5
binding. Sizes of the proteins in amino acids are shown to the right. (B) Genomic organization
and T-DNA insertion sites in Arabidopsis WAPL1 and WAPL2. Primer sets used for genotyping
of AtWAPL1 (1.1LP, 1.1RP and LBb1.3 for Atwapl1.1; 1.2LP, 1.2 RP and LBb1.3 for Atwapl1.2)
and AtWAPL2 (wapl2LP, wapl2RP and LBb1.3 for wapl2) T-DNA lines are shown. Quantitative
RT-PCR primers are indicated by 1F, 1R, 2F and 2R.
2.4.1 Arabidopsis WAPL genes are redundant, but not essential
In order to determine if the two predicted Arabidopsis WAPL genes are in fact involved in
controlling sister chromatid cohesion, we characterized T-DNA insertion lines that were
available in the Arabidopsis Stock Center. Two lines were characterized for AtWAPL1
(Atwapl1.1 and Atwapl1.2, Figure 2.1B) and one line for AtWAPL2 (Atwapl2, Figure 2.1B).
Plants homozygous for the individual insertion lines displayed normal vegetative growth,
development and fertility when compared with wild type plants. The high degree of similarity
between AtWAPL1 and AtWAPL2 raised the possibility that the two genes share overlapping
functions. Therefore, we crossed Atwapl2 with both Atwapl1.1 and Atwapl1.2. Plants double
homozygous for both combinations (Atwapl1.1wapl2 and Atwapl1.2wapl2) were isolated and
studied. Plants homozygous for both the Atwapl1.2 and Atwapl2 mutations displayed normal
vegetative growth and development, but a reduction in fertility. Average seed set/silique in
Atwapl1.2wapl2 plants (43.7±5.1, n=32) is lower than wild type (53.7±4, n=42, p< 0.0001).
Plants containing the Atwapl1.1wapl2 double mutant combination showed a more pronounced
phenotype. Specifically, the plants grew somewhat slower than wild type plants (Figure 2.2A)
and produced shorter siliques, which contained fewer seeds than Atwapl1.2wapl2 siliques
(37.5±6.7, p< .0001). Further analysis of both double mutant combinations identified similar
alterations in reproduction, including aborted pollen and ovules prior to fertilization and embryo
defects in approximately 25% of the fertilized seed, with higher numbers of aborted pollen,
ovules and seed consistently observed in Atwapl1.1wapl2 plants (Figure 2.2B, C).
43
Figure 2.2 Atwapl1.1wapl2 plants exhibit reduced fertility. (A) Thirty five day-old wild-type
and Atwapl1.1wapl2 plants.
(B) Alexander staining of wild-type, Atwapl1.1, Atwapl2, and
Atwapl1.1wapl2 pollen. Green pollen is nonviable. The number of viable pollen (red) in
Atwapl1.1wapl2 is approximately 50% of wild type levels. Size Bars = 10 µm. (C) Seed setting
in siliques of wild type, Atwapl1.2wapl2 and Atwapl1.1wapl2 plants.
44
The Atwapl1.2 and Atwapl2 T-DNA insertions are in the first exon and intron,
respectively, while the Atwapl1.1 insert is located in intron 6 (Figure 2.1B). In order to
investigate the differences we observe between the two double mutant combinations and
specifically determine if the T-DNA insertions result in complete inactivation of the genes we
examined AtWAPL1 and AtWAPL2 transcriptional patterns in both wild type and mutant plants.
Transcripts for both genes were detected in roots, leaves, buds and sliques of wild type plants;
little to no transcript for either gene was detected in stems (Figure 2.3A). While both genes are
active, AtWAPL1 transcripts were more abundant than those for AtWAPL2 in all tissues
examined, with the highest overall levels observed in roots (Figure 2.3A). Analysis of WAPL
transcript levels by qPCR with primers located downstream of the T-DNA inserts in the different
double mutant backgrounds indicate that the Atwapl1.1 mutation results in essentially complete
inactivation of the gene, while relatively high levels of RNA are present downstream of the
Atwapl1.2 T-DNA insert (Figure 2.3B). Low levels (>10% wild type) of truncated Atwapl2
transcripts were also detected downstream of the Atwapl2 T-DNA insert.
45
Figure 2.3 AtWAPL1 and AtWAPL2 show similar expression patterns. (A) Relative transcript levels
for AtWAPL1 and AtWAPL2 in different wild type tissues are shown. (B) AtWAPL transcript levels in
bud tissue from wild type, Atwapl1.1wapl2, and Atwapl1.2wapl2 plants. Results are shown as means ±
46
SD (n = 3). Asterisks represent significant differences (*P < 0.0001, **P < 0.95; Student's t-test) relative
to wild type.
The presence of truncated AtWAPL2 transcripts in atwapl2 plants raised the possibility
that a truncated, partially functional version of WAPL2 may be produced. To address this
possibility we introduced a WAPL RNAi construct (Figure 2.4 A) into wild type and
Atwapl1.1wapl2 plants. Expression of WAPL RNAi in Atwapl1.1wapl2 plants reduced the level
of truncated Atwapl2 transcripts to less than 5% of wild type levels but had no effect on the
phenotype of Atwapl1.1wapl2 plants (Figure 2.4B). This suggests that Atwapl1.1 and wapl2
alleles result in essentially complete inactivation of the genes. The weaker phenotype associated
with Atwapl1.2wapl2 plants may be due to the production of a partially functional protein from
the Atwapl1.2 allele. Because Atwapl1.1wapl2 plants appear to contain near complete knockouts
of both genes we confined our more detailed analyses to Atwapl1.1wapl2 plants.
Figure 2.4 A. Construct is shown 35S promoter and restriction sites for enzyme cleavage in pFGC 5941
plasmid. B. Real time mRNA expression showing transcript of both of the AtWAPL is downregulated
when wild type plants are transformed with 35SWAPL2RNAi construct. Expression of 35S WAPL RNAi
in Atwapl1.1wapl2 plants reduced the level of truncated Atwapl2 transcripts to less than 5% of wild type
levels.
47
Anthers of Atwapl1.1wapl2 plants contain less pollen than wild type plants (229±21.3,
n=12 verses 458±23.8, n=10, p< 0.0001) and 28% of the pollen (n= 2752) that is produced is not
viable, appearing green and shriveled when analyzed by Alexander stain (Figure 2.2B). Analysis
of seed development in Atwapl1.1wapl2 plants revealed that 28% of the ovules (n=1689) abort
prior to fertilization, while 23% of the seed (n= 2022) that is produced is shrunken and shriveled.
Examination of cleared ovules from developmentally staged siliques of Atwapl1.1wapl2 plants
identified defects beginning after the Megaspore Mother Stage (Figure 2.5 A, D).
Approximately 16% of ovules examined (n=409) arrest at FG1 with one nucleus (Figure 2.5E).
Approximately eight percent of the ovules arrest at FG2 (Figure 2.5F). In most instances the
arrested nuclei persisted throughout ovule development and were observed in siliques with
normal FG7 ovules.
Figure 2.5 Female gametophyte development is altered in and Atwapl1.1wapl2 plants.
Cleared ovules of wild-type (A-C) and Atwapl1.1wapl2 (D-F) plants are shown at the Megaspore Mother
48
Cell stage (A, D), wild type FG2 (B, E) and wild-type FG7 stages (C, F). Female gametophytes were
found to arrest at FG1 (E) and FG2 (F) in Atwapl1.1wapl2 plants. Images shown for Atwapl1.1wapl2
represent the most common phenotypes observed. Arrows indicate arrested nuclei. Size bars = 10μM
2.4.2 AtWAPL plays an important role in meiosis
The presence of aborted ovules and reduced numbers of pollen in Atwaplwapl2 plants suggested
that AtWAPL plays an important role in meiosis. aTo investigate this possibility further we
analyzed
DAPI
(4',
6-diamidino-2-phenylindole)
stained
meiotic
chromosomes
in
Atwapl1.1wapl2 plants. Early stages of meiosis appeared relatively normal in the mutant. As
observed in wild type meiocytes, chromosomes began to condense as fine thin threads during
leptotene (Figure 2.6A, E), and homologous chromosome co-alignment and pairing occurred
during early to mid zygotene (Figure 2.6B, F). In wild type meiocytes homologous chromosomes
are fully synapsed by the beginning of pachytene (Figure 2.6C). Most late zygotene/ pachytene
stage meiocytes exhibited normal synapsis. However, in 15% of the Atwapl1.1wapl2 pachytene
meiocytes (n=135) the chromosomes co-aligned, but did not synapse completely (Figure 2.6G).
In addition, four to six brightly stained chromocenters are typically observed in wild type
meiocytes, while in the mutant we observed three or fewer heterochromatin regions in 60% of
the cells (n=84), suggesting that abnormal association of heterochromatic regions may occur in
the mutant.
Desynapsis occurs during diplotene (Figure 2.6D) with five bivalents appearing at
diakinesis in wild type meiocytes (Figure 2.6I). The five bivalents align on the equatorial plane
at metaphase I (Figure 2.6J). Segregation of homologous chromosomes and then sister
chromatids at anaphase I and anaphase II, respectively, results in the presence of four sets of five
individual chromosomes at the cell poles by telophase II (Figures 2.6K, 2.6L and 2.6Q, 2.6R).
Diplotene appeared relatively normal in the mutant (Figure 2.6H). However, alterations were
observed at diakinesis in essentially all cells. Specifically meiocytes were observed in which the
chromosomes condensed into either one or two large intertwined masses of chromatin (Figure
2.6M, n=25). The chromosomes continued to appear primarily as one intertwined mass as they
further condensed and moved to the cell equator; five normal appearing individual bivalents
were never observed (Figure 2.6N, n=23). While some (<20%) normal cells were observed at
the metaphase I-anaphase I transition, most cells contained stretched chromosomes that did not
49
separate properly (Figure 2.6O, n=57). Chromosome bridges and lagging chromosomes were
observed by late anaphase I and telophase I (Figure 5P, n=31), respectively in the majority of
meiocytes. In most cells (68%, n=31) “sticky” chromosome masses were observed at one or both
poles at metaphase II (Figure 2.6U); however in approximately 30% of the meiocytes individual
chromosomes
appeared
to
align
normally
on
the
plate.
Twenty
or
more
chromosomes/chromosome fragments were typically observed scattered around most (62%,
n=26) anaphase II and telophase II cells (Figure 2.6V). Ultimately, a mixture of polyads (6%),
tetrads containing a mixture of shrunken and mis-shaped microspores (26%) containing varying.
amounts of DNA (Figure 2.6W, X, n= 506), and relatively normal appearing tetrads were
observed.
50
Figure 2.6 Atwapl1.1wapl2 plants exhibit defects during male meiosis. DAPI stained chromosomes
from male meiocytes of wild type (A-D, I-L, Q-S) and Atwapl1.1wapl2 plants (E-H, M-P, U-W) are
51
shown at leptotene (A, E), zygotene (B, F), pachytene (C, G), diplotene (D, H), diakinesis (I, M),
metaphase I (J, N), anaphase 1 (K, O), telophase I (L, P), metaphase II (Q, U), telophase II (R, V) and
tetrad stage (S, W). Alexander stained tetrads/polyads are shown in (T, X).
Images shown for
Atwapl1.1wapl2 represent the most common phenotypes observed at each stage. Arrows in C & G denote
chromocenters. Arrow in P denotes a lagging chromosome. Size Bars = 5μm.
2.4.3 WAPL helps prevent abnormal centromere association during
prophase I
One of the earliest defects observed in the meiocytes of Atwapl1.1wapl2 plants is a reduced
number of heterochromatin regions, suggesting that AtWAPL is important early in prophase I,
possibly in controlling heterochromatin structure. In order to investigate this possibility,
fluorescence in situ hybridization (FISH) experiments was conducted using a 180 bp repetitive
centromere fragment as a probe on meiocytes of wild type and Atwapl1.1wapl2 plants. Eight to
ten centromere signals were observed in meiocytes during leptotene in both wild type (mean=
9.2±0.71, n=26) and Atwapl1.1wapl2 (mean= 9.0±1.2, n=29) plants (Figure 2.7 A, E). Four to
six signals were normally observed in wild type meiocytes (mean= 5.4±0.5, n=25) during
zygotene as homologous chromosomes pair (Figure 2.7B). Alterations were first observed at
zygotene when approximately 50% of the Atwapl1.1wapl2 meiocytes observed (n=30) were
found to contain clusters of condensed signals (Figure 2.7F). At pachytene wild type and
Atwapl1.1wapl2 meiocytes contained on average 4.8±0.35 (n=8) and 3.53±1.4 (n= 39)
centromere signals, while in mutant mean: 3.04±1.3 n= 84 (p-value) < 0.0001 relative to wild
type, with 50% of Atwapl1.1wapl2 meiocytes showing one or two clusters of signals (Figure 2.7
C, G). Five pairs of centromere signals corresponding to the five bivalents are visible at
diakinesis and early metaphase I in wild type meiocytes, followed by ten signals during anaphase
I/telophase I and 20 during meiosis II (Figure 2.7D, I-L, n= 48). In contrast, centromere signals
were clustered together at diplotene and diakinesis (Figure 2.7H) in 60% of Atwapl1.1wapl2
meiocytes examined. Individual centromere signals could however be observed within the
condensed chromatin at metaphase I (n=15) (Figure 2.7M). While some normal anaphase I cells
were observed, more than ten centromere signals were observed beginning at anaphase I in 65%
of the Atwapl1.1wapl2 meiocytes observed (n=27), suggesting that either centromere cohesion is
lost prematurely or never properly formed in these cells. Approximately 35% of the cells proceed
52
normally through the remainder of meiosis. However, in most cells centromere signals of
varying intensities associated with mis-segregated chromosomes and chromosome fragments
were observed at telophase I (Figure 2.7N) and scattered around the cells during meiosis II
(Figure 2.7O, P, n= 24).
Figure 2.7 Atwapl1.1wapl2 meiocytes exhibit nonspecific association of centromeres. FISH was
conducted using a 180 bp centromere repeat probe on male meiocytes from wild type (A-D, I-L) and
Atwapl1.1wapl2 (E-H, M-P) plants. DAPI-stained chromosomes are shown in red, centromere FISH
signals in green. Ten signals are observed at interphase I cells of both lines (A, E). Five signals are
typically observed during zygotene (B), pachytene (C), and diplotene (D) in wild type meiocytes.
53
Centromere signals are typically observed in Atwapl1.1wapl2 meiocytes during prophase I (F, G, H). In
wild type five pairs of chromosomes are observed at metaphase I (I) that separate into two groups of five
signals at anaphase I (J); two groups of five pairs of signals are observed at metaphase II (K) followed
four groups of five signals at telophase II (L). Ten to twenty signals, which show aberrant segregation are
observed beginning at anaphase I and extending through meiosis II in Atwapl1.1wapl2 meiocytes (M-P).
Images shown for Atwapl1.1wapl2 represent the most common phenotypes observed at each stage. Size
bar = 10 µm.
Results from our chromosome spreading suggested that defects in homologous
chromosome pairing and synapsis may exist in the mutant. To investigate this possibility further
we performed FISH using a telomere-derived fragment that also strongly labels a region
proximal to the centromere of chromosome 1 (45). Two strong chromosome 1 signals, with
weaker telomere signals were observed during leptotene in both wild type (n=17) and
Atwapl1.1wapl2 (n=24) meiocytes (Figure 2.8A and 2.8E). One strong signal was observed in
wild-type meiocytes starting at zygotene and extending through diplotene (mean=1.02±0.17,
n=36) (Figure 2.8B-D). Cells with either one or two chromosome 1 signals were observed during
these stages of meiosis in Atwapl1.1wapl2 plants. While most cells resembled wild type
meiocytes and contained one signal (mean = 1.19±0.40) during zygotene, pachytene and
diplotene (Figure 2.8F-H), approximately 20% of the nuclei observed (n= 139) contained two
widely spaced chromosome 1 signals throughout prophase (Figure 2.8I-L). Therefore, a small
but significant fraction of meiocytes do not undergo normal pairing and synapsis.
54
Figure 2.8 Atwapl1.1wapl2 meiocytes exhibit alterations in homologous chromosome pairing. FISH
was conducted on male meiocytes from wild type (A-D) and wapl1.1wapl2 (E-L) plants using a telomere
repeat probe that binds to a region proximal to the centromere of chromosome 1. (A, E, I) Two signals
are observed at early leptotene. (B, F, J) One signal reflecting synapsed chromosomes is observed at late
zygotene in wild type and some wapl1.1wapl2 meiocytes, while two signals are observed in others (I).
(C, G, K) One signal is observed at pachytene in wild type and some Atwapl1.1wapl2 meiocytes, while
two signals are observed in others (K). (D, H, L) Two closely spaced signals are typically observed at
diplotene in wild type and many Atwapl1.1wapl2 meiocytes with two widely separated signals in others
(L). Images shown for Atwapl1.1wapl2 represent the most common phenotypes observed at each stage.
Size Bars = 10 μm.
Meiotic prophase was investigated further by analyzing the distribution of ASY1 and
ZYP1. ASY1 is a meiosis-specific protein that is intimately associated with chromosome axes
during prophase I Armstrong 2002. In both wild type and Atwapl1.1wapl2 meiocytes ASY1
appears as diffuse foci during G2, forming thin threads that co-localize with the developing
univalent axes during leptotene. It is associated with the axes of the synapsed chromosomes
during pachytene and disappears from chromosomes at diplotene. No differences were observed
in ASY1 labeling between wild type and Atwapl1.1wapl2 meiocytes (Figure 2.9A, B and C, D).
55
Subtle alterations were however observed in ZIP1 distribution in approximately 25% of the
meiocytes. ZYP1, an axial element protein, appears at zygotene as foci. ZYP1 signals extend
during pachytene producing a continuous signal between the synapsed homologous
chromosomes (35). The majority (77%) n= 30 of Atwapl1.1wapl2 meiocytes resembled wild
type and exhibited continuous ZYP1 signals (Figure 2.10L). However, approximately 23% of the
meiocytes exhibited more diffuse ZYP1 labeling patterns and contained pachytene chromosomes
that exhibited discontinuous and/or unpaired ZIP1 signals (Figure 2.10F, I). Therefore, ASY and
ZIP1 appear to load normally on Atwapl1.1wapl2 meiotic chromosomes, some of which do not
undergo complete synapsis.
56
Figure 2.9 Localization of ASY1 in wild type and Atwapl1.1wapl2 mutant meiocytes. The distribution of
ASY1 was similar between wild type and Atwapl1.1wapl2 plants at zygotene (A, C) and pachytene (B,
D). Size Bar=10 um.
Figure 2.10 Localization of ZYP1 in wild type and Atwapl1.1wapl2 mutant meiocytes. ZYP1
immunolocalization on pachytene stage meiocytes from wild type (A-C) and Atwapl1.1wapl2 (D-L). Left
panel indicates the DAPI stained chromosome. Middle panel shows green signal for ZYP1 and the right
panel shows the merged DAPI and ZYP1 signals. Size Bar=10 um. Normal looking pachytene (D), shows
57
discontinuous ZYP1 signal, abnormal paired pachytene chromosome (G) shows abnormal ZYP1 signal
and normal pachytene (J) resembles wild type localization of ZYP1.
2.4.4 WAPL determines the timely release of meiotic cohesion
The observed alterations in chromosome condensation and the “sticky” nature of meiotic
chromosomes suggested that Atwapl1.1wapl2 plants may be defective in the release of cohesion
release during prophase. In order to investigate this possibility,we performed immunolocalization
experiments on Atwapl1.1wapl2 and wild type meiocytes with antibodies to either SYN1, the
Arabidopsis homolog of REC8 (33), or AtSMC3(34). Cohesin labeling appeared normal in
Atwapl1.1wapl2 plants during early stages of prophase I. At interphase SYN1 exhibited diffuse
nuclear labeling with the signal decorating the developing chromosomal axes beginning at early
leptotene and extending into zygotene. During late zygotene and pachytene the protein lined the
chromosomes (Figure 2.11 A, B, G, H). A large amount of SYN1 is released from meiotic
chromosomes in wild type during diplotene (Figure 8C, n= 9) and diakinesis (Figure 2.11 D, n=
7) as the chromosomes condense. By prometaphase I SYN1 is barely detectable on wild type
chromosomes (Figure 2.11 E, n=14). In contrast, strong SYN1 labeling was consistently
observed from diplotene into anaphase I in the mutant (Figure 8I-L). SYN1 was observed on
sticky metaphase I chromosomes (Figure 2.11K, n=5) and stretched bivalents during anaphase I
(Figure 2.11L, n=10). While 20% of metaphase II meiocytes (n=25) showed faint SYN1 signals,
the majority of meiocytes did not, suggesting the protein was removed during telophase I and
interphase II.
58
Figure 2.11 Cohesin release is delayed in Atwapl1.1wapl2 meiocytes. Meiotic spreads of wild type (AF) and atwapl1.1wapl2 (G-L) plants were prepared and stained with anti-SYN1 antibody (green) and
propidium iodide (red). Meiocytes in wild-type and Atwapl1.1wapl2 plants exhibited similar SYN1
staining at zygotene (A, G) and pachytene
(B,H). SYN1 is removed from the arms of wild type
meiocytes during diplotene (C) and diakinesis (D) and is not detectable during metaphase I and anaphase
I (E, F). Strong SYN1 signal is observed on the chromosomes of Atwapl1.1wapl2 meiocytes during
diplotene, diakinesis, metaphase and anaphase (I-L). Images shown for Atwapl1.1wapl2 represent the
most common phenotypes observed at each stage. Size bars = 5 μm.
2.4.5 WAPL is essential for proper spindle attachment and assembly during
meiosis
As part of our studies to better define meiotic stages in the mutant and further characterize
chromosome behavior, we performed immunolocalization studies using β-tubulin antibody on
wild type and Atwapl1.1wapl2 meiocytes. No significant differences in β-tubulin labeling were
observed between wild type and mutant plants during interphase and prophase I. Wild type
spindles exhibit a bipolar configuration during metaphase I and anaphase I (Figure 2.12A, B),
with radial spindles forming between the two groups of chromosomes at telophase I (Figure 2.12
C). Two bipolar spindles, which are perpendicular to each other, are then observed during
metaphase II and anaphase II (Figure 2.12D, E), with radial microtubules again forming between
the four separated nuclei during telophase II.
While normal bipolar spindles were formed during metaphase I and metaphase II in
approximately 35% of Atwapl1.1wapl2 meiocytes, the majority of cells showed abnormal
59
spindle configurations. For example, cells in which spindle microtubules passed over the
chromosomes were observed (Figure 2.12F, n=20). During anaphase I spindles were commonly
stretched and not well defined (Figure 2.12G, n= 31), with alterations also being observed in the
radial spindles during telophase I (Figure 2.12H, n=14) and interphase II. Two types of
alterations were commonly observed during meiosis II. Approximately 30% of metaphase II
cells contained parallel spindles (Figure 2.12I, J, n=12), while another 30% of the cells lacked
metaphase II spindles altogether and instead contained random microtubule networks (Figure
2.12K, L, n=13). A large number of additional alterations, including cells lacking metaphase I
spindles, stretched metaphase II spindles, and cells with four bipolar or parallel spindles were
observed at lower frequencies (Figure 2.13I).
60
Figure 2.12 WAPL is essential for proper meiotic spindle assembly and structure. Spindles of male
meiocytes from wild type and (A-E) and Atwapl1.1wapl2 (F-L) plants were stained with antiantibody (green) and DNA was counterstained with propidium iodide (red). Alterations were observed in
Atwapl1.1wapl2 male meiocytes throughout meiosis, including metaphase I (F), anaphase I (G), telophase
I (H), metaphase II (I, K), and telophase II (J, L). Images shown in F-H represent those most commonly
observed during meiosis I in Atwapl1.1wapl2 male meiocytes, while those in I, K and J, L represent the
two most common defects observed in metaphase II and telophase II, respectively. Arrows indiacte the
chromosomal DNA is not associated with spindles.Size bars = 10 μm.
61
Figure 2.13 Spindle abnormalities observed in Atwapl1.1wapl2 male meiocytes at metaphase I (A-D),
anaphase I (E-H), and meiosis II (I-L). Size Bar=5um.
2.4.6 WAPL is required for early embryonic patterning
The siliques of Atwapl1.1wapl2 plants contain approximately 23% aborted seed (n= 2022),
suggesting defects in embryo and/or endosperm development. In order to investigate this
possibility we examined cleared seeds in siliques of self-fertilized Atwapl1.1wapl2 plants and
found that approximately 25% of the seed contained abnormal embryos (n=31 siliques).
Alterations in embryo development were observed as early as the two cell stage when instead of
the typical vertical division of the apical cell, 9% the mutant embryos (n=61) performed a
horizontal division (Figure 2.14A, E). Alterations in the suspensor were also observed early in
development with approximately 5% of the seeds (n= 39) containing suspensors with either two
cells instead of a file of four cells other that exhibited abnormal shapes (Figure 2.15A). One
common alterations at later stages, involved embryos containing altered division planes resulting
62
in abnormal embryo shapes (Figure 2.14G, n=10). Another common defect involved either
abnormal or uncontrolled division in cells destined to become the suspensor hypophysis (Figure
2.14G, n=14). In early cotyledon stage siliques, both normal-appearing and abnormal embryos
that were either arrested or delayed were observed at several stages, including: dermatogen,
globular and early heart stages (Figure 2.14H, 2.15). Shrunken seeds with no trace of an embryo
were also observed. It is not clear if these alterations result from the wapl mutations directly
affecting cellular division in the embryo or if they arise from fertilization events involving
abnormal gametes that subsequently result in abnormal cellular division and ultimately embryo
arrest.
Figure 2.14 Embryonic patterning is defective in the seeds of Atwapl1.1wapl2 plants. Fertilized
ovules of wild type (A-D) and Atwapl1.1wapl2 (E-L) plants were cleared in Hoyers solution and viewed
using DIC microscopy. Abnormal division planes were observed early in development, including in two
(E) and four celled embryos (F). Asynchronous/abnormal cell division and growth was also observed (F,
G) with defects becoming more pronounced at the dermatogen (G) and globular stages (H). Images shown
63
for Atwapl1.1wapl2 represent the most common abnormal phenotypes observed at each stage. Size bars =
10 μm.
Figure 2.15 Additional embryo alterations observed in Atwapl1.1wapl2 siliques. Embryo arrested at 1cell stage with an abnormal suspensor (A). Abnormal four cell embryo (B). Normal appearing two cell
embryo that is arrested/delayed (C). Two cell embryo with the abnormal divisional planes and suspensor
(D). Normal appearing eight cell embryo that is arrested/delayed (E). Normal appearing dermatogen that
is arrested/delayed (F). Normal appearing globular stage that is arrested/delayed (G). Normal appearing
early heart stage embryo is arrested/delayed (H). Embryos shown in B, E, F, G and H were all observed in
sliques with cotyledon staged embryos. Size bar=10µm.
2.4.7 Mitotic cells show chromosome segregation defects, but normal cohesion
release
The fact that Atwapl1.1wapl2 plants grow and develop normally, albeit slightly slower than wild
type suggested that WAPL does not play a major role in nuclear division in somatic cells. In
order to determine if inactivation of WAPL has an effect on mitotic cells we examined root tips
of Atwapl1.1wapl2 plants. The majority of mitotic figures (n=120) observed in the root tips of
64
Atwapl1.1wapl2 plants appeared normal, with ten pairs of chromosomes condensing at the
metaphase plate and then segregating at anaphase/telophase (Figure 2.16A-C). Altered mitotic
figures were, however observed in approximately 20% of the cells, with most of the alterations
resembling those observed in meiotic cells. The most common alterations were the presence of
“sticky chromosomes” at metaphase (Figure 2.16A, D) that failed to segregate properly at
anaphase (Figure 2.16B, E) resulting in chromosome bridges, lagging chromosomes and possibly
chromosomes fragments at telophase (Figure 2.16C, F).
Figure 2.16
Atwapl1.1wapl2 plants show defects in mitosis. Root tips of wild type (A-C) and
Atwapl1.1wapl2 plants (D-I) were squashed and stained with DAPI. In wild type root tips the replicated
chromosomes condense and align on the metaphase plate (A) followed by the even segregation of ten
chromosomes to each pole during anaphase (B) and telophase (C). Most Atwapl1.1wapl2 root tip cells
appeared normal; however 20% of the cells contained metaphase chromosomes that appeared sticky (D).
Uneven segregation of chromosomes, chromosome bridges, stretched chromosomes and chromosome
fragments were subsequently observed at anaphase and telophase (E, F). Arrows denote a lagging
chromosome and chromosome bridge in E and F, respectively. Size Bars =10 μm.
65
Immunolocalization using antibody to SMC3 was performed on root tips of Atwapl1.1wapl2
plants to determine if cohesion is released normally during mitotic prophase. SMC3 displayed a
diffuse labeling pattern during interphase in both wild type and Atwapl1.1wapl2 plants (Figure
2.17A, E). The chromosome bound SMC3 signal gradually decreased during prophase and was
absent from the chromosomes by metaphase in both wild type and Atwapl1.1wapl2 plants
(Figure 2.17B, F). Although weak SMC3 signals were sometimes observed in the chromosome
spreads, chromosome bound SMC3 signal was never observed (n=20) during anaphase and
telophase (Figure 2.17C, D, G, H), even on “sticky” metaphase chromosomes or chromosome
bridges during anaphase and telophase (Figure 2.17F-H). Therefore, mitotic cohesin complexes
appear to be removed normally during mitosis. However, it is possible that small amounts of
cohesin remain on the chromosomes leading to the mitotic alterations we observe.
Figure 2.17 Cohesin is released normally in Atwapl1.1wapl2 root tip cells. Mitotic spreads of wild
type (A-D) and Atwapl1.1wapl2 (E-H) root tips were prepared and stained with anti-SMC3 antibody
(green) and propidium iodide (red). Wild type and Atwapl1.1wapl2 plants exhibit similar staining patterns
during interphase (A, E), metaphase (B, F), anaphase (C, G) and telophase (D, H). Size bars = 5 μm.
2.4.8 Inactivation of WAPL rescues Atctf7-induced lethality
Finally, we investigated the possible genetic interaction between AtWAPL and AtCTF7 by
crossing Atwapl1.1wapl2 plants with plants heterozygous for a T-DNA insertion in AtCTF7 (46).
In particular we were interested in determining if inactivation of WAPL can suppress the
66
dramatic affect of Atctf7 mutations. AtCTF7 is an essential gene with mutations causing female
gametophyte lethality (46). Plants homozygous for Atctf7 mutations can however be recovered at
very low frequencies (47); the plants are dwarf, completely sterile and display multiple
developmental alterations (Figure 2.18A). PCR genotyping was used to first identify plants triple
heterozygous for the three mutations and then Atwapl1.1wapl2ctf7+/- plants were identified in F2
populations of several different crosses. Atwapl1.1wapl2ctf7+/- plants resembled Atwapl1.1wapl2
plants, displaying relatively normal vegetative growth and reduced fertility (Figure 2.18C).
Atwapl1.1wapl2ctf7+/- anthers produce pollen 234±18.2 (n=16) and 41% (n=1642) of the pollen
produced was not viable (Figure 2.18B). Likewise, 43% of the ovules in siliques (n=21) of
Atwapl1.1wapl2ctf7+/- plants abort prior to fertilization and 52% of the seed produced (n=2036)
is shrunken and shriveled. Ultimately Atwapl1.1wapl2ctf7+/- plants produce 17.9±3.3 viable
seeds per silique (n=23).
Plants homozygous for mutations in all three genes (Atwapl1.1wapl2ctf7) were readily
obtained
from
selfed
Atwapl1.1wapl2Ctf7+/-
plants.
The
vegetative
growth
of
Atwapl1.1wapl2ctf7 plants is relatively normal, with the growth rate and overall size of the plants
resembling that of wild type (Figure 2.18A). Further, while Atctf7 plants are completely sterile,
Atwapl1.1wapl2ctf7 plants produce some viable pollen and seed (Figure 2.18B, C).
Atwapl1.1wapl2ctf7 plants produce 47±15.5 viable pollen/anther (n=16) and approximately
10.8±4.3
normal
seeds/silique
(n=23).
Fewer
ovules
appear
to
be
fertilized
Atwapl1.1wapl2ctf7 plants; however those that are fertilized develop into viable seed.
67
in
Figure 2.18 Inactivation of AtWAPL rescues atctf7 mutants. (A) Thirty day-old wild-type (left), Atctf7
homozygous (middle) and Atwapl1.1wapl2ctf7 triple homozygous (right) plants. (B) Alexander staining
of anthers showing pollen viability in AtCTF7+/-, Atctf7, Atwapl1.1wapl2, Atwapl1.1wapl2CTF7+/- and
Atwapl1.1wapl2ctf7 plants. Viable pollen stain red, while nonviable pollen stain green. Size Bar = 10µm
(C) Seed set in Atwapl1.1wapl2CTF7+/- and Atwapl1.1wapl2ctf7plants is lower than that observed in
Atwapl1.1wapl2 plants. Images shown represent the most common phenotypes observed.
68
2.5 Discussion
In this study we investigated the role(s) of WAPL in Arabidopsis. Unlike other organisms that
have been studied to date, Arabidopsis contains two active copies of WAPL. The Arabidopsis
genes are highly similar and display similar transcriptional patterns. Inactivation of each
individual gene has no apparent effect, suggesting that the genes share overlapping functions.
Plants double homozygous for the Atwapl1.2 and Atwapl2 mutations display normal vegetative
growth and development, and a modest reduction in fertility, which results primarily from early
ovule abortion. The presence of transcripts 3’ to the Atwapl1.2 T-DNA insert, which is located in
intron one, combined with the weak phenotype raises suggest that a partially functional version
of the protein may be produced in Atwapl1.2 plants.
Plants containing the Atwapl1.1wapl2 double mutant combination grew slightly slower
than wild type and exhibited a greater reduction in fertility which results from defects in both
male and female meiosis. Mitotic alterations were also observed some Atwapl1.1wapl2 root tip
cells, but these alterations did not have a noticeable impact on root growth or patterning.
AtWAPL1 transcripts are not present in Atwapl1.1wapl2 plants. Low levels of truncated
AtWAPL2 transcripts are produced in Atwapl2 plants raises the possibility that a truncated,
partially functional version of AtWAPL2 may be produced. While we can not rule out this
possibility, the fact that reduction of the truncated transcript to less than 5% of wild type levels
via RNAi has no effect on the phenotype of Atwapl1.1wapl2 plants suggests that the alleles result
in essentially complete inactivation of the genes. Therefore, WAPL is not an essential gene in
Arabidopsis.
WAPL was first identified in Drosophila where mutations typically cause embryo
lethality (48). However, a few “escapers” are able to develop into adults with wings that are
abnormally separated. Neuroblasts of Drosophila wapl mutants arrest at metaphase with most
chromosomes displaying prolonged cohesion (27). WAPL is also an essential gene in mice (49).
Wapl-/- mice were not obtained in experiments where Cre recombinase and ”floxed” Wapl alleles
were used to generate null alleles (49). Mouse embryonic fibroblasts in which a floxed Wapl
locus was deleted displayed altered transcriptional patterns and contained chromosomes with
hyper-condensed heterchromatin that failed to segregate properly at anaphase, ultimately leading
to cellular arrest (49). The reduction of WAPL in HeLa cells using SiRNA blocked the
dissociation of cohesin from chromosomes during mitotic prophase and delayed the resolution of
69
sister chromatids, resulting in the accumulation of prometaphase-like cells (11, 12). While most
Wapl depleted cells eventually entered anaphase and separated their chromosomes, the cells
ultimately arrested. In contrast, Wpl/Rad61 is a nonessential gene in yeast (50). The growth of
wpl/rad61 mutants is indistinguishable from wild type; however the mutants are sensitive to
DNA damaging agents and show alterations in cohesin dynamics.
Similar to the situation in yeast, inactivation of Arabidopsis WAPL does not have a
significant impact on growth. Inactivation of Arabidopsis WAPL results in alterations in
approximately 20% of root tip cells, which display altered mitotic figures including the presence
of “sticky chromosomes” at metaphase and chromosome bridges, lagging chromosomes and
possibly chromosome fragments at telophase (Figure 11 D-I). However, most cells undergo
normal division and cohesin complexes appear to be removed normally, including those that
displayed mitotic defects (Figure 12). However, we cannot rule out the possibility that low levels
of cohesin remain on the “sticky” mitotic chromosomes. Given that WAPL seems to play similar
roles in controlling the interaction of cohesin with the chromosomes in all organisms studied to
date, it is not clear why WAPL is an essential protein in flies, and vertebrates, but not yeast and
plants. Further studies are required to address this question.
2.5.1 AtWAPL is required for the prophase release of cohesin from meiotic chromosomes
Our results show that while AtWAPL is not critical for nuclear division in somatic cells,
it is required for the proper release of cohesin from meiotic chromosomes during prophase.
Essentially all Atwapl1.1wapl2 male meiocytes observed at metaphase I/early anaphase I
contained “sticky chromosomes” that displayed strong SYN1 labeling. SYN1 is undetectable on
the chromosomes of wild type meiocytes beginning at pro-metaphase I (33). The formation of
chromosome bridges at anaphase I and ultimately mis-segregated chromosomes at telophase I is
likely due to the prolonged presence of chromosome arm cohesin in Atwapl1.1wapl2 meiocytes.
While some Atwapl1.1wapl2 metaphase II chromosomes showed faint cohesin signals, the
majority did not, suggesting that the arm-associated cohesin complexes, which are normally
removed by WAPL during prophase, are removed during telophase I and interphase II in the
mutant, potentially through the action of separase. Although we did not specifically analyze
meiosis in megasporocytes, the fact that a relatively large number of female gametophytes arrest
at FG1 or FG2, suggests that inactivation of AtWAPL affects both male and female meiosis.
70
Little is known about the role of WAPL in meiosis. Drosophilia wapl mutants exhibit meiotic
alterations, specifically in the segregation of nonexchange X chromosomes; however the basis of
these alterations is not known (27). In budding yeast inactivation of Wpl does not appear to affect
spore formation and viability (51).
The chromosomal alterations we observe during meiosis in Atwapl1.1wapl2 plants
resemble those caused by depletion of WAPL during mitosis in human cell cultures and flies.
Depletion of Wapl in human cell lines blocks the removal of cohesin during prophase resulting
in poorly resolved sister chromatids (11). Likewise, mitotic chromosomes in wapl flies also show
prolonged arms cohesion that delays/blocks the resolution of sister chromatids at anaphase (27).
While yeast wpl/rad61 cells display increased steady-state levels of cohesin, Wpl/Rad61 does
not play a critical role in the removal of cohesin complexes during mitotic prophase (15, 52).
Rather, most mitotic cohesin complexes are removed from yeast chromosomes at anaphase by
separase.
Interestingly, 65% of Atwapl1.1wapl2 meiocytes contained more than the expected ten
centromere signals at metaphase I/anaphase I. This suggests that while the removal of arm
cohesin is delayed, centromere cohesion either is not established properly or is prematurely
released. The aggregation of centromere sequences we observe during prophase indicate there
are alterations in heterchromatin structure, suggesting that meiotic chromosome centromere
cohesion may in fact not form properly in the mutant. This is similar to the situation in
Drosophila wapl neuroblasts in which the largely heterochromatic chromosomes 4 and Y display
a precocious loss of cohesion, while the other chromosomes maintain arm cohesion and arrest at
prometaphase (27). Finally, Wpl appears to be important for controlling chromosome
condensation in budding yeast where inactivation of Wpl results in increased compaction of
chromosome arms in S/G2 (51). Our results show that inactivation of AtWAPL results in the
aggregation of heterochromatin regions, in particular centromeres. Therefore, WAPL appears to
play a common role in controlling chromosome structure in most organisms.
Our results indicate that AtWAPL most-likely functions during meiosis in a manor
similar to that proposed for Wapl in mitotic cells. Prior to DNA replication cohesin has been
shown to bind the chromatin in a reversible manner that is normally not able to establish sister
chromatid cohesion (10-15). This reversible binding is controlled in part through interactions
71
between Wapl, Pds5 and the cohesin complex. Specifically, interactions between Wapl, Pds5 and
the cohesin complex are thought to either open or maintain an open confirmation of the cohesin
ring at the junction between the SMC3 ATPase domain and the SCC1 N-terminal WHD (53, 54).
Stable cohesin binding to the chromosomes and the establishment of cohesion, which occurs
during DNA replication, involves the inactivation of this Wapl-dependent anti-establishment
activity through the Eco1/Ctf7-dependent acetylation of critical lysine residues in SMC3 (13, 5559). In animal cells, acetylation of SMC3 facilitates recruitment of sororin and displacement of
Wapl, to help create a stable cohesin complex (17, 60). A sororin ortholog has not been detected
in yeast where acetylation appears to directly inactivate the Wpl releasing activity and result in
tight binding of cohesin to the chromosomes (17, 61).
Most closely related to our work here are studies in vertebrate cells that have shown that
Wapl is involved in the non-proteolytic removal of cohesin from the arms of mitotic
chromosomes as part of the prophase pathway (11, 12). This process, which involves the mitotic
kinases Polo-like kinase (Plk1) and Auora B (62-64), also involves opening of the cohesin ring at
the junction between SMC3 and the SCC1 WHD (53, 54). Plk1 and Auora B have been shown to
phosphorylate multiple sites on Sororin, which leads to the disassociation of Sororin from
acetylated cohesion complexes (17). SA2/SCC3 is also phosphorylated by Plk1 (20), which
likely alters the interaction of Wapl with cohesin.
Finally, structural studies on Wapl from fungi and human have generated partial
structures of Wapl, which have provided further insights into how Wapl exerts its’ antimaintenance activity and the residues important for interactions between Wapl, Pds5 and cohesin
(28, 29, 65). A number of features are shared between the fungal and human Wapl proteins;
however, several structural and mechanistic differences were also identified. These structural
differences are likely related to the fact that Sororin plays an important role in the Wapldependent opening of the cohesin ring in vertebrates, but not in yeast.
The removal of cohesin from meiotic chromosomes in Arabidopsis involves a prophase
step (66), which we show here is dependent on WAPL. This suggests that the process may also
involve the phosphorylation of SCC3. Further studies are required to test this hypothesis and
determine if an Aurora or Polo-like kinase is involved in this process. Likewise, a sororin
ortholog does not appear to be present in the Arabidopsis genome, suggesting that acetylation of
SMC3 may directly interfere with WAPL binding in plants. However, further experiments are
72
necessary to determine if Arabidopsis SMC3 is actually acetylated by CTF7. Furthermore, while
five potential PDS5 orthologs are present in the Arabidopsis genome, a role for the proteins in
controlling sister chromatid cohesion has not yet been established. Therefore, additional studies
are needed to further characterize the roles of WAPL, PDS5 and CTF7 in plants and further
define how specifically they control the association of cohesin with the chromatin. It will be
important to better understand the apparent differences in how cohesin interacts with
chromosomes in meiotic and somatic cells and determine why specifically meiotic and mitotic
plant cells respond so differently to Atwapl mutations.
2.5.2 Inactivation of WAPL suppresses lethality and restores partial fertility to Atctf7
plants
We show here that similar to the situation in other organisms (13-15, 58, 59), inactivation
of WAPL suppresses the lethality associated with ctf7 mutations in Arabidopsis. Inactivation of
AtCTF7 results in embryo lethality(46); however for reasons that are not understood,
homozygous ctf7 mutant plants can be obtained at very low frequencies (47). Ctf7 plants are
dwarf, exhibit severe developmental abnormalities and are completely sterile. They also display
severe mitotic defects, alterations in double strand break repair and the premature dissociation of
cohesin from meiotic chromosomes, which leads to the early separation of sister chromatids (47).
Plants triple homozygous for the Atwapl1.1wapl2ctf7-1 mutations display normal vegetative
growth and produce small numbers of viable seed. The growth rate and overall size of
Atwapl1.1wapl2ctf7-1 plants is indistinguishable from that of wild type, indicating that
inactivation of WAPL suppresses most, if not all of the effects associated with CTF7 inactivation
in somatic cells. Furthermore, inactivation of WAPL restores some fertility to Atctf7-1 plants.
The overall fertility of Atwapl1.1wapl2ctf7-1 plants is significantly lower than that of
Atwapl1.1wapl2 plants, but similar to that observed for Atwapl1.1waplCtf7+/- plants. Therefore,
meiotic chromosomes are much more sensitive to the level and distribution of cohesin than
somatic cells in plants.
Our results indicate that AtWAPL most-likely functions during meiosis in a manor
similar to that proposed for Wapl in mitotic cells. Prior to DNA replication cohesin has been
shown to bind the chromatin in a reversible manner that is normally not able to establish sister
chromatid cohesion (10-15). This reversible binding is controlled in part through interactions
73
between Wapl, Pds5 and the cohesin complex. Specifically, interactions between Wapl, Pds5 and
the cohesin complex are thought to either open or maintain an open confirmation of the cohesin
ring at the junction between the SMC3 ATPase domain and the SCC1 N-terminal WHD (53, 54).
Stable cohesin binding to the chromosomes and the establishment of cohesion, which occurs
during DNA replication, involves the inactivation of this Wapl-dependent anti-establishment
activity through the Eco1/Ctf7-dependent acetylation of critical lysine residues in SMC3 (13, 5559). In animal cells, acetylation of SMC3 facilitates recruitment of sororin and displacement of
Wapl, to help create a stable cohesin complex (17, 60). A sororin ortholog has not been detected
in yeast where acetylation appears to directly inactivate the Wpl releasing activity and result in
tight binding of cohesin to the chromosomes (17, 61).
Most closely related to our work here are studies in vertebrate cells that have shown that
Wapl is involved in the non-proteolytic removal of cohesin from the arms of mitotic
chromosomes as part of the prophase pathway (11, 12). This process, which involves the mitotic
kinases Polo-like kinase (Plk1) and Auora B (62-64), also involves opening of the cohesin ring at
the junction between SMC3 and the SCC1 WHD (53, 54). Plk1 and Auora B have been shown to
phosphorylate multiple sites on Sororin, which leads to the disassociation of Sororin from
acetylated cohesion complexes (17). SA2/SCC3 is also phosphorylated by Plk1 (20), which
likely alters the interaction of Wapl with cohesin.
Finally, structural studies on Wapl from fungi and human have generated partial
structures of Wapl, which have provided further insights into how Wapl exerts its’ antimaintenance activity and the residues important for interactions between Wapl, Pds5 and cohesin
(28, 29, 65). A number of features are shared between the fungal and human Wapl proteins;
however, several structural and mechanistic differences were also identified. These structural
differences are likely related to the fact that Sororin plays an important role in the Wapldependent opening of the cohesin ring in vertebrates, but not in yeast.
The removal of cohesin from meiotic chromosomes in Arabidopsis involves a prophase
step (66), which we show here is dependent on WAPL. This suggests that the process may also
involve the phosphorylation of SCC3. Further studies are required to test this hypothesis and
determine if an Aurora or Polo-like kinase is involved in this process. Likewise, a sororin
ortholog does not appear to be present in the Arabidopsis genome, suggesting that acetylation of
SMC3 may directly interfere with WAPL binding in plants. However, further experiments are
74
necessary to determine if Arabidopsis SMC3 is actually acetylated by CTF7. Furthermore, while
five potential PDS5 orthologs are present in the Arabidopsis genome, a role for the proteins in
controlling sister chromatid cohesion has not yet been established. Therefore, additional studies
are needed to further characterize the roles of WAPL, PDS5 and CTF7 in plants and further
define how specifically they control the association of cohesin with the chromatin. It will be
important to better understand the apparent differences in how cohesin interacts with
chromosomes in meiotic and somatic cells and determine why specifically meiotic and mitotic
plant cells respond so differently to Atwapl mutations.
2.6 References
(1)
Uhlmann, F. (2004) The mechanism of sister chromatid cohesion. Exp Cell Res 296, 8085.
(2)
Nasmyth, K., and Haering, C. H. (2005) The Structure and function of Smc and kleisin
complexes. Annu Rev Biochem74, 595-648.
(3)
Nasmyth, K., and Haering, C. H. (2009) Cohesin: Its Roles and Mechanisms. Annu Rev
Genet 43, 525-558.
(4)
Dorsett, D., and Merkenschlager, M. (2013) Cohesin at active genes: a unifying theme for
cohesin and gene expression from model organisms to humans. Curr Opin Cell Biol25,
11-7
(5)
Yuan, L., Yang, X., and Makaroff, C. A. (2011) Plant cohesins, common themes and
unique roles. Curr Prot Pept Sci 12, 93-104.
(6)
Seitan, V. C., and Merkenschlager, M. (2012) Cohesin and chromatin organisation. Curr
Opin Genet Dev 22, 93-100.
(7)
Ciosk, R., Shirayama, M., Shevchenko, A., Tanaka, T., Toth, A., and Nasmyth, K. (2000)
Cohesin's binding to chromosomes depends on a separate complex consisting of Scc2 and
Scc4 proteins. Mol Cell 5, 243-254.
(8)
Takahashi, T. S., Yiu, P. Y., Chou, M. F., Gygi, S., and Walter, J. C. (2004) Recruitment
of Xenopus SCC2 and cohesin to chromatin requires the pre-replication complex. Nat
Cell Biol 6, 991-1001.
75
(9)
Watrin, E., Schleiffer, A., Tanaka, K., Eisenhaber, F., Nasmyth, K., and Peters, J. M.
(2006) Human Scc4 is required for cohesin binding to chromatin, sister-chromatid
cohesion, and mitotic progression. Curr Biol 16, 863-874.
(10)
Tanaka, K., Hao, Z. L., Kai, M., and Okayama, H. (2001) Establishment and maintenance
of sister chromatid cohesion in fission yeast by a unique mechanism. Embo J 20, 57795790.
(11)
Gandhi, R., Gillespie, P. J., and Hirano, T. (2006) Human Wapl Is a Cohesin-Binding
Protein that Promotes Sister-Chromatid Resolution in Mitotic Prophase. Curr Biol : CB
16, 2406-2417.
(12)
Kueng, S., Hegemann, B., Peters, B. H., Lipp, J. J., Schleiffer, A., Mechtler, K., and
Peters, J. M. (2006) Wapl controls the dynamic association of cohesin with chromatin.
Cell 127, 955-967.
(13)
Ben-Shahar, T. R., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M., and Uhlmann,
F. (2008) Eco1-Dependent Cohesin Acetylation During Establishment of Sister
Chromatid Cohesion. Science 321, 563-566.
(14)
Rowland, B. D., Roig, M. B., Nishino, T., Kurze, A., Uluocak, P., Mishra, A., Beckouet,
F., Underwood, P., Metson, J., Imre, R., Mechtler, K., Katis, V. L., and Nasmyth, K.
(2009) Building Sister Chromatid Cohesion: Smc3 Acetylation Counteracts an
Antiestablishment Activity. Mol Cell 33, 763-774.
(15)
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009) Budding Yeast
Wpl1(Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing
Reaction. Curr Biol19, 492-497.
(16)
Panizza, S., Tanaka, T., Hochwagen, A., Eisenhaber, F., and Nasmyth, K. (2000) Pds5
cooperates with cohesin in maintaining sister chromatid cohesion. Curr Biol 10, 15571564.
(17)
Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando,
M., Shirahige, K., Hyman, A. A., Mechtler, K., and Peters, J. M. (2011) Sororin Mediates
Sister Chromatid Cohesion by Antagonizing Wapl. Cell 143, 737-749.
(18)
Beckouet, F., Hu, B., Roig, M. B., Sutani, T., Komata, M., Uluocak, P., Katis, V. L.,
Shirahige, K., and Nasmyth, K. An Smc3 Acetylation Cycle Is Essential for
Establishment of Sister Chromatid Cohesion. Mol Cell 39, 689-699.
76
(19)
Waizenegger, I. C., Hauf, S., Meinke, A., and Peters, J.-M. (2000) Two Distinct
Pathways Remove Mammalian Cohesin from Chromosome Arms in Prophase and from
Centromeres in Anaphase. Cell 103, 399-410.
(20)
Hauf, S., Roitinger, E., Koch, B., Dittrich, C. M., Mechtler, K., and Peters, J.-M. (2005)
Dissociation of Cohesin from Chromosome Arms and Loss of Arm Cohesion during
Early Mitosis Depends on Phosphorylation of SA2. PLoS Biol 3, e69.
(21)
Zhang, N. G., Panigrahi, A. K., Mao, Q. L., and Pati, D. (2011) Interaction of Sororin
Protein with Polo-like Kinase 1 Mediates Resolution of Chromosomal Arm Cohesion. J
Biol Chem 286, 41826-41837.
(22)
Kitajima, T. S., Sakuno, T., Ishiguro, K., Iemura, S., Natsume, T., Kawashima, S. A., and
Watanabe, Y. (2006) Shugoshin collaborates with protein phosphatase 2A to protect
cohesin. Nature 441, 46-52.
(23)
Tang, Z. Y., Shu, H. J., Qi, W., Mahmood, N. A., Mumby, M. C., and Yu, H. T. (2006)
PP2A is required for centromeric localization of sgol and proper chromosome
segregation. Dev Cell 10, 575-585.
(24)
Uhlmann, F., Lottspeich, F., and Nasmyth, K. (1999) Sister-chromatid separation at
anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400, 37-42.
(25)
Siomos, M. F., Badrinath, A., Pasierbek, P., Livingstone, D., White, J., Glotzer, M., and
Nasmyth, K. (2001) Separase is required for chromosome segregation during meiosis I in
Caenorhabditis elegans. Curr Biol 23, 1825-1835.
(26)
Buonomo, S. B. C., Clyne, R. K., Fuchs, J., Loidl, J., Uhlmann, F., and Nasmyth, K.
(2000) Disjunction of homologous chromosomes in meiosis I depends on proteolytic
cleavage of the meiotic cohesin Rec8 by separin. Cell 103, 387-398.
(27)
Vernì, F., Gandhi, R., Goldberg, M. L., and Gatti, M. (2000) Genetic and Molecular
Analysis of wings apart-like (wapl), a Gene Controlling Heterochromatin Organization in
Drosophila melanogaster. Genetics 154, 1693-1710.
(28)
Ouyang, Z., Zheng, G., Song, J., Borek, D. M., Otwinowski, Z., Brautigam, C. A.,
Tomchick, D. R., Rankin, S., and Yu, H. Structure of the human cohesin inhibitor Wapl.
Proc Natl Acad Sci 110, 11355-11360.
(29)
Chatterjee, A., Zakian, S., Hu, X. W., and Singleton, M. R. (2013) Structural insights into
the regulation of cohesion establishment by Wpl1. Embo J 32, 677-687.
77
(30)
Cunningham, M. D., Gause, M., Cheng, Y. Z., Noyes, A., Dorsett, D., Kennison, J. A.,
and Kassis, J. A. (2012) Wapl antagonizes cohesin binding and promotes Polycombgroup silencing in Drosophila. Development 139, 4172-4179.
(31)
Ross, K. J., Fransz, P., and Jones, G. H. (1996) A light microscopic atlas of meiosis in
Arabidopsis thaliana. Chromosome Res 4, 507-516.
(32)
Yang, X., Yuan, L., and Makaroff, C. Immunolocalization Protocols for Visualizing
Meiotic Proteins in Arabidopsis thaliana: Method 3, in Plant Meiosis pp 109-118,
Humana Press.
(33)
Cai, X., Dong, F. G., Edelmann, R. E., and Makaroff, C. A. (2003) The Arabidopsis
SYN1 cohesin protein is required for sister chromatid arm cohesion and homologous
chromosome pairing. J Cell Sci 116, 2999-3007.
(34)
Lam, W. S., Yang, X. H., and Makaroff, C. A. (2005) Characterization of Arabidopsis
thaliana SMC1 and SMC3: evidence that ASMC3 may function beyond chromosome
cohesion. J Cell Sci 118, 3037-3048.
(35)
Higgins, J. D., Sanchez-Moran, E., Armstrong, S. J., Jones, G. H., and Franklin, F. C. H.
(2005) The Arabidopsis synaptonemal complex protein ZYP1 is required for
chromosome synapsis and normal fidelity of crossing over. Genes Dev 19, 2488-2500.
(36)
Armstrong, S., Caryl, A., Jones, G., and Franklin, F. (2002) Asy1, a protein required for
meiotic chromosome synpasis, localizes to axis-associated chromatin in Arabidopsis and
Brassica. J Cell Sci 115, 3645-3655.
(37)
Fransz, P., Alonso-Blanco, C., Liharska, T. B., Peeters, A. J. M., Zabel, P., and Hans de
Jung, J. (1996) High resolution physcial mapping in Arabidopsis thaliana and tomato by
fluorescence in situ hybridization to extended DNA fibers. Plant J 9, 421-430.
(38)
Caryl, A. P., Armstrong, S. J., Jones, G. H., and Franklin, F. C. H. (2000) A homologue
of the yeast HOP1 gene is inactivated in the Arabidopsis meiotic mutant asy1.
Chromosoma 109, 62-71.
(39)
Martinez-Zapater, J., Estelle, M., and Somerville, C. (1986) A highly repeated DNA
sequence in Arabidopsis thaliana. Mol Gen Genet MGG 204, 417-423.
(40)
Vielle-Calzada, J. P., Baskar, R., and Grossniklaus, U. (2000) Delayed activation of the
paternal genome during seed development. . Nature 404, 91-94.
78
(41)
Herr, J. M., Jr. (1971) A New Clearing-Squash Technique for the Study of Ovule
Development in Angiosperms. American Journal of Botany 58, 785-790.
(42)
Siddiqi, I., Ganesh, G., Grossniklaus, U., and Subbiah, V. (2000) The dyad gene is
required for progression through female meiosis in Arabidopsis. Development 127, 197207.
(43)
Alexander, M. P. (1969) Differential staining of aborted and nonaborted pollen. Stain
Technol. 44, 117-22.
(44)
Shintomi, K., and Hirano, T. (2009) Releasing cohesin from chromosome arms in early
mitosis: opposing actions of Wapl-Pds5 and Sgo1. Genes & Development 23, 2224-2236.
(45)
Armstrong, S., Franklin, F., and Jones, G. (2001) Nucleolus-associated telomere
clustering and pairing preceed meiotic chromosome synapsis in Arabidopsis thaliana. J
Cell Sci 114, 4207-04217.
(46)
Jiang, L., Yuan, L., Xia, M., and Makaroff, C. A. (2010) Proper Levels of the
Arabidopsis Cohesion Establishment Factor CTF7 Are Essential for Embryo and
Megagametophyte, But Not Endosperm, Development. Plant Physiol 154, 820-832.
(47)
Bolaños-Villegas, P., Yang, X., Wang, H.-J., Juan, C.-T., Chuang, M.-H., Makaroff, C.
A., and Jauh, G.-Y. Arabidopsis CHROMOSOME TRANSMISSION FIDELITY 7
(AtCTF7/ECO1) is required for DNA repair, mitosis and meiosis. The Plant J, n/a-n/a.
(48)
Gvozdev, V. A., Gostimsky, S. A., Gerasimova, T. I., Dubrovskaya, E. S., and
Braslavskaya, O. Y. (1975) Fine genetic structure of the 2D3-2F5 region of the Xchromosome of Drosophila melanogaster. Mol Gen Genet 141, 269-275.
(49)
Tedeschi, A., Wutz, G., Huet, S., Jaritz, M., Wuensche, A., Schirghuber, E., Davidson, I.
F., Tang, W., Cisneros, D. A., Bhaskara, V., Nishiyama, T., Vaziri, A., Wutz, A.,
Ellenberg, J., and Peters, J.-M. Wapl is an essential regulator of chromatin structure and
chromosome segregation. Nature 501, 564-568.
(50)
Bennett, C. B., Lewis, L. K., Karthikeyan, G., Lobachev, K. S., Jin, Y. H., Sterling, J. F.,
Snipe, J. R., and Resnick, M. A. (2001) Genes required for ionizing radiation resistance
in yeast. Nat Genet 29, 426-434.
(51)
Lopez-Serra, L., Lengronne, A., Borges, V., Kelly, G., and Uhlmann, F. (2013) Budding
Yeast Wapl Controls Sister Chromatid Cohesion Maintenance and Chromosome
Condensation. Curr Biol 23, 64-69.
79
(52)
Bernard, P., Schmidt, C. K., Vaur, S., Dheur, S., Drogat, J., Genier, S., Ekwall, K.,
Uhlmann, F., and Javerzat, J. P. (2008) Cell-cycle regulation of cohesin stability along
fission yeast chromosomes. Embo J 27, 111-121.
(53)
Arumugam, P., Nishino, T., Haering, C. H., Gruber, S., and Nasmyth, K. (2006)
Cohesin's ATPase activity is stimulated by the C-terminal winged-helix domain of its
kleisin subunit. Curr Biol 16, 1998-2008.
(54)
Nasmyth, K. (2011) Cohesin: a catenase with separate entry and exit gates? Nat Cell Biol
13, 1170-1177.
(55)
Ivanov, D., Schleiffer, A., Eisenhaber, F., Mechtler, K., Haering, C. H., and Nasmyth, K.
(2002) Eco1 Is a Novel Acetyltransferase that Can Acetylate Proteins Involved in
Cohesion. Curr Biol 12, 323-328.
(56)
Bellows, A. M., Kenna, M. A., Cassimeris, L., and Skibbens, R. V. (2003) Human
EFO1p exhibits acetyltransferase activity and is a unique combination of linker histone
and Ctf7p/Eco1p chromatid cohesion establishment domains. Nucleic Acids Res 31,
6334-6343.
(57)
Lengronne, A., McIntyre, J., Katou, Y., Kanoh, Y., Hopfner, K. P., Shirahige, K., and
Uhlmann, F. (2006) Establishment of sister chromatid cohesion at the S. cerevisiae
replication fork. Mol Cell 23, 787-799.
(58)
Unal, E., Heidinger-Pauli, J. M., Kim, W., Guacci, V., Onn, I., Gygi, S. P., and Koshland,
D. E. (2008) A molecular determinant for the establishment of sister chromatid cohesion.
Science 321, 566-569.
(59)
Zhang, J. L., Shi, X. M., Li, Y. H., Kim, B. J., Jia, J. L., Huang, Z. W., Yang, T., Fu, X.
Y., Jung, S. Y., Wang, Y., Zhang, P. M., Kim, S. T., Pan, X. W., and Qin, J. (2008)
Acetylation of Smc3 by Eco1 is required for S phase sister chromatid cohesion in both
human and yeast. Mol Cell 31, 143-151.
(60)
Lafont, A. L., Song, J. H., and Rankin, S. (2011) Sororin cooperates with the
acetyltransferase Eco2 to ensure DNA replication-dependent sister chromatid cohesion.
Proc Natl Acad USA 107, 20364-20369.
(61)
Schmitz, J., Watrin, E., Lenart, P., Mechtler, K., and Peters, J. M. (2007) Sororin is
required for stable binding of cohesin to chromatin and for sister chromatid cohesion in
interphase. Curr Biol 17, 630-636.
80
(62)
Gimenez-Abian, J. F., Sumara, I., Hirota, T., Hauf, S., Gerlich, D., de la Torre, C.,
Ellenberg, J., and Peters, J. M. (2004) Regulation of sister chromatid cohesion between
chromosome arms. Curr Biol 14, 1187-1193.
(63)
Sumara, I., Vorlaufer, E., Stukenberg, P., Kelm, O., Redemann, N., Nigg, E., and Peters,
J. (2002) The dissociation of cohesin from chromosomes in prophase is regulated by
polo-like kinase. Mol Cell 9, 515-525.
(64)
Lenart, P., Petronczki, M., Steegmaier, M., Di Fiore, B., Lipp, J. J., Hoffmann, M.,
Rettig, W. J., Kraut, N., and Peters, J.-M. (2007) The Small-Molecule Inhibitor BI 2536
Reveals Novel Insights into Mitotic Roles of Polo-like Kinase 1. Curr Biol : CB 17, 304315.
(65)
Chan, K.-L., Gligoris, T., Upcher, W., Kato, Y., Shirahige, K., Nasmyth, K., and
Beckout, F. Pds5 promotes and protects cohesin acetylation. Proc Natl Acad Sci.
(66)
Liu, Z., and Makaroff, C. A. (2006) Arabidopsis separase AESP is essential for embryo
development and the release of cohesin during meiosis. Plant Cell 18, 1213-1225.
81
Chapter 3
82
Arabidopsis CTF7/ECO1 and WAPL1/2 interact during plant
development and control vegetative growth and chromosome
condensation during meiosis
Kuntal De, Xiaohui Yang, Sayantan Mitra, Garett Homan and Chris Makaroff
The paper will be submitted to The Plant Cell
Author contributions: Kuntal De and Chris Makaroff contributed to data analysis and writing of
the manuscript; Kuntal De contributed to data collection; Sayantan Mitra contributed to
Alexander staining of tetrads in Atwapl1.1wapl2ctf7 plants; Garett Homan contributed to female
gametophyte analysis; Xiaohui Yang provided ctf7 FISH and ctf7SYN1 immunolocalization
figure panels.
Keywords: meiosis, mitosis, DNA repair, heterochromatin condensation, sister chromatid
cohesion
wings apart like, chromosome transmission fidelity 7, cohesin complex
83
3.1 Abstract
The cohesin complex mediates sister chromatid cohesion, which is important for the proper
segregation of chromosomes in mitosis and meiosis. The establishment of stable sister chromatid
cohesion occurs during DNA replication and involves acetylation of the complex by the
acetyltransferase CTF7. Mutantations in CTF7 typically results in lethality. The majority of
cohesin complexes dissociate from chromosomes during prophase, in a WAPL dependent
process. Plants carrying mutations in both WAPL genes exhibit relatively normal vegetative
growth, but dramatically reduced fertility. In this study, we show that inactivation of both WAPL
genes rescued Atctf7 associated lethality and restored limited fertility. Inactivation of both
WAPL and CTF7 restores cohesin release during prophase in wapl1wapl2ctf7 plants, but some
wapl-associated meiotic abnormalities were still still observed in Atwapl1.1wapl2ctf7 meiocytes.
3.2 Introduction
In eukaryotic organisms proper chromosome segregation contributes to genomic stability, while
errors in this process may lead to aneuploidy and tumor progression (1). Proper chromosome
segregation requires that sister chromatids remain linked together during replication, a task
performed by the cohesin complex, which primarily consists of a heterodimer of Structural
Maintenance of Chromosome (SMC) proteins SMC1 and SMC3, Sister Chromatid Cohesion
(SCC) protein SCC3 and an alpha-kleisin protein, either SCC1 in somatic cells or REC8 in
meiotic cells. The SMC subunits along with an -kleisin protein are believed to form a ring
structure, which is stabilized by SCC3, that embraces the replicated chromosomes (2, 3). At the
metaphase to anaphase transition a cysteine protease called Separase cleaves the -kleisin
subunit of centromere bound cohesin complexes allowing the ring to open, and the replicated
chromosomes to separate. The ring model is widely accepted, although other mechanisms which
involve DNA-cohesin interactions might also take place (4, 5).
Cohesin is primarily recruited onto chromosomes during G1 phase with the help of the
SCC2/SCC4 complex (6). Prior to S phase cohesin binding to the chromosomes is dynamic and
is controlled by a complex containing the Wings apart-like (Wapl) and the Precocious
dissociation of sisters 5 (Pds5) proteins, which have been termed the "releasin" or "antiestablishment" complexes (7-13). Stabilization of cohesin on the chromosomes is facilitated by
84
acetylation of two adjacent lysine residues on SMC3 by the Ctf7/Eco1 acetyltransferase, which
appears to antagonize the action of Wapl (11, 13-15). In vertebrates cohesin-DNA interactions
are also controlled by Sororin (10, 16-18), which stabilizes cohesin binding on the DNA by
antagonizing Wapl (18). Cohesin removal from the chromosomes varies among different species,
but general features of the process appear to be conserved. During mitotic prophase the majority
of cohesins are removed from the chromosome arms, but centromeric cohesin remains in place.
SCC1 is cleaved by the protease separase at anaphase, allowing the removal of centromeric
cohesin (19-23). This process involves several steps, including the phosphorylation of Sororin by
Cdk1/cyclin B, and its replacement by Wapl to form a new, stable complex, the Pds5-Wapl
complex. Cohesin is then released from the chromosome arms by the action of the Pds5-Wapl
complex (24, 25). At the same time, Shugoshin1(Sgo1) recruits Phosphatase 2A (PP2A) to
centromeres to protect cohesin from phosphorylation and therefore protect it from release (2628). At anaphase, the spindle checkpoint is disrupted and the Anaphase Promoting
Complex/Cyclosome (APC/C) becomes active. The active APC/C targets Securin and Cyclin B
for ubiquitylation and subsequent degradation by the proteasome (19, 29, 30). Once Securin and
Cyclin B are degraded, separase becomes active. Sgo1is released from the centromeres and the
Scc1 protein becomes phosphorylated. Phosphorylated Scc1 at the centromeres is cleaved by
separase and cohesion is lost (29, 31). Studies in yeast, fly and human cells has revealed that
Wapl triggers the release of cohesin by destabilizing contacts between the Winged helix domain
of SCC1 and the ATPase domain of SMC3 (32, 33). Analysis of the yeast Wapl homologue
revealed that Wapl stimulated the rate ATP hydrolysis by cohesin and thus may facilate its
release from DNA(34). Nonetheless other mechanisms are also possible.
Point mutations in ESCO2, the human ortholog of ECO1, causes Roberts syndrome
(RBS) where cells show premature centromere separation (35, 36). Recent studies on CTF7 in
mouse Eco1 and Esco2 mutants suggest that mutations in the N-terminus cause defects in
cohesin establishment and mitosis in somatic cells (36, 37). In yeast establishment of cohesion is
mediated by Eco1/Ctf7 during the S-phase and Wapl is considered important for the removal of
cohesin. However it is still unclear how Eco1/Ctf7 and Wapl interact with each other. It has
however been shown that inactivation of WAPL can rescue eco1-induced lethality in budding
yeast (16).
85
Results from studies in yeast, fly and animals have identified interesting differences in
how organisms control the association and stable binding of cohesin with the chromosomes.
Recent studies in Arabidopsis have begun to shed further insights into this process. The
Arabidopsis genome contains a single CTF7/ECO1 gene, which is similar to other
CTF7/ECO1 proteins in that it contains a conserved N-terminal PIP box, a zinc finger domain
and a C-terminal acetyltransferase domain (38). Plants heterozygous for ctf7 mutants showed
reduced seed set with approximately 25% of the seed exhibiting embryo arrest before or at the
globular stage (38). It was originally believed that homozygous ctf7 mutants were not viable;
however remarkably approximately 4% of the Atctf7-/- progeny from heterozygous Ctf7+/- parents
survive, albeit with strong defects in vegetative development, male and female sterility and
severe defects in the establishment of cohesin (39). At this time it is not clear why/how a small
number of Atctf7-/- plants are able to develop and grow when in most instances CTF7 is an
essential gene.
The Arabidopsis genome contains two Wapl orthologs, AtWAPL1 and AtWAPL2. TDNA insertions in each individual gene have no effect on plant growth, development or fertility
(De; Makaroff PLOS Genetics in press). Vegetative growth of Atwapl1.1wapl2 plants is
relatively normal, although they do grow slightly slower than wild type. Atwapl1.1wapl2 plants
also exhibit a significant reduction in male and fermale fertility with meiocytes exhibiting
alterations in homologous chromosome pairing and spindle formation and delays in cohesin
removal, which result in "sticky chromosomes, chromosome bridges and the missegregation of
chromosomes. Alterations were also observed early in embryo development, including
asynchronous/abnormal cell division and growth. While chromosome alterations were observed
at low frequencies in root tips, most mitotic cells observed appeared normal. Finally a
preliminary genetic interaction between AtWAPL and AtCTF7 was shown by crossing
Atwapl1.1wapl2 plants with plants heterozygous for a T-DNA insertion in AtCTF7 (38).
Mutations in Atwapl was found to restore vegetative growth and partial fertility to ctf7 plants.
(De; Makaroff PLOS Genet in press).
In this study we further characterized the interaction between Arabidopsis CTF7 and
WAPL by conducting a detailed analysis of Atwapl1.1wapl2ctf7+/- and Atwapl1.1wapl2ctf7
plants. The growth of Atwapl1.1wapl2ctf7+/- plants resembles that of Atwapl1.1wapl2, while the
growth rate of Atwapl1.1wapl2ctf7 triple mutant plants is similar to wild type. Like Atctf7 plants,
86
Atwapl1.1wapl2ctf7 and Atwapl 1.1wapl2 plants show defects in mitotic DNA repair, with
Atwapl1.1wapl2ctf7 plants also displaying a high level of aneuploidy, similar to Atctf7. Fertility
in Atwapl1.1wapl2ctf7+/- and Atwapl1.1wapl2ctf7 plants is lower than that of Atwapl1.1wapl2,
but significantly higher than Atctf7. Finally, WAPL inactivation was found to suppress many
ctf7-associated cohesin defects early in meiotic prophase, while mutations in ctf7 partially
supressed wapl mutations later in prophase. Therefore, CTF7 and WAPL play antagonistic roles
during meiosis in Arabidopsis.
3.3 Materials and Methods
3.3.1 Plant material and growth conditions
Arabidopsis thaliana T-DNA lines were obtained from the Arabidopsis Biological Resource
Center (ABRC, Ohio). The Columbia ecotype, was used for crossing, transcript analysis and
microscopic studies. Plants were grown in Metro-Mix 200 soil (Scotts-Sierra Horticulture
Products; http://www.scotts.com) or on germination plates (Murashige and Skoog; Caisson
Laboratories; www.caissonlabs.peachhost.com) in a growth chamber at 22 oC with a 16-h-light/
8-h-dark cycle. The leaves were collected from rosette-stage plants grown on soil and used for
DNA isolation and genotyping. Approximately 24 days after germination, flower buds were
collected and staged for microscopy studies. For transcript analysis all samples were harvested,
frozen in liquid N2, and stored at -80oC until needed.
3.3.2 Chromosome analysis and immunolocalization
Male meiotic chromosome spreads were performed on floral buds fixed in Carnoy's fixative
(ethanol: chloroform:acetic acid: 6:3:1, v/v) and prepared as described previously (40).
Chromosomes were stained with DAPI, observed with an Olympus BX51 epifluorescence
microscope system. Images were captured using Spot camera system and processed using Adobe
Photoshop. Mitosis was studied in root tips. Arabidopsis seeds were sterilized and plated on MS
agar plates. Root tips were harvested from seven day old seedlings, fixed and digested with same
protocol used in meiotic spread.
Immunolocalization
of
cohesin
proteins
and
β-tubulin
was
performed
on
paraformaldehyde fixed cells as previously described (41). Meiotic stages were assigned based
87
on the chromosome structure and cell morphology as well as the developmental stage of the
surrounding anther cells. Primary antibodies, used at 1:500 dilutions have been described (42,
43). The slides were incubated overnight at 4 0C, and then washed for 2h with eight changes of
wash buffer. The slides were incubated overnight at 4 0C with Alexa 488-labeled goat anti- rabbit
secondary antibody (1:500), or with Alexa Fluor 594- labeled goat anti-mouse secondary
antibody (1:500), washed and then stained with DAPI.
Fluorescence In Situ Hibridization (FISH) was conducted on meiocytes from
inflorescences fixed in Carnoy's solution for 1 h at room temperature after replenishing the
fixative. FISH was performed on meiotic spreads as previously described (44, 45) with the
following modification: samples were treated with a solution of freshly prepared 70% formamide
in 2X SSC for 2min at 800C, and dehydrated through a graded ethanol series (70%, 90%, 100%)
for 5min at -200C. The slides were then dried at room temperature before adding the probe. The
180-bp pericentromeric repeat (46) was amplified, purified, labeled with Roche High Prime
fluorescein, and then used as a probe at a concentration of 5 ugml-1. Telomere-repeat sequences
were detected by hybridization with a 5'-end fluorescein isothiocyanate-labeled oligonucleotide
probe, (CCCTAAA)6 at 5ugml-1. Slides were counterstained with DAPI and observed as describe
above.
3.3.3 Expression analyses
Total RNA was extracted from stems, buds, roots, leaves and siliques of wild-type plants to
examine WAPL expression patterns, and from inflorescencses of wild-type, Atwapl1.1wapl2 and
Atwapl1.2wapl2ctf7-1 plants to measure WAPL transcript levels in mutant plants. Total RNA
was extracted with the Plant RNeasy Mini kit (Qiagen, Hilden, Germany), treated with Turbo
DNase I (Ambion), and used for cDNA synthesis with the First Strand cDNA Synthesis Kit
(Roche). Real time PCR was performed with SYBR-Green PCR Mastermix (Clontech)
Amplification was monitored on a CFX system (Biorad). Expression was normalized against the
β-tubulin-2 gene. At least three biological replicates were sampled, with two technical replicates
for each sample. Primers used in this study are presented in (Supplementary Table 1).
3.3.4 Analysis of female gametophyte development and embryo development
88
Whole-mount clearing was used to determine the phenotype of embryos (47, 48). Siliques from
wild-type and mutant plants were dissected and cleared in Hoyer's solution containing lactic
acid: chloral hydrate: phenol: clove oil: xylene ( 2:2:2:2:1, w/w). Samples were observed with an
Olympus BX51 microscope equipped with differential interference contrast optics. Female
gametophyte analysis was performed as described in (49).
3.4 Results:
3.4.1 Inactivation of WAPL rescues ctf7-induced vegetative developmental
defects and restores partical fertility to ctf7 plants
Atwapl1.1wapl2 plants display relatively normal growth and development, but grow slightly
slower than wild type plants (De; Makaroff PLOS Genetics in press). In contrast when Atctf7-/plants survive they are dwarf and show severe developmental abnormalities (Figure 3.1A) (39)
(De; Makaroff PLOS Genetics in press). Atwapl1.1wapl2ctf7+/- plants resemble Atwapl1.1wapl2,
growing slower than wild type (Figure 3.1B). Interestingly, normal growth rates are observed in
triple mutant plants with Atwapl1.1wapl2ctf7 plants closely resembling wild-type. Atctf7 plants
exhibit complete sterility, while wapl1.1wapl2ctf7+/- and wapl1.1wapl2ctf7 plants produce
approximately 10-20 seeds/ silique. Crossing experiments showed that male and female fertility
is affected in both Atwapl1.1wapl2ctf7+/- and wapl1.1wapl2ctf7 plants. In order to better
understand the combined effect(s) of WAPL and CTF7 inactivation on reproduction we analyzed
pollen development and female gametophyte development in Atwapl1.1wapl2ctf7+/- and
Atwapl1.1wapl2ctf7 plants. Atwapl1.1wapl2ctf7+/- plants produce on average 234±18.2
pollen/anther with 41% inviable pollen (n=1642). This compares to 229±21.3 pollen/anther
(n=15) in Atwapl1.1wapl2 plants with 28% of the pollen (n= 2752) that is produced appearing
nonviable. In contrast, wild type plants produce 458±23.8 pollen/anther (n=10), essentially all of
which is viable. Inactivation of both copies of CTF7 reduces male fertility even further with
Atwapl1.1wapl2ctf7 plants producing 47±15.5 viable pollen/anther (n=16). Alexander staining
of anthers from Atwapl1.1wapl2ctf7 plants shows defects in tetrad formation (Figure 3.2I, II).
89
Figure 3.1 Inactivation of WAPL rescues plant growth in ctf7 mutants. (A) Thirty day-old
ctf7 homozygous plant showing poor growth, (B) Left to right: Thirty day -old wild type, ctf7
homozygous, wapl1.1wapl2Ctf7+/- and wapl1.1wapl2ctf7 triple homozygous plants. Note the
triple homozygous mutant recapitulates wild type growth.
90
Figure 3.2 Alexander staining showing severe defects in tetrad formation. Monad (A), Dyad
(B), Triad (C), abnormal tetrad (D), polyad with five (E) and seven uneven (F) microspores II.
Graph showing distribution of different types of polyads in Atwapl1.1wapl2ctf7 plants. Scale
Bar: 5µm.
91
Female fertility is also reduced by introduction of the ctf7-1 mutation into Atwapl1.1wapl2
plants. Approximately 28% of Atwapl1.1wapl2 ovules (n=1689) abort prior to fertilization, with
23% of the seed (n= 2022) produced appearing shrunken and shriveled. Approximately 40% of
Atwapl1.1wapl2ctf7+/- ovules abort prior to fertilization, with approximately 50% of the fertilized
ovules producing shrunken and shriveled seed (n=2036).
Analysis of ovule development identified developmental defects very early in female
gametophyte development in Atwapl1.1wapl2ctf7 plants with ovules arresting at different
developmental stages. Approximately 40% of the ovules observed (n=392) progress and mature
normally to FG7 (3.3D); 34% of the ovules arrested at FG0, with no identifiable nuclei (Figure
3.3A), while 12% of the ovules arrested at FG1 with one nucleus (Figure 3.3B ). Smaller
numbers of ovules arrested at FG2 (4%) with two nuclei (Figure 3.3C), and at later stages of
development, including FG3- FG6 (8.6%). These results along with the results from our previous
studies on Atwapl1.1wapl2 and ctf7-1 plants suggested that meiotic defects are likely present in
the plants. Therefore, meiosis was investigated in male meiocytes of Atwapl1.1wapl2ctf7 plants
and specifically compared with the defects observed in Atwapl1-1wapl2 and ctf7-1 plants.
92
Figure 3.3 Atwapl1.1wapl2ctf7 female gametophytes show defects early in development.
Cleared ovules from a developmentally-staged silique of Atwapl1.1wapl2ctf7 plants at FG7. A.
Ovule arrested at FG0, with no identifiable nuclei. B. Ovules arresting at FG1 with one nucleus.
C. Ovule arrested at FG2 with two nuclei. D. Normal appearing ovule at FG7. Solid arrows
indicate nuclei while the dashed arrow denotes no trace of a nucleus. Bar = 10µm.
93
Figure 3.4 Arabidopsis wapl1.1wapl2ctf7 plants exhibit defects during male meiosis. DAPI
stained chromosomes from male meiocytes of wild type (A-D, Q-T), ctf7(E-H), Atwapl1.1wapl2
(I-L) and Atwapl1.1wapl2ctf7 (M-P, U-X) plants are shown at pachytene (A, E, I and M),
diakinesis (B, F, J and N), metaphase I (C, G, K and O), anaphase I (D, H, L and P), telophase I
(Q, U), metaphase II (R, V), anaphase II (S, W), telophase I/tetrad (T, X). Scale bars = 5μm.
94
Inactivation of WAPL1 or CTF7 individually has pronounced effects on meiosis in
Arabidopsis. Dramatic alterations are observed very early in meiocytes of ctf7-1 plants (39).
Alterations in chromosome condensation are observed during leptotene and zygotene followed
by a failure of homologous chromosomes to align and synapse properly during zygotene and
pachytene. A mixture of unpaired and unevenly paired chromosomes are observed at pachytene
(Figure 3.4E). A decondensed mass of chromatin is typically observed at diplotene followed by a
mixture of uncondensed chromatin, apparent chromosome fragments, unpaired chromosomes,
and possibly some bivalents at diakinesis (Figure 3.4F). A mass of DNA is typically observed at
the center of metaphase I cells (Figure 3.4G) followed by chromosome bridges, uneven
chromosome segregation and lagging chromosomes during anaphase I. Randomly distributed
chromosomes are observed during telophase I (Figure 3.4H). From metaphase II onward the
chromosomes are irregularly scattered around the cell.
Early stages of meiosis are relatively normal in Atwapl1.1wapl2 plants. Only subtle
alterations can be detected at zygotene/pachytene when approximately 60% of cells show
nonspecific association of heterchromatin regions followed by incomplete synapsis in a small
subset (15%) of cells (Figure 3.4I). The most dramatic alterations are observed beginning at
diakinesis when chromosomes condense into large intertwined masses of chromatin (Figure
3.4I). The chromosomes appear primarily as one intertwined mass as they further condense and
move to equator at metaphase I (Figure 3.4K). During anaphase I most cells contain stretched
chromosomes that do not separate properly with chromosome bridges and lagging chromosomes
observed by late anaphase I and telophase I (Figure 3.4L). The chromosomes are typically
randomly dispersed around the cell during anaphase II and telophase II.
Analysis of meiosis in Atwapl1.1wapl2ctf7-1 plants revealed that for the most part it is
similar to that observed in Atwapl1.1wapl2 plants. Early stages of meiosis are relatively normal
in Atwapl1.1wapl2ctf7-1 plants with no obvious alterations observed in chromosome
condensation and the pairing of homologous chromosomes during leptotene, zygotene and
pachytene (Figure 3.4M). Abnormalities were however observed starting at diplotene when
chromosomes failed to desynapse properly with bivalents appearing as unresolved masses of
DNA at diakinesis and metaphase I (Figure 3.4N, O). Homologous chromosomes failed to
segregate properly during anaphase I (Figure 3.4P) resulting in chromosome bridges, uneven
95
chromosome segregation and broken chromosomes telophase I (Figure 3.4U). Approximately
30% of interphase II and metaphase II cells contained 20 or more chromosomes, indicating that
centromere cohesion is prematurely lost similar to the situation in Atwapl1.1wapl2 plants.
Missegregation of chromosomes during meiosis II resulted in the formation of a mixture of
tetrads and polyads (Figure 3.4X). Therefore, WAPL inactivation can suppress many of the
dramatic defects associated with the ctf7-1 mutation.
96
Figure 3.5 Male meiotic chromosomes from wapl1.1wapl2ctf7 show partial recovery of
centromere organization. Fluoresencence In Situ Hybridization (FISH) with a centromere
probe was performed on male meiocytes from wild type (A-D, Q-T), ctf7 (E-H) and
wapl1.1wapl2 (I-L), (M-P, U-X) plants. DAPI-stained chromosomes are shown in red and the
centromere signal is shown in green. Ten signals were observed at leptotene in WT (A),
wapl1.1wapl2 (I) and wapl1.1wapl2ctf7 (M), while more than signals were typically observed in
ctf7 (E). Five signals were typically observed during zygotene (B), pachytene (C) in wild type
meiocytes with ten signals (five pairs) observed at diakinesis (D). In wapl1.1wapl2ctf7 meiocytes
at zygotene (N), morphology resembled that of wild type meiocytes. Clustering of centromere
signals was also observed during pachytene (O). In the wild type five pairs of chromosomes were
observed at metaphase I (Q), and during anaphase I two separate groups of five signals were
observed (R); two groups of five pairs of signals were observed at anaphase II (S) followed by
four groups of five signals at telophase II (T). Stretched centromere signals were common in
Atwapl1.1wapl2ctf7 "sticky" metaphase I (U) chromosomes, and ten to twenty centromere
signals were observed, moreover aberrant segregation was observed from metaphase I to meiosis
II in wapl1.1wapl2ctf7 meiocytes (U-X). Scale bar = 5 µm.
Inactivation of WAPL appears to suppress many of the effects of CTF7 inactivation. To
investigate this possibility further and explore the possibily that the ctf7-1 mutation may suppress
the subtle defects associated with Atwapl1.1wapl2 plants during prophase, including the
nonspecific association of heterchromatin, in situ hybridization was conducted using the 180bp
centromere (CEN) repeat as a probe (50). In wild type meiocytes ten unpaired and well-dispersed
CEN signals are observed during leptotene (Figure 3.5A). Four to five centromere signals are
observed during zygotene (Figure 3.5B), pachytene (Figure 3.5C) and diplotene followed by five
pairs of signals corresponding to the five bivalents at diakinesis (Figure 3.5D) and early
metaphase I (Figure 3.5Q). Ten centromere signals are observed during anaphase I/telophaseI
(Figure 3.5R) and 20 during meiosis II (Figure 3.5S, T).
Meiocytes of ctf7-1 plants typically contain 11-15 irregular CEN signals during leptotene
and zygotene (Figure 3.5E, F). As ctf7-1 meiocytes progress through meiosis I and II the number
of centromere signals increase with ten to twenty centromere signals typically observed from
97
pachytene to diakinesis and twenty or more signals observed from metaphase I through meiosis
II (Figure 3.5G, H).
Centromere signals resemble wild type throughout meiosis in approximately 50% of
Atwapl1.1wapl and Atwapl1.1waplctf7-1 meiocytes. The other half of the cells observed
resemble wild type during leptotene and early zygotene (Figure 3.5I, M), but were found to
contain clusters of condensed CEN signals from late zygotene to diakinesis (Figure 3.5J, K, N,
O). Typically one to three large clusters of signals were observed. Individual centromere signals
were observed within the condensed chromatin at late diakinesis and metaphase I (Figure 3.5L,
P). Most anaphase I cells were normal, however more than ten centromere signals were observed
beginning at anaphase I approximately in 30 % of the Atwapl1.1wapl2ctf7 meiocytes observed
(n=20), indicating that similar to the situation in Atwapl1.1wapl2, centromere cohesion is lost
prematurely or never properly formed in these cells. While a small number of cells proceed
normally through meiosis, in most cells centromere signals associated with mis-segregated
chromosomes and chromosome fragments are observed at telophase I (Figure 3.5V) and
chromosomes are observed scattered around the cells during meiosis II (Figure 3.5W, X, n= 5).
Therefore, centromere behavior in Atwapl1-1waplctf7-1 meiocytes for the most part resembles
that of Atwapl1-1wapl plants indicating that inactivation of CTF7 does not suppress the nonspecific association of centromeres caused by inactivation of WAPL.
The effect of eliminating both WAPL and CTF7 on meiotic prophase was further
investigated by examining the distribution of ASY1 and ZYP1 on prophase chromosomes.
ASY1 is a meiosis-specific protein, which associates with chromosome axes during prophase I
(51). ASY1 signals first appear as diffuse foci on the univalent axes during leptotene. It then
lines the axes of synapsed chromosomes during pachytene and from diplotene onward ASY1
signals are typically not observed (51). Similar to the situation for Atwapl1-1wapl2 plants (De;
Makaroff PLOS Genetics in review), no obvious differences were observed in ASY1 labeling in
Atwapl1-1wapl2ctf7 meiocytes (Figure 3.6).
ZYP1 is is a component of the transverse filament of the synaptonemal complex (52).
ZIP1 signals appear during zygotene and become continuous during pachytene. ZIP1 signals in
Atwapl1-1wapl2ctf7 meiocytes appeared normal throughout meiosis (n= 64) (Figure 3.6).
98
Figure 3.6 Loading of synaptonemal complex proteins is normal in meiotic chromosomes of
the Atwapl1.1wapl2ctf7 mutant. In mutant the loading of ASY1(A, B) and ZYP1(C, D) is
completed at the pachytene stage. Scale bar: 10 µm.
The prophase removal of cohesin is recovered in Atwapl1-1wapl2ctf7
Immunolocaliztion studies with antibody against SYN1, the meiotic homolog of cohesion
subunit REC8 (53), were conducted in order to determine the effect of inactivating both WAPL
and CTF7 on cohesin distribution. In wild type meiocytes SYN1 antibody shows a diffuse
labeling of the condensing chromosomes during early leptotene and decorates the developing
chromosomal axes during late leptotene and zygotene. The antibody lines the axes of synapsed
chromosomes from late zygotene to pachytene (Figure 3.7A & B). A large portion of the cohesin
is released from chromosomes during diplotene and diakinesis as the chromosomes condense
(Figure 3.7C), and by prometaphase I very little SYN1 is observed on the condensed
chromosomes (Figure 3.7D). The loading and distribution of SYN1 on chromosomes is severly
affected in ctf7-1 meiocytes (39). SYN1 labeling is very weak and irregular during leptotene and
99
zygotene (Figure 3.7 E) and becomes progressively weaker as prophase progresses in
approximately half of the meiocytes (Figure 3.7F-H).
Figure 3.7 Cohesin establishment is recovered
in wapl1.1wapl2ctf7 meiocytes. Meiotic
spreads of wild-type (A-D), ctf7 (E-H), wapl1.1wapl2 (I-L) and wapl1.1wapl2ctf7 (M-P) plants
were prepared and stained with anti-SYN1 antibody (green) and propidium iodide (red).
Meiocytes in wild-type plants, wapl1.1wapl2 and the Atwapl1.1wapl2ctf7 mutant exhibited
similar patterns of staining with SYN1 from the leptotene to pachytene. The ctf7 mutant did not
exhibit clear SYN1 signals during leptotene (E), zygotene (F), pachytene (G) and diakinesis (H).
In wild-type meiocytes SYN1 is removed from chromosome arms from diplotene (data not
shown) through diakinesis (C) and was not detectable during pro- metaphase I (D). However, a
strong SYN1 signal was detectable in wapl1.1wapl2 during diakinesis, metaphaseI/anaphaseI
stage (K, L). The SYN1 signal on chromosomes of wapl1. 1wapl2ctf7 resembled the pattern
100
observed in wild type meiocytes from leptotene to pachytene (M,N). During diakinesis (O), the
SYN1 signals were also strong, which suggests that the cohesin complex was not removed from
the chromosome arms as normal. Finally, by the metaphase/ anaphase I stage (P) little to no
SYN1 signals were detected, and by late anaphase I (data not shown) no trace of SYN1 signal
was identified. Scale bars = 5 μm.
In contrast, cohesin labeling is normal in Atwapl1.1wapl2 plants during early stages of
prophase I with SYN1 labelling the developing axes during leptotene (Figure 3.7I) and zygotene
and completely lining the synapsed chromosomes at pachytene (Figure 3.7J). Defects are
however observed beginning at diplotene/diakinesis in Atwapl1.1wapl2 meiocytes, when cohesin
release from chromosome arms is delayed (Figure 3.7 K). Strong SYN1 labeling of the
chromosomes is consistently observed on metaphase I and early anaphase I chromosomes in
Atwapl1.1wapl2 meiocytes (Figure 3.7L). Although SYN1 signals were typically not observed
metaphase II meiocytes (De, Makaroff PLOS Genetics in press).
SYN1 labeling patterns in Atwapl1.1wapl2ctf7 meiocytes were normal during early
prophase. At interphase SYN1 exhibited diffuse nuclear labeling with the signal decorating the
developing chromosomal axes beginning at early leptotene and extending into zygotene (Figure
3.7M). The protein lined the axes of the paired chromosomes during late zygotene and pachytene
(Figure 3.7 N). While not as dramatic as the alterations in Atwapl1.1wapl2, SYN1 release from
the chromosomes at diplotene and diakinesis appeared to be delayed with strong SYN1 signals
observed on the chromosomes at diplotene and diakinesis (Figure 3.7O). However, the SYN1
signal was reduced during prometaphase/metaphaseI (Figure 3.7P) with little to no signal being
observed by anaphase I.
CTF7 inactivation amplifies abnormalities in spindle attachment and
assembly in WAPL inactivated cells during meiosis
Chromosome behavior in Atwapl1.1waplctf7 meiocytes was further studied by analyzing spindle
formation with immunolocalization studies using β-tubulin antibody. In wild type meiocytes a
bipolar spindle is observed during metaphase I and anaphase I (Figure 3.8A, B), with radial
spindles forming between the two groups of chromosomes at telophase I (Figure 6C). Two
bipolar spindles, which are perpendicular to each other, are then observed during metaphase II
101
and anaphase II (Figure 6D, 6E) with radial microtubules again forming between the four
separated nuclei during telophase II (Figure 6F).
Figure 3.8 The radial microtubule system (RMS) is severely abnormal due to inactivation
of WAPL1/2 and CTF7/ECO1. Spindles of male meiocytes from wild type and (A-F)
Atwapl1.1wapl2ctf7 (G-L) were stained using anti- tubulin antibody (green), while DNA was
counterstained with propidium iodide (red). Abnormalities were observed in Atwapl1.1wapl2ctf7
male meiocytes at metaphase I (A, G), anaphase I (B, H), telophase I (C, I), metaphase II (D, J),
anaphase II (E, K), and telophase II/tetrad stages (F, L). Scale bars = 10 μm.
Similar to the situation in Atwapl1.1wapl2 plants, abnormal spindle morphologies were
observed throughout meiosis in the majority (80%) of Atwapl1.1wapl2ctf7 meiocytes. During
metaphase I some cells lacked a bipolar spindle all together (data not shown), while in others the
spindles were distorted (data not shown) or contained spindle microtubules that passed over the
chromosomes (Figure 3.8G). During anaphase I and telophase I the spindles were often not well
defined and in approximately 30% of the meiocytes chromosomes were observed that did not
attach to the spindles (Figure 3.8H, I). During meiosis II cells containing parallel spindles
(Figure 3.8J, n=5), or spindle microtubules that connected small individual groups of
chromosomes were commonly observed (Figure 3.8k, n=4). Abnormalities were also observed in
the Radial Microtubule System of most cells (90%, n=24) at telophase/tetrad stage in (Figure
3.8L).
102
Mitotic cells show normal chromosome segregation in Atwapl1.1wapl2ctf7 root
tips
In a previous report (39) it was shown that ctf7 plants are defective in mitotic chromosome
segregation. Likewise, altwerations in mitotic cells were also observed in Atwapl1.1wapl2 cells
at a lower frequency (ref). Mitotic spreads on Atwapl1.1wapl2ctf7 root tips failed to identify
alterations in mitosis. Therefore roots appear to show full recovery of chromosome structure
during mitosis.
3.5 Discussion
3.5.1 WAPL inactivation suppresses lethality and restores partial fertility in
atctf7 plants
Previous studies revealed that mutations in both copies of Arabidopsis WAPL results in a
high frequency of poorly resolved sister chromatids during meiosis, but has little effect on
vegetative growth. When they survive Atctf7 plants are dwarf, exhibit severe developmental
abnormalities and are completely sterile. They also display severe mitotic defects, alterations in
double strand break repair and the premature dissociation of cohesin from meiotic chromosomes,
which leads to the early separation of sister chromatids (39). Similar to the situation in yeast
(11), inactivation of Wapl is able to rescue the vegetative growth defects and partially rescue
fertility defects associated with Atctf7 mutatiuons. Plants triple homozygous for the
Atwapl1.1wapl2ctf7-1 mutations display normal vegetative growth and produce 30-40 pollen per
anther locule and 10-15 seeds per silique (De, Makaroff PLOS Genetics in press). The growth
rate of Atwapl1.1wapl2ctf7-1 plants is same as that of wild type, indicating that inactivation of
WAPL suppresses most, if not all of the effects associated with CTF7 inactivation in somatic
cells. Furthermore, inactivation of WAPL restores some fertility to Atctf7-1 plants. The overall
fertility of Atwapl1.1wapl2ctf7-1 plants is lower than that of Atwapl1.1wapl2 plants, but similar
to that observed for Atwapl1.1wapl2ctf7+/- plants. Previous studies in budding yeast showed that
Eco1/CTF7 antagonizes Wpl1p, likely by acetylating Smc3-K112, K113 residues (11). In other
organisms WAPL is required for efficient removal of cohesin from the chromosomes (9, 10, 54).
103
Likewise, it has been found in human cells that cohesion defects due to Esco2 depletion can be
rescued by co-depletion of WAPL (10).
Recent studies have also shown that human and mouse WAPL homologues are required
to regulate chromatin structure and chromosome condensation (55, 56). Interestingly, most
Atwapl1.1wapl2ctf7 male meiocytes observed at the metaphaseI/anaphaseI transition stage
contained "poorly resolved" chromosomes and the level of stickiness is much lower between the
bivalents. This hints to the possibility that the cohesin complex might not be released normally in
the triple homozygous mutant. The frequency of formation of chromosomal bridges in
Atwapl1.1wapl2ctf7 plants was also higher than in Atwapl1.1wapl2 plants, possibly due to the
additive effect of CTF7 inactivation. If this were the case it is possible that heterochromatin
condensation is altered in both somatic and meiotic Arabidopsis chromosomes and that this
defect accounts for the high frequency of chromosomal bridges during meiotic anaphase in the
Atwapl1.1wapl2 and Atwapl1.1wapl2ctf7 mutants. However, more work will be required to test
this hypothesis.
3.5.2 CTF7/ECO1 is no longer essential for cohesion when WAPL1/2 are
inactivated
Depletion of AtCTF7 and AtWAPL appears to have antagonistic effects on cohesion. Depletion
of AtCTF7 causes premature separation of chromatids, while depletion of AtWAPL causes
delayed separation of homologs and produces "sticky" chromosomes in Arabidopsis. To
understand the interaction between AtCTF7 and AtWAPL we inactivated both proteins
individually or together and analyzed the distribution patterns of the SYN1 cohesin subunit by
means of immunolocalization in meiotic chromosomes. Mitotic chromosomes were also
analyzed by using an SMC3 antibody in both Atwapl1.1wapl2 and Atwapl1.1wapl2ctf7 plants.
No differences where observed in terms of release of cohesin from mitotic chromosomes when
compared to the wild type. In meiotic cells, inactivation of AtCTF7 leads to dramatic alterations
in SYN1 labeling (39). In approximately 50% of the meiocytes, the SYN1 labeling was same as
wild type, but in the remaining 50% of the meiocytes, there was little to no signal beginning at
leptotene (43). At later stages we could not identify any trace of SYN1 labeling in Atctf7-/meiocytes. We previously showed that, Wapl inactivation causes the chromosomes become
sticky and the cohesin release is delayed in meiocytes. Interestingly, depletion of both AtCtf7 and
104
AtWapl, resulted in sticky chromosomes and the SYN1 cohesin signal during diakinesis was
quite similar to that when AtWapl is inactivated. These observations/phenotypes clearly indicates
that, AtCtf7 is essential for cohesin only in the presence of AtWapl and this suggest that AtCtf7
has the antagonizing function to AtWapl in Arabidopsis. Similar results have been observed
between Sororin and Wapl (25), where Sororin mediates sister chromatid cohesion by
antagonizing AtWapl.
It is not well understood how the establishment, maintenance and release of sister
chromatid cohesion is regulated. More recent studies have proposed that the establishment and
stability of of cohesion is achieved by acetylation of Smc3 and during S-phase, which may cause
a conformational change as a result of the acetylation (11, 13-15). One of the important
outcomes of this study is that, if the function of AtCtf7 is to inhibit AtWapl, then AtCtf7 should
be expected to be dispensable in the absence of AtWapl. Our results support this hypothesis.
Another important finding from this study is that AtCtf7 might not be important for cohesin
establishment in absence of AtWapl. However it is also possible that a redundant pathway is
getting activated due to inactivation of both AtWapl and AtCtf7 in Arabidopsis genome. Another
possibility that when AtCtf7 is knocked out, while AtWapl is present, the presence of the
antiestablishment factor might masks any possible secondary establishment factors which come
into play for the establishment of cohesion. But, when both the primary establishment factor
(AtCtf7) and anti-establishment factor (AtWapl) is knocked out, secondary establishment factors
might come into play.
Recent studies in animal cells revealed that sororin also acts as an antagonist to WAPL
(25). It has been shown that Sororin is essential for the stable interaction between cohesin and
DNA. The coupling of DNA replication and cohesin acetylation promotes binding of Sororin to
cohesin and by this interaction Sororin replaces Wapl from its partner Pds5. However, they have
shown that in the absence of Wapl, Sororin is not as important protein for cohesion (25). A Sorin
homolog has not been found in plants. But since the protein has very little amino acid similarities
among different species it may just not have been found yet. So in the future, it will be
interesting to explore other factors or proteins which enables cohesin protein to establish and
maintains its cohesion.
105
3.6 References
(1)
Juan-Manuel Schvartzman, R. S. R. B. (2011) Mitotic chromosomal instability and
cancer: mouse modelling of the human disease. Nat Rev Cancer 10, 102-115.
(2)
Anderson, D. E., Losada, A., Erickson, H. P., and Hirano, T. (2002) Condensin and
cohesin display different arm conformations with characteristic hinge angles. J Cell Biol
156, 419-424.
(3)
Haering, C., Lowe, J., Hochwagen, A., and Nasmyth, K. (2002) Molecular architecture of
SMC proteins and the yeast cohesin complex. Mol Cell 9, 773-788.
(4)
Huang, C. E., Milutinovich, M., and Koshland, D. (2005) Rings, bracelet or snaps:
fashionable alternatives for Smc complexes. Philos. Trans. R. Soc. B: Biological Sciences
360, 537-542.
(5)
Nasmyth, K., and Haering, C. H. (2009) Cohesin: Its Roles and Mechanisms. Annu Rev
Genet 43, 525-558.
(6)
Lin, W. Q., Jin, H., Liu, X. W., Hampton, K., and Yu, H. G. (2011) Scc2 regulates gene
expression by recruiting cohesin to the chromosome as a transcriptional activator during
yeast meiosis. Mol Biol Cell 22, 1985-1996.
(7)
Gerlich, D., Koch, B., Dupeux, F., Peters, J. M., and Ellenberg, J. (2006) Live-cell
imaging reveals a stable cohesin-chromatin interaction after but not before DNA
replication. Curr Biol 16, 1571-1578.
(8)
Ouyang, Z., Zheng, G., Song, J., Borek, D. M., Otwinowski, Z., Brautigam, C. A.,
Tomchick, D. R., Rankin, S., and Yu, H. Structure of the human cohesin inhibitor Wapl.
Proc Natl Acad Sci 110, 11355-11360.
(9)
Kueng, S., Hegemann, B., Peters, B. H., Lipp, J. J., Schleiffer, A., Mechtler, K., and
Peters, J. M. (2006) Wapl controls the dynamic association of cohesin with chromatin.
Cell 127, 955-967.
(10)
Gandhi, R., Gillespie, P. J., and Hirano, T. (2006) Human Wapl Is a Cohesin-Binding
Protein that Promotes Sister-Chromatid Resolution in Mitotic Prophase. Curr Biol : CB
16, 2406-2417.
106
(11)
Ben-Shahar, T. R., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M., and Uhlmann,
F. (2008) Eco1-Dependent Cohesin Acetylation During Establishment of Sister
Chromatid Cohesion. Science 321, 563-566.
(12)
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009) Budding Yeast
Wpl1 (Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing
Reaction. Curr Biol 19, 492-497.
(13)
Rowland, B. D., Roig, M. B., Nishino, T., Kurze, A., Uluocak, P., Mishra, A., Beckouet,
F., Underwood, P., Metson, J., Imre, R., Mechtler, K., Katis, V. L., and Nasmyth, K.
(2009) Building Sister Chromatid Cohesion: Smc3 Acetylation Counteracts an
Antiestablishment Activity. Mol Cell 33, 763-774.
(14)
Unal, E., Heidinger-Pauli, J. M., Kim, W., Guacci, V., Onn, I., Gygi, S. P., and Koshland,
D. E. (2008) A molecular determinant for the establishment of sister chromatid cohesion.
Science 321, 566-569.
(15)
Zhang, J. L., Shi, X. M., Li, Y. H., Kim, B. J., Jia, J. L., Huang, Z. W., Yang, T., Fu, X.
Y., Jung, S. Y., Wang, Y., Zhang, P. M., Kim, S. T., Pan, X. W., and Qin, J. (2008)
Acetylation of Smc3 by Eco1 is required for S phase sister chromatid cohesion in both
human and yeast. Mol Cell 31, 143-151.
(16)
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009) Budding Yeast
Wpl1(Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing
Reaction. Curr Biol 19, 492-497.
(17)
Panizza, S., Tanaka, T. U., Hochwagen, A., Eisenhaber, F., and Nasmyth, K. (2000) Pds5
cooperates with cohesin in maintaining sister chromatid cohesion. Curr Biol 10, 15571564.
(18)
Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando,
M., Shirahige, K., Hyman, A. A., Mechtler, K., and Peters, J. M. (2011) Sororin Mediates
Sister Chromatid Cohesion by Antagonizing Wapl. Cell 143, 737-749.
(19)
Uhlmann, F., Lottspeich, F., and Nasmyth, K. (1999) Sister-chromatid separation at
anaphase onset is promoted by cleavage of the cohesin subunit Scc1. Nature 400, 37-42.
(20)
Waizenegger, I. C., Hauf, S., Meinke, A., and Peters, J.-M. (2000) Two Distinct
Pathways Remove Mammalian Cohesin from Chromosome Arms in Prophase and from
Centromeres in Anaphase. Cell 103, 399-410.
107
(21)
Losada, A., Hirano, M., and Hirano, T. (2002) Cohesin release is required for sister
chromatid resolution, but not for condensin-mediated compaction, at the onset of mitosis.
Genes Dev 23, 3004-3016.
(22)
Tomonaga, T., Nagao, K., Kawasaki, Y., Furuya, K., Murakami, A., Morishita, J., Yuasa,
T., Sutani, T., Kearsey, S., Uhlmann, F., Nasmyth, K., and Yanagida, M. (2000)
Characterization of fission yeast cohesin: essential anaphase proteolysis of Rad21
phosphorylated in the S phase. Genes & Dev 14, 2757-2770.
(23)
Sumara, I., Vorlaufer, E., Gieffers, C., Peters, B. H., and Peters, J. M. (2000)
Characterization of vertebrate cohesin complexes and their regulation in prophase. J Cell
Biol 151, 749-761.
(24)
Schmitz, J., Watrin, E., Lenart, P., Mechtler, K., and Peters, J. M. (2007) Sororin is
required for stable binding of cohesin to chromatin and for sister chromatid cohesion in
interphase. Curr Biol 17, 630-636.
(25)
Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando,
M., Shirahige, K., Hyman, A. A., Mechtler, K., and Peters, J.-M. Sororin Mediates Sister
Chromatid Cohesion by Antagonizing Wapl. Cell 143, 737-749.
(26)
Kitajima, T. S., Kawashima, S. A., and Watanabe, Y. (2004) The conserved kinetochore
protein shugoshin protects centromeric cohesion during meiosis. Nature 427, 510-517.
(27)
Rivera, T., and Losada, A. (2009) Shugoshin regulates cohesion by driving relocalization
of PP2A in Xenopus extracts. Chromosoma 118, 223-233.
(28)
Tang, Z. Y., Shu, H. J., Qi, W., Mahmood, N. A., Mumby, M. C., and Yu, H. T. (2006)
PP2A is required for centromeric localization of sgol and proper chromosome
segregation. Dev Cell 10, 575-585.
(29)
Hauf, S., Waizenegger, I. C., and Peters, J. M. (2001) Cohesin cleavage by separase
required for anaphase and cytokinesis in human cells. Science 293, 1320-1323.
(30)
Musacchio, A., and Salmon, E. D. (2007) The spindle-assembly checkpoint in space and
time. Nature Reviews Mol Cell Biol 8, 379-393.
(31)
Uhlmann, F., Wernic, D., Poupart, M. A., Koonin, E. V., and Nasmyth, K. (2000)
Cleavage of cohesin by the CD clan protease separin triggers anaphase in yeast. Cell 103,
375-386.
108
(32)
Chan, K. L., Roig, M. B., Hu, B., Beckouet, F., Metson, J., and Nasmyth, K. (2012)
Cohesin's DNA Exit Gate Is Distinct from Its Entrance Gate and Is Regulated by
Acetylation. Cell 150, 961-974.
(33)
Buheitel, J., and Stemmann, O. (2013) Prophase pathway-dependent removal of cohesin
from human chromosomes requires opening of the Smc3-Scc1 gate. Embo J 32, 666-676.
(34)
Chatterjee, A., Zakian, S., Hu, X. W., and Singleton, M. R. (2013) Structural insights into
the regulation of cohesion establishment by Wpl1. Embo Journal 32, 677-687.
(35)
Vega, H., Waisfisz, Q., Gordillo, M., Sakai, N., Yanagihara, I., Yamada, M., van Gosliga,
D., Kayserili, H., Xu, C. Z., Ozono, K., Jabs, E. W., Inui, K., and Joenje, H. (2005)
Roberts syndrome is caused by mutations in ESCO2, a human homolog of yeast ECO1
that is essential for the establishment of sister chromatid cohesion. Nat Genet 37, 468470.
(36)
Whelan, G., Kreidl, E., Wutz, G., Egner, A., Peters, J. M., and Eichele, G. (2012)
Cohesin acetyltransferase Esco2 is a cell viability factor and is required for cohesion in
pericentric heterochromatin. Embo J 31, 71-82.
(37)
Lu, S., Goering, M., Gard, S., Xiong, B., McNairn, A. J., Jaspersen, S. L., and Gerton, J.
L. Eco1 is important for DNA damage repair in S. cerevisiae. Cell Cycle 9, 3335-3347.
(38)
Jiang, L., Yuan, L., Xia, M., and Makaroff, C. A. (2010) Proper Levels of the
Arabidopsis Cohesion Establishment Factor CTF7 Are Essential for Embryo and
Megagametophyte, But Not Endosperm, Development. Plant Physiology 154, 820-832.
(39)
Bolaños-Villegas, P., Yang, X., Wang, H.-J., Juan, C.-T., Chuang, M.-H., Makaroff, C.
A., and Jauh, G.-Y. Arabidopsis CHROMOSOME TRANSMISSION FIDELITY 7
(AtCTF7/ECO1) is required for DNA repair, mitosis and meiosis. The Plant Journal.
(40)
Ross, K. J., Fransz, P., and Jones, G. H. (1996) A light microscopic atlas of meiosis in
Arabidopsis thaliana. Chromosome Res 4, 507-516.
(41)
Yang, X., Yuan, L., and Makaroff, C. Immunolocalization Protocols for Visualizing
Meiotic Proteins in Arabidopsis thaliana: Method 3, in Plant Meiosis pp 109-118,
Humana Press.
(42)
Lam, W. S., Yang, X. H., and Makaroff, C. A. (2005) Characterization of Arabidopsis
thaliana SMC1 and SMC3: evidence that ASMC3 may function beyond chromosome
cohesion. J Cell Sci 118, 3037-3048.
109
(43)
Cai, X., Dong, F. G., Edelmann, R. E., and Makaroff, C. A. (2003) The Arabidopsis
SYN1 cohesin protein is required for sister chromatid arm cohesion and homologous
chromosome pairing. J Cell Sci 116, 2999-3007.
(44)
Fransz, P., Alonso-Blanco, C., Liharska, T. B., Peeters, A. J. M., Zabel, P., and Hans de
Jung, J. (1996) High resolution physcial mapping in Arabidopsis thaliana and tomato by
fluorescence in situ hybridization to extended DNA fibers. Plant J 9, 421-430.
(45)
Caryl, A. P., Armstrong, S. J., Jones, G. H., and Franklin, F. C. H. (2000) A homologue
of the yeast HOP1 gene is inactivated in the Arabidopsis meiotic mutant asy1.
Chromosoma 109, 62-71.
(46)
Martinez-Zapater, J., Estelle, M., and Somerville, C. (1986) A highly repeated DNA
sequence in Arabidopsis thaliana. Molecular and General Genetics MGG 204, 417-423.
(47)
Vielle-Calzada, J. P., Baskar, R., and Grossniklaus, U. (2000) Delayed activation of the
paternal genome during seed development. . Nature 404, 91-94.
(48)
Herr, J. M., Jr. (1971) A New Clearing-Squash Technique for the Study of Ovule
Development in Angiosperms. American Journal of Botany 58, 785-790.
(49)
Siddiqi, I., Ganesh, G., Grossniklaus, U., and Subbiah, V. (2000) The dyad gene is
required for progression through female meiosis in Arabidopsis. Development 127, 197207.
(50)
Armstrong, S., Franklin, F., and Jones, G. (2001) Nucleolus-associated telomere
clustering and pairing preceed meiotic chromosome synapsis in Arabidopsis thaliana. J
Cell Sci 114, 4207-04217.
(51)
Armstrong, S. J., Caryl, A. P., Jones, G. H., and Franklin, F. C. H. (2002) Asy1, a protein
required for meiotic chromosome synapsis, localizes to axis-associated chromatin in
Arabidopsis and Brassica. J Cell Sci 115, 3645 - 3655.
(52)
Higgins, J. D., Sanchez-Moran, E., Armstrong, S. J., Jones, G. H., and Franklin, F. C. H.
(2005) The Arabidopsis synaptonemal complex protein ZYP1 is required for
chromosome synapsis and normal fidelity of crossing over. Genes Dev 19, 2488-2500.
(53)
Cai, X., Dong, F., Edelmann, R. E., and Makaroff, C. A. (2003) The Arabidopsis SYN1
cohesin protein is required for sister chromatid arm cohesion and homologous
chromosome pairing. J Cell Sci 116, 2999 - 3007.
110
(54)
Bernard, P., Schmidt, C. K., Vaur, S., Dheur, S., Drogat, J., Genier, S., Ekwall, K.,
Uhlmann, F., and Javerzat, J. P. (2008) Cell-cycle regulation of cohesin stability along
fission yeast chromosomes. Embo J27, 111-121.
(55)
Tedeschi, A., Wutz, G., Huet, S., Jaritz, M., Wuensche, A., Schirghuber, E., Davidson, I.
F., Tang, W., Cisneros, D. A., Bhaskara, V., Nishiyama, T., Vaziri, A., Wutz, A.,
Ellenberg, J., and Peters, J. -M. Wapl is an essential regulator of chromatin structure and
chromosome segregation. Nature 501, 564-568.
(56)
Haarhuis, Judith H. I., Elbatsh, Ahmed M. O., van den Broek, B., Camps, D.,
Erkan, H., Jalink, K., Medema, R.  H., and Rowland, Benjamin D. WAPL-Mediated
Removal of Cohesin Protects against Segregation Errors and Aneuploidy. Curr Biol 23,
2071-2077.
111
Chapter 4
112
Characterization of MMD-like Genes and Their Roles in
Chromosome Biology
Kuntal De, Sayantan Mitra, Garret Homan, Megan Shroder, Joseph Chandran and Christopher A.
Makaroff
Author contributions: Kuntal De contributed to the collection of data; Kuntal De and Chris
Makaroff contributed to
the writing of the manuscript; Kuntal De and Sayantan Mitra
contributed by pollen Alexander staining; Joseph Chandran constructed the MBP-MMD1PHD
clone; Kuntal De, Garret Homan and Megan Shroder contributed to plant genotyping and making
RNAi construct.
113
4.1 Abstract:
Meiosis involves a number of highly coordinated events that are regulated by transcriptional and
checkpoint control mechanisms. A large number of Arabidopsis meiotic mutants have been
studied, but very little is known about the regulation of meiosis in plants. The characterization of
the male meiocyte death1 (mmd1) mutant in which male meiocytes undergo apoptosis during
prophase I was previously reported. MMD1 is a PHD (Plant Homeo Domain) containing protein.
In addition to MMD1 there are three other MMD-like genes in Arabidopsis, which also contain
PHD fingers. MS1 (male sterility 1) is required for pollen development and appears to be a
transcription factor. Two other MMD1-like proteins MMDL1 and MMDL2 have yet to be
characterized. In order to better understand the role of MMD1 in meiosis, we have investigated
the role(s) of MMDL1 and MMDL2. Plants homozygous for mutations in either gene show no
phenotype, but interestingly plants heterozygous for each mutation and plants double
heterozygous for mutations in the genes exhibit defects in seed development and pollen abortion.
In double heterozygous plants there is no sign of endosperm and embryo development.
Therefore, proper levels of MMDL-1 and MMDL-2 and potentially the ratio of MMDL1 and
MMDL2 appear to be essential for pollen, female gametophyte and embryo development.
4.2 Introduction
The Plant Homeo Domain (PHD) was first identified in the Arabidopsis thaliana HAT3 protein
(1). PHD domains contain a Cys4-His-Cys3 motif, which is often considered a RING domain.
PHD fingers are approximately 50-60 amino acids in length. In the budding yeast
Saccharomyces cerevisiae, 14 proteins have been identified that contain PHD fingers (2). All of
the proteins have either been shown to be targeted to the nucleus [19], or predicted to be essential
for transcription elongation (TFS2M) and histone modification (3). In Drosophila melanogaster,
38 proteins contain a PHD finger and 28 have been shown to localize to the nucleus (4). In
humans more than 100 proteins contain a PHD domain, many of which are targeted to the
nucleus and facilitate chromatin remodelling and/or transcription. Several human diseases are
associated with mutations in PHD proteins that affect chromatin structure. For example, the
114
William Syndrome Transcription Factor (WSTF) contains a PHD finger that contains conserved
cysteines and histidines, which can coordinate two zinc ions (5). It is a constituent of ISWI- and
SWI/SNF based chromatin remodelling complexes (6). The autoimmune regulator protein
(AIRE1), which has a PHD domain is also predicted to be involved in transcription (7). ATRX,
which is a component of SWI/SNF2-like chromatin remodelling complex is another well studied
human disease-related PHD protein, which is involved in transcriptional regulation (7, 8). The
Arabidopsis genome contains 66 genes that encode one or more PHD domains, and most of them
are predicted to function in chromatin remodelling.
Meiotic cell cycle control mechanisms appear to differ between yeast, animal cells and
plants. Regulation of the meiotic cell cycle is best understood in yeast (9), where a number of
mutations have been identified and are related to block chromosome synapsis and/ or
recombination and induces arrest of meiocytes by pachytene (10, 11). The meiotic checkpoint
related to pachytene has also been shown in other organisms, such as Drosophila,
Caenorhabditis elegans, and mouse (12-16); however, it has not been explored in plants. A
mutation in Arabidopsis has been identified that affects male meiocyte formation through the
process of meiosis (17). Genetic studies in number of plants have identified other mutations that
affect either meiocyte formation or the process of meiosis (18-23). Most of these meiotic mutants
do not arrest but rather produce abnormal microspores of unequal size and shape which
ultimately form aborted pollen and results in male sterility or reduced male fertility. This
suggests that the meiotic checkpoint control might not be important in plants. However, one
mutation, mmd1, has been identified that results in male meiocyte death (17).
Mutations in the Arabidopsis Male Meiocyte Death1 (MMD1) gene results in
cytoplasmic shrinkage and chromatin fragmentation, leading to male meiocyte apoptosis
(17). MMD1 is expressed during meiosis and encodes a PHD finger. Arabidopsis contains three
other MMD1-like proteins, MS1, which is essential for tapetal cell development (24) and
MMDL1 and MMDL2, which are expressed at elevated levels in the endosperm and sperm cells,
respectively. In the current study genetic analyses were conducted on a number of lines
containing mutations in MMDL1 and MMDL2 to understand the roles of the proteins. Plants
homozygous for single mutations in MMDL1 and MMDL2 appear normal. Plants heterozygous
for any of three different MMDL2 mutations show reduced male and female fertility. Plants
heterozygous for one of the MMDL1 alleles also shows male and female reduced fertility, while
115
a
second
allele
does
not.
Plants
homozygous
for
both
mutations
were
not
recovered. Interestingly, mmdl1-/-Mmdl2+/- plants are viable, but display a seed abortion
phenotype, while Mmdl1+/-mmdl2-/- plants were not recovered. All progeny from mmdl1-/Mmdl2+/- plants are the same plant genotype; mmdl1-/-Mmdl2+/- suggesting, apomoxis/maternal
clones. Plants containing a DMC1-MMDL2 RNAi construct showed a severe pollen abortion
phenotype in a wild type background, suggesting that there may be dosage effect for MMDL2.
As part of biochemical studies, we have shown that the MMD1 PHD finger of is capable of
binding histone H2A. Therefore, the MMDL proteins may be important for controlling chromatin
structure and play a role in transcriptional regulation.
4.3 Methods and Materials
4.3.1 Plant material and growth conditions: Arabidopsis thaliana ecotype Columbia (Col) was
the source of both wild type and mutant plants. T-DNA insertion mutants for MMDL1
(At1g33420) and MMDL2 (At2g01810) were obtained from the Arabidopsis Stock Center. The
T-DNA line mmdl1-1 (Salk_015926) contains a T-DNA insert in the 5'UTR region while the
mmdl1-2 (Salk_014761) insert is in the second exon of AtMMDL-1. T-DNA insertional mutants
for mmdl2-1 (Salk_124249), mmdl2-3 (Salk_ 099086C) and mmdl2-2 (Salk_147417C) contain
inserts in exon 2 and exon 3 of AtMMDL-2 respectively. Plants were grown in Metro-Mix 200
soil (Scotts-Sierra Horticulture Products; http://www.scotts.com) or on germination plates
(Murashige and Skoog; Caisson Laboratories; www.caissonlabs.peachhost.com) in a growth
chamber at 22oC with a 16-h-light/ 8-h-dark cycle. Leaves were collected from rosette-stage
plants grown on soil and used for DNA isolation and genotyping. Approximately 24 d after
germination, buds were collected and staged for microscopy studies. For transcript analysis all
samples were harvested, frozen in liquid N2, and stored at -80oC until needed.
4.3.2 Phylogenetic analysis of multiple MMD-like genes in plants
A phylogenetic analysis of MMD-like genes was conducted using vector NTI and PHD domains
were compared using the CLUSTAL W software.
4.3.3 Analysis of T-DNA knockout mutations of MMDL1 and MMDL2
116
For genotyping, genomic DNA was isolated from single homozygous mutant plants, segregating
populations of double heterozygous plants and wild type plants. To identify the mmdl1-1 T-DNA
insertion
the
primer
pairs
(5'
ATGGTTCACGTAGTGGGCCATC
3'/5'
CGGAACTGGATAATGGATA 3') and ( 5' CGGAACTGGATAATGGATA/ 470 5'
TCAAACTCGAGAAGAGCGT) were used. To identify the mmdl1-2 T-DNA primer pairs
(TCCCTTTAATCCGTATGACCC/LBb1.3) and (5' AAGTATGGGATGGACTACCGG / 5'
TCCCTTTAATCCGTATGACCC) were used. For
mmdl2-1 and mmdl2-2 primer sets (5'
CTCTCTGGTGACCAAATCATG +LBb1. 3) and (5' CTCTCTGGTGACCAAATCATG/ 5'
ATGATTGGGAAGAACCTG) were used for genotyping.
4.3.4 Expression analyses
Total RNA was extracted from inflorescences of wild-type, Atmmdl1 and Atmmdl2 plants to
measure MMD-like transcript levels in mutant plants. Total RNA was extracted from with the
Plant RNeasy Mini kit (Qiagen, Hilden, Germany), treated with Turbo DNase I (Ambion) and
used for cDNA synthesis with an oligo (dt) primer and a First Strand cDNA Synthesis Kit
(Roche). Real time PCR was performed with SYBR-Green PCR Mastermix (Clontech) and the
amplification was monitored on a CFXsystems (Biorad). Expression was normalized against βtubulin-2.
4.3.5 Analysis of pollen and embryo development
Anther morphology and pollen viability was analyzed by staining with Alexander staining (25).
Whole-mount clearing was used to determine the embryo phenotypes (26, 27). Siliques from
wild-type and mutant plants were dissected and cleared in Hoyer's solution containing lactic
acid: chloral hydrate: phenol: clove oil: xylene ( 2:2:2:2:1, w/w). Embryo development was
studied microscopically with a Olympus BX51 microscope equipped with differential
interference contrast optics.
4.3.6 Chromosome analysis
Male meiotic chromosome spreads were performed on floral buds fixed in Carnoy's fixative
(ethanol:chloroform:acetic acid: 6:3:1) and prepared as described previously (28). Chromosomes
117
were stained with DAPI, observed with an Olympus BX51 epifluorescence microscope system
and images captured using Spot camera system and processed using Adobe Photoshop.
4.3.7 35S and DMC1 promoter RNAi constructs
To produce transgenic plants expressing a MMDL2-RNAi construct, a 450-nucleotide fragment
from the MMDL2 C-terminal coding region nucleotides (1358 to 1808) was amplified using
primers 5'-CCTTAATTAACCATGGCCCGTGTTCAAGAGCAAAAA-3'and
5'GCTCTAGAGGCGCGCCTCACGTTGTCGTCTAGCTTCT-3' and cloned into pFGC5941.
The PCR products were purified and cloned in both the sense (digested with NcoI and AscI) and
antisense (digested with XbaI and PacI) directions flanking the CHSA intron. The same
fragments were also cloned to a modified version of pFGC5941 that contained the meiosisspecific long DMC1 promoter using same enzymes.
4.3.8 MBP-PHD construct
Primer # 977 5' GGAATTCCATATGCAAGGTGGATGTGATACATGGAT3' and primer #
1002 CCCAAGCTTCAGCACTTTCCTCTGTTGCTCTGC were used to amplify a cDNA
fragment containing the MMD1 PHD domain, which was then cloned using restriction enzymes
NdeI and Hind III into pIADL14 vector. This generated a C-terminal MBP tag with a thrombin
cleavage site in between the MBP tag and PHD domain.
4.3.9 Purification of MMD1 PHD and binding assays with histone H2A
After standard over-expression conditions the cells were harvested and the cell pellet
resuspended with 500mM NaCl, 50mM Tris, pH 7.6 (Buffer A) and lysed using a french press.
The cell lysate was centrifuged at 4 degrees Celsius at 20,000 rpm to separate the soluble protein
and insoluble pellet. The soluble fraction was then loaded on an amylose affinity column. After
loading, the column was washed with 20 column volumes buffer A. One ml of a commercial
preparation of total histones (1 mg/ml) was loaded and incubated at cold room for 15-30 minutes.
After incubation, the column was again washed with 20 column volumes buffer A and the fusion
protein was eluted by using 500mM NaCl, 50mM, 10 mM maltose Tris pH 7.6 (Buffer B). The
eluted purified protein was then run on an SDS protein gel and stained with coomassie blue. The
histone bands were confirmed by protease digestion of gel bands followed by analysis by
118
MALDI. Western blotting performed using anti-H2A antibody confirmed that MMD1-PHD can
bind histone H2A.
4.4 Results
4.4.1 Gene Structure of MMDL1 and MMDL2
Analysis of the Arabidopsis genome sequence identified two genes that showed high
levels of similarity to MMD1 and MS1 and contain a PHD domain at their C-termini. The two
genes were named Male Meiocyte Death like-1 (At1g33420) and Male Meiocyte Death like- 2
(At2g01810). The predicted gene models MMDL1 and MMDL2 suggested that they each consist
of 3 exons and 2 introns (Figure 4.1A). In order to confirm the gene models for MMDL1 and
MMDL2 cDNAs were isolated and sequenced. The sequenced cDNAs matched perfectly with
the predicted gene structure. The predicted protein sequences of MMDL1 and MMDL2 were
compared to MMD1 (17), MS1(20) and several other predicted MMD-like proteins from other
plant species using CLUSTAL W software. MMDL1 is most similar to MS1 while MMDL2 is
most similar to MMD1 (Figure 4.1B). Comparison of the PHD domains from the four
Arabidopsis proteins indicated that they are conserved at the C-termini of the proteins.
The expression profiles of MMDL1 and MMDL2 were examined by analyzing publicly
available expression databases. Transcripts for MMDL1 are present throughout the plant with the
anther abscission zone, seed and shoot apex showing relatively high levels of transcript. The
highest transcript levels are observed in the seed with the embryo, endosperm and seed coat all
showing high levels if expression. The highest overall levels were observed in the suspensor. In
contrast MMDL2 levels are low throughout the plant with the exception of sperm cells, which
show very high levels of expression (Figure 4.2).
119
Figure 4.1 A. Gene Structure of AtMMDL1 and AtMMDL2 Genomic organization and
T-DNA insertion sites in Arabidopsis MMDL-1 and MMDL-2. Primer sets used for genotyping
of AtMMDL-1 (469, 470 and LBb1.3 for Atmmdl1-1; 1434, 1435 and LBb1.3 for Atmmdl1-2)
and AtMMDL2 (1127, 1216 and LBb1.3 for Atmmdl2-1 and Atmmdl2-1) T-DNA insertion sites
are shown.
B. Basic alignment of PHD containing MMD-like proteins. C. Phylogenetic analysis of MMD-like genes
in different species using Vector NTI is showing that MMD1 and MMDL2 MS1 are more closely related
as are MS1 and MMD-1
120
Figure 4.2 MMDL1 is expressed throughout the plant with highest expression in the seed. MMD-L2
is highly expressed in sperm cells
Characterization of MMDL1 and MMDL2 expression analyzed by Genevestigator V3. MMDL2 is
expressed at high levels in sperm cells with very low expression elsewhere. MMD-L1 is expressed
throughout the plant with the seed suspensor showing the highest expression .
4.4.2 Plants heterozygous for MMDL1 and MMDL2 mutations show reduced
fertility
121
In order to investigate the roles of AtMMDL1 and AtMMDL2 and determine if they are required
for reproduction, we characterized T-DNA insertion lines that were available in the Arabidopsis
Stock Center. Two lines were characterized for AtMMDL1 (Atmmdl1-1 and Atmmdl1-2, Figure
1B) and for AtMMDL2 (Atmmdl2-1 and Atmmdl2-2 Figure 1B). All lines received from
Arabidopsis Stock Center were homozygous for the T-DNA insertions. Plants homozygous for
the individual T-DNA insertion lines displayed normal vegetative growth, development and
fertility when compared with wild type Columbia plants. MMDL1 and MMDL2 share 48%
amino acid similarity, raising the possibility that the genes share overlapping functions.
Therefore, crossing experiments were conducted with the different mmdl1 and mmdl2 alleles.
During these experiments it was discovered that plants double heterozygous for mutatins in the
two genes showed reduced fertility defects. Wildtype backcrossing experiments were then
conducted to determine if single heterozygous plants also showed a phenotype.
Interestingly heterozygous mutant Mmdl1-1+/-, Mmdl2-1+/- and Mmdl2-2+/- plants all
display reduced fertility, with all of the lines displaying very short siliques. However, the
fertility defects is are relatively low in Mmdl1-2+/- plants. Average seed set/silique for the lines
are shown in Table 4.1.
Anthers of Atmmdl1-1+/- plants contain 30% aborted pollens (n=15) appearing green and
shriveled when analyzed by Alexander stain (Figure 2B). Analysis of seed development in
Atmmdl2-1+/- and Atmmdl2-2+/- plants revealed that 50% of the ovules abort prior to fertilization.
Tetrad analysis on each of the heterozygous lines revealed that anthers contained essentially all
normal tetrads, suggesting that, the problem is likely not with meiosis but with the pollen
development. Future studies to specifically analyze pollen development are underway to
determine the actual cause of the abnormality.
122
Figure 4.3 (I) Thirty day- old wild type: I (A), Atmmdl1-1-/- (B), Atmmdl2-2-/-(C) and AtMmdl22+/-(D) seedlings.
II. Silique dissection of plants homozygous mutants for either single mutation have no visible
phenotype. In contrast Mmdl2-2+/- and Mmdl1-1+/- had shorter siliques and reduced fertility.
Arrowheads highlight the pattern of silique development.
III. Expression levels of MMDL1 and MMDL2 studied by real-time PCR. Knocking out of
MMDL1 reduces the expression of MMDL2. Knocking out of MMDL2 reduces the expression of
MMDL1 when compared to wild type meiocytes.
123
Figure 4.4 Alexander staining showing viable (red) and aborted (green) pollen.
124
4.4.3 Double homozygous Atmmdl1mmdl2 plants are lethal
Interestingly mmdl1+/- mmdl2+/-
plants displayed 50% reduced fertility. We were unable to
identify mmdl1+/-mmdl2-/- and mmdl1-/-mmdl2-/- double homozygous plants from double
heterozygous viable progenies. Over 200 plants were analyzed from the progeny of mmdl1-/mmdl2+/- plants. Theoretically 50% of the plants should be double homozygous; however we
could not identify any double homozygous mmdl1mmdl2 plants. Interestingly 100% of the
progeny from mmdl1-2-/-mmdl2-2+/- plants showed the mmdl1-/-mmdl2+/- genotype when
analyzed by PCR. This phenomenon where the parent plant is not segregating and the progenies
are maternal clones, is termed as apomeiosis/apomixis. This phenomenon is quite complicated
and further research is necessary to understand the cause of the apparent apomixis.
When the pollen of mmdl1-2-/-mmdl2-2+/- plants was studied by Alexander staining, none
of the anther locules showed shrunken and shriveled pollen, which suggests that the pollen
lethality is recovered in mmdl1-2-/-mmdl2-2+/- plants with respect to mmdl2+/- plants. Genotyping
also failed to identify mmdl1+/-mmdl2-/- plants, suggesting that the phenotype is also lethal. A
real-time PCR on mmdl1-/-Mmdl2
+/-
plants may help us better understand why the mmdl1+/-
mmdl2-/- genotype is lethal.
125
I.
II.
Figure 4.5 I) Alexander staining showing the pollen abortion rescued by dosage effect. II) The graph
shows the percentage of pollen abortion.
4.4.4 Transmission through female gametophytes is dramatically reduced in
mmdl1-2-/-Mmdl2-2+/- plants
126
To investigate the transmission of the mutations we crossed mmdl1-2-/-mmdl2-2+/- female plants
with wild type pollen and the seeds were collected and grown to further analyze the genotype of
the progeny.
The passage of the mmd2-2 through the female gametophyte is lower than
predicted. Out of 14 plants analyzed, 10 plants were wild type for MMDL2 and 4 plants were
mmdl2-2+/-. This shows that the mutation is transferred at a reduced level through the female
side. Reciprocal crossing to investigate which side is affected was also conducted. Figure 4.6
shows that the mmdl2-2 mutation affects embryo development when it is on the female side
compared to the male side, which suggests that MMDL2 is important for female gametophyte
development.
A
B
C
D
Figure 4.6 A: Siliques are shown from a MMD-L2-2+/- plant crossed with wild type pollen; B:
Silique of a wild type plant crossed with MMD-L2-2+/- pollen; C: Silique of an MMD-L2-1+/plant crossed with wild type pollen; D: silique of a wild type plant crossed with MMD-L2-1+/pollen.
Table 4.1: Table showing percentage of ovule abortion is increased through the female side of
both Mmdl1+/- and Mmdl2+/-.
127
Table 4.2 Table showing percentage of ovule abortion in different double heterozygous lines.
4.4.5 Embryo development is abnormal in MMDL2 heterozygous mutants
The siliques of Atmmdl2-2+/- plants contain approximately 50% aborted seed (n= 2400),
suggesting defects in embryo and/or endosperm development.
In order to investigate this
possibility we examined cleared seeds in siliques of self-fertilized Atmmdl2-2+/- plants and found
that in 54% of the seeds no trace of an embryo could be identified, but the endosperm had
developed to some extent (Figure 4.7).
128
Figure 4.7 Proper levels of MMDL2 is essential for embryo development
(A) Two cell stage, (B) eight cell stage, (C) dermatogen, (D) early globular stage, (E) late
globular stage, (F) early heart stage in wild type embryo development.
(H-J): No embryo development is observed in aborted seed. The endosperm is however
somewhat developed.
4.4.6 35S 2GRNAi in mmdl1-2-/-Mmdl2-2+/- plant shows minor defects in
pollen meiosis, but no defect in pollen development.
After observing that the mmdl1-/-mmdl2-/- and mmdl1+/-mmdl2-/-, genotypes result in lethality we
conducted an MMDL2 RNAi experiment to knock-down MMDL2 expression instead of
completely knocking it out. To do this, we chose to express the MMDL2 RNAi from the 35S
promoter, which is expressed at high levels in most tissues of Arabidopsis plants. The restriction
129
enzymes used to generate the RNAi construct were Nco1 and Asc1for the first insertion,
followed Xba1and Pac1 for the second insertion. The 35S-MMDL2-RNAi construct was
transformed into mmdl1-/-mmdl2+/- plants and Basta resistant plants were identified in the T1
generation. Only three plants were identified and one of the Basta resistant plants showed
reduced fertility. But the subsequent generation from the reduced fertile plant did not display any
reduced fertility.
Figure 4.8 Construct is shown 35S promoter and restriction sites for enzyme cleavage in our
pFGC plasmid.
In order to investigate if there are any abnormalities in pollen meiosis in 35SMMDL2RNAi
Atmmdl1+/-mmdl2-/- plants we analyzed DAPI (4', 6-diamidino-2-phenylindole) stained meiotic
chromosomes. No obvious alterations were observed during early stages of meiosis. In wild type
plants chromosomes condense as fine thin threads during leptotene, (Figure 4.9 A, E), and
homologous chromosomes undergo co-alignment and pairing during zygotene (Figure 4.9 B, F).
During pachytene homologous chromosomes are fully synapsed (Figure 4.9 C). Desynapsis
occurs during diplotene (Figure 4.9 D) with five bivalents appearing at diakinesis (Figure 4.9 I).
During metaphase I the bivalents align on the equatorial plane (Figure 4.9 J). Segregation of
homologous chromosomes and then sister chromatids at anaphase I and anaphase II,
respectively, results in the presence of four sets of five individual chromosomes at the cell poles
by telophase II (Figures 4.9 K, L and Q, R).
130
No obvious alterations were observed during early stages of meiosis in 35S-MMDL2RNAi Atmmdl1-/-mmdl2+/- plants. Chromosomes condensed and paired normally during leptotene
(Figure 4.9 F), pachytene (Figure 4.9 G). However, alterations were observed starting at
diakinesis when we observed a large percentage (70%) of diakinesis staged cells do not
desynapse properly (Figure 4.9 I). Typically diakinesis is a relatively short stage with many more
pachytene cells observed compared to diakinesis cells in wild type meiocytes. However, in the
RNAi lines many more diakinesis cells were observed compared to any other stage. During
metaphase I bivalents were not resolved on the equatorial plane and instead were often
interwined. Defects were then observed in the segregation of homologs in anaphase I and
chromosome bridges and lagging chromosomes were observed by late anaphase I and telophase I
in some meiocytes. In some cells “sticky” chromosomes were observed at metaphase II (Figure
4.9 R) and chromosomes/chromosome fragments were observed scattered in a small number of
anaphase II and telophase II cells (Figure 4.9 S), which gives rise to polyad formation (Figure
4.9 T).
131
Figure 4.9 MMDL2 RNAi plants exhibit defects during male meiosis. (K-T) Wild-type
male meiosis. (A-J) MMDL-2RNAi male meiosis. (A,K) leptotene; (B,L) pachytene; (C,M)
diplotene; (D,N) diakinesis; (E,O) metaphase I; (F,P) anaphase I; (G,Q) telophase I; (H,R)
metaphase II; (I,S) anaphase II; (T) tetrad in wild type. Note the improperly condensed and
resolved chromosomes in diakinesis staged MMDL2 RNAi meiocytes. Metaphase I bivalent
chromosomes are not resolved on the equatorial plane. Arrow indicates fragmented chromosome
(FC). Defects identified in sister chromatid separation in anaphase I and FC indicated by arrow
(P). Chromosomes are sticky in metaphase II and not resolved properly indicated by an arrow.
Anaphase II stage shows FC and some are lying on the organelle band which is abnormal. (J)
Polyad showing 5 microspores of different size and shape.
4.4.7 DMC1 MMDL2 RNAi in WT plants mimics the pollen abortion as in
Atmmdl2+/- heterozygous plants
As MMDL2 is expressed highly in sperm cells, we decided to generate a second MMDL2 RNAi
construct in which the RNAi is expressed from a meiosis-specific promoter. The DMC1
promoter was swapped into the previously described pFGC5941 plasmid using the restriction
enzymes NcoI and PacI. The RNAi was transformed into both wild type and Atmmdl1-/-mmdl2+/plants. Ten Basta 10 resistant plants were obtained in the wild type background and 50% of
those plants showed reduced fertility. Expression of the DMC1-MMDL2-RNAi in a wild type
background resulted in a severe pollen abortion phenotype similar to that observed in AtMmdl2+/heterozygous plants. However, remarkably when the DMC1-MMDL2-RNAi is present in
Atmmdl1-/-mmdl2+/- plants, it is able to rescue the seed abortion phenotype typically found in
these plants. We analyzed tetrads in DMC1-MMDL2-RNAi wild type plants and no obvious
abnormalities were observed, which suggests no pre-meiotic defects. Future studies including
sectioning of the anthers to examine pollen and anther cell development will provide insights
into the alterations.
I
132
.
.II.
Figure 4.10 I) The construct is shown DMC1 promoter and restriction sites for enzyme cleavage
in our pFGC plasmid. II)
Alexander staining showing normal level pollens in
DMC1MMDL2RNAi transformed in mmdl1-2-/-Mmdl2-2+/- plants and pollen abortion in
DMC1MMDL2RNAi transformed in wild type plants.
4.4.8 MMD1 PHD finger is capable of binding histone H2A
We have previously shown that AtMMD1 is an important gene for male meiosis. Several, recent
studies have shown that PHD finger proteins, including YNG1, NURF and ING2, are able to
133
bind modified histones (29, 30). In order to investigate the possibility that the MMD1-PHD may
be a histone binding motif we constructed a recombinant MMD1PHD-MBP (Maltose binding
protein) plasmid, over-expressed the protein in E.coli and purified the protein through amylose
resin affinity chromatography. The MBP tag helps solubilize a recombinant protein to solubilize
and we were able to purify 140-160 mg of MMD1-PHDMBP fusion protein per litre of Luria
Broth media.
To investigate if the PHD finger of AtMMD1 binds histones, MMD1PHD-MBP was produced,
purified and bound to the amylose affinity column. As a negative control, we used the
Arabidopsis ETHE1 fused with MBP tag to make a second affinity column. A total histone
preparation from calf liver was passed over the MMD1-PHD affinity column, washed and then
the column was eluted with elution buffer. The purified eluted protein was then run on a SDS
protein gel (Figure 4.12). Bands were excised and analyzed by MALDI. A band, which was
eluted from the MMD-PHD column, but not the ETHE1 column was identified as histone 2A.
The identity of the histone H2A band was confirmed with western blot (Figure 4.12) and
MALDI (data not shown).
134
Figure 4.12 A) MMD1PHD domain cloned into MBP vector which is soluble and affinity
purified. Thrombin site is present in the construct to remove the MBP tag from the protein.
B) MBP-PHD fractions eluted from amylose affinity column
C) Cleavage of MBP from PHD-MBP: first lane showing purified MBP-PHD protein, second
lane is the broad range protein marker and purified MMD1-PHD (lane 1) was treated with
thrombin at room temperature for 24 hours. Digestion stopped by adding 2mM PMSF.
135
Figure 4.12 MMD1-PHD finger proteins binds histone H2A. Coomassie-blue stain of maltose
binding protein (MBP)–PHD and ETHE1-MBP pull downs
incubated with calf thymus
histones. B) Coomassie-blue staining of MBP-PHD with histone and without histone C) Western
blot analysis of MBP-PHD pull-down assays with using Histone H2A antibody. The H2A was
also confirmed by MALDI. (data not shown).
4.5 Discussion
4.5.1 Phenotypic analysis and expression pattern of MMD like genes
Numerous Arabidopsis meiotic mutants have been studied, but very little is known about the
regulation of meiosis in plants. The characterization of the male meiocyte death1 (mmd1) mutant
in which male meiocytes undergo apoptosis during prophase I was previously reported (17).
MMD1 is a PHD containing protein. In addition to MMD1 there are three other MMD-like genes
in Arabidopsis, which also contain PHD fingers. MS1 (male sterility 1) is required for pollen
development and appears to be a transcription factor (24). Data presented here show that
homozygous Atmmdl1-/- and Atmmdl2-/- plants resemble normal wild type (Col) plants, while
heterozygous AtMmdl1+/- and AtMmdl2+/- plants show reduced male and female fertility. This
phenomenon is remarkable and to our knowledge the first instance where a heterozygous mutant
show reduced fertility while the homozygous mutant is completely normal. This suggests that
there may be dosage effect for the phenotype we are experiencing. To test this possibility of a
dosage effect, we created transgenic plants that express MMDL2-RNAi from a 35S constitutive
promoter or the meiosis specific DMC1 promoter in either the wild type or Atmmdl1-/-Mmdl2+/backgrounds. Consistent with the possibility that reproduction is sensitive to MMDL2 levels
expression of DMC1-MMDL2-RNAi in wild type plants results in reduced fertility. Pollen
abortion ranges from 28% to 45% (n=800). This mimics the phenotype of AtMmdl2+/- plants and
provides evidence that the phenotype we observe is because of a dosage effect. Analysis of
mRNA levels in the RNAi plants are necessary to determine if this is a direct effect of MMDL2
reduction or if other genes are also affected. Interestingly, the ovule abortion in Atmmdl1-/Mmdl2+/- is rescued in DMC1-MMDL2-RNAi in mmdl1-/-Mmdl2+/- plants.
4.5.2 MMD like genes may encode a PHD finger transcription factor
136
MMDL1 and MMDL2 show significant homology to the previously identified genes MS1 (24)
and MMD1 (17) in the Arabidopsis genome. All the above mentioned genes contain a PHD
domain. PHD domains have a Cys4-His-Cys3 sequence that coordinates with two zinc ions (2).
Studies in yeast and animals reveals that the PHD -finger is found in histone methyltransferases,
histone acetyltransferases, chromatin binding and DNA binding proteins (2).
The PHD finger protein in animals is essential for tumorigenesis, DNA repair and DNA
recombination (31). Recently, it has been implicated that the zinc finger structural fold in PHD
domain can read histone states in a sequence dependent manner which is regulated by the
methylation state of arginine and lysine (29, 30, 32-34).
4.5.4 MMD1-PHD binds to histone H2A
Pull down assays, MALDI analysis and Western blotting showed that MMD1-PHD can
bind histone H2A. Histones are the proteins that help chromosomal DNA package into the
nucleosomes. Not much knowledge is known about H2A modifications. However, some
modifications like Serine phosphorylation has been found in histone H2A (35). There are also
instances of modified histone H2A variants. For instance, the variant H2AX was found to be
essential for DNA repair (36). DNA repair is accompanied by phosphorylation of the H2AX Cterminus. Once the phosphorylated H2AX formed, the DNA repair process is being completed.
As our studies show that, MMD1-PHD can bind histone H2A. This raises the possibility that
MMD1 may be involved in chromatin remodelling and regulation of gene transcription.
4.5.5 What is the role of MMD-like genes?
Based on information available in expression databases, MMDL1 is expressed at high levels in
the suspensor of seed and MMDL2 is expressed in the sperm cell. Consistent with the fact that
the heterozygous mutation on each gene produces reduced fertile plants, a unique phenomenon
of dosage effect is implicated in this study. Analysis of tetrads suggest that the MMD like genes
are essential for pollen development but not meiosis. Therefore a particular dosage effect could
come into play, which triggers the pathway for pollen and ovule development. So, if there is
100% mRNA transcript level or fully knockout/null gene, then the pathway for pollen
development is normal, but if there is a significant change in the protein level, then the
development pathway for the pollen and ovule development stalled and shows severe
abnormalities and abortion.
137
Another aspect of these two MMD1 like genes are the double homozygous plants are not
viable and the Atmmdl1-2-/-Mmdl2-2+/- progenies appear to be maternal clones, i.e; all the
progeny have the same genotype as their parent. This phenomenon would be embraced by the
agriculture field as a way to produce F1 hybrid seed for higher yield. The final and most
important implication is the presence of PHD domain which raises the possibility, that it might
participate in chromatin remodelling events by regulating gene expression. These two genes
might be important for protein-protein or protein-DNA interactions.
4.6 References:
(1)
Schindler, U., Beckmann, H., and Cashmore, A. R. (1993) HAT3.1, a novel Arabidopsis
homeodomain protein containing a conserved cysteine-rich region. Plant J 4, 137-150.
(2)
Bienz, M. (2006) The PHD finger, a nuclear protein-interaction domain. Trends
Biochemical Sci 31, 35-40.
(3)
Trewick, S. C., McLaughlin, P. J., and Allshire, R. C. (2005) Methylation: lost in
hydroxylation? EMBO reports 6, 315-320.
(4)
Conti, E., Uy, M., Leighton, L., Blobel, G.N., and Kuriyan, J. (1998) Crystallographic
Analysis of the Recognition of a Nuclear Localization Signal by the Nuclear Import
Factor Karyopherin α. Cell 94, 193-204.
(5)
Pascual, J., Martinez-Yamout, M., Dyson, H. J., and Wright, P. E. (2000) Structure of the
PHD Zinc Finger from Human Williams-Beuren Syndrome Transcription Factor. J Mol
Biol 304, 723-729.
(6)
Bozhenok, L., Wade, P. A., and Varga―Weisz, P. (2002) WSTF ISWI chromatin
remodeling complex targets heterochromatic replication foci. The EMBO J 21, 22312241.
(7)
Gibbons, R., Bachoo, S., Picketts, D., Aftimos, S., Asenbauer, B., Bergoffen, J., Berry,
S., Dahl, N., Fryer, A., Keppler, K., Kurosawa, K., Levin, M., Masuno, M., Neri, G.,
Pierpont, M., Slaney, S., and Higgs, D. (1997) Mutations in transcriptional regulator
ATRX establish the functional significance of a PHD-like domain. Nat Genet 17, 146148.
(8)
Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T. L., Sechi, S., Qin, J., Zhou, S.,
Higgs, D., and Wang, W. (2003) The ATRX syndrome protein forms a chromatin138
remodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies.
Proc Natl Acad Sci 100, 10635-10640.
(9)
Lee, B., and Amon, A. (2001) Meiosis: how to create a specialized cell cycle. Curr Opin
Cell Biol 13, 770-777.
(10)
Roeder, G. (1997) Meiotic chromosomes: it takes two to tangle. Genes Dev 11, 26002621.
(11)
Roeder, G. S., and Bailis, J. M. (2000) The pachytene checkpoint. Trends Genet 16, 395403.
(12)
Edelmann, W., Cohen, P. E., Kane, M., Lau, K., Morrow, B., Bennett, S., Umar, A.,
Kunkel, T., Cattoretti, G., Chaganti, R., Pollard, J. W., Kolodner, R. D., and
Kucherlapati, R. (1996) Meiotic pachytene arrest in MLH1-deficient mice. Cell 85, 11251134.
(13)
Edelmann, W., Cohen, P., Kneitz, B., Winand, N., Lia, M., Heyer, J., Kolodner, R.,
Pollard, J., and Kucherlapati, R. (1999) Mammalian MutS homologue 5 is required for
chromosome pairing in meiosis,. Nat Genet 21, 123-127.
(14)
Pittman, D. L., Cobb, J., Schimenti, K. J., Wilson, L. A., Cooper, D. M., Brignull, E.,
Handel, M. A., and Schimenti, J. C. (1998) Meiotic prophase arrest with failure of
chromosome synapsis in mice deficient for Dmc1, a germline-specific RecA homolog.
Mol Cell 1, 697-705.
(15)
Ghabrial, A., and Schupbach, T. (1999) Activation of meiotic checkpoint regulates
translation of Gurken during Drosophilia oogenesis. Nat Cell Biol 1, 354-357.
(16)
Gartner, A., Milstein, S., Ahmed, S., Hodgkin, J., and Hengartner, M. (2000) A
conserved checkpoint pathway mediates DNA damage-induced apoptosis and cell cycle
arrest in C. elegans. Mol Cell 5, 435-443.
(17)
Yang, X., Makaroff, C. A., and Ma, H. (2003) The Arabidopsis male meiocyte death1
gene Is required for male meiosis and encodes a novel putative chromatin remodeling
factor. Plant Cell 15, 1281-1295.
(18)
Taylor, P. E., Glover, J. A., Lavithis, M., Craig, S., Singh, M. B., Knox, R. B., Dennis, E.
S., and Chaudhury, A. M. (1998) Genetic control of male fertility in Arabidopsis thaliana:
structural analyses of postmeiotic developmental mutants. Planta 205, 492-505.
139
(19)
Sanders, P. M., Bui, A. Q., Weterings, K., McIntire, K. N., Hsu, Y. C., Lee, P. Y.,
Truong, M. T., Beals, T. P., and Goldberg, R. B. (1999) Anther developmental defects in
Arabidopsis thaliana male-sterile mutants. Sex Plant Reprod 11, 297-322.
(20)
Mccormick, S. (1993) Male gametophyte development. Plant Cell 5, 1265-1275.
(21)
Chaudhury, A. M., Lavithis, M., Taylor, P. E., Craig, S., Singh, M. B., Signer, E. R.,
Knox, R. B., and Dennis, E. S. (1994) Genetic control of male fertility in Arabidopsis
thaliana : structural analysis of premeiotic developmental mutants. Sex Plant Reprod 7,
17-28.
(22)
Scott, R., Hodge, R., Paul, W., and Draper, J. (1991) The Molecular Biology of Anther
Differentiation. Plant Sci 80, 167-191.
(23)
Neuffer, M., Coe, E., and Wessler, S. (1997) Mutants of maize, pp 263-266., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor.
(24)
Wilson, Z., Morroll, S., Dawson, J., Swarup, R., and Tighe, P. (2001) The Arabidopsis
MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis,
with homology to the PHD-finger family of transcription factors. Plant J 28, 27-39.
(25)
Alexander, M. P. (1969) Differential staining of aborted and nonaborted pollen. Stain
Technol. 44, 117-22.
(26)
Vielle-Calzada, J. P., Baskar, R., and Grossniklaus, U. (2000) Delayed activation of the
paternal genome during seed development. . Nature 404, 91-94.
(27)
Herr, J. M., Jr. (1971) A New Clearing-Squash Technique for the Study of Ovule
Development in Angiosperms. American Journal of Botany 58, 785-790.
(28)
Ross, K. J., Fransz, P., and Jones, G. H. (1996) A light microscopic atlas of meiosis in
Arabidopsis thaliana. Chromosome Res 4, 507-516.
(29)
Li, H. T., Ilin, S., Wang, W. K., Duncan, E. M., Wysocka, J., Allis, C. D., and Patel, D. J.
(2006) Molecular basis for site-specific read-out of histone H3K4me3 by the BPTF PHD
finger of NURF. Nature 442, 91-95.
(30)
Shi, X. B., Hong, T., Walter, K. L., Ewalt, M., Michishita, E., Hung, T., Carney, D.,
Pena, P., Lan, F., Kaadige, M. R., Lacoste, N., Cayrou, C., Davrazou, F., Saha, A.,
Cairns, B. R., Ayer, D. E., Kutateladze, T. G., Shi, Y., Cote, J., Chua, K. F., and Gozani,
O. (2006) ING2 PHD domain links histone H3 lysine 4 methylation to active gene
repression. Nature 442, 96-99.
140
(31)
Aasland, R., Gibson, T., and Stewart, F. (1995) The PHD finger: implications for
chromatin-mediated transcriptional regulation. Trends in Biochem Sci 20, 50-59.
(32)
Wysocka, J., Swigut, T., Xiao, H., Milne, T. A., Kwon, S. Y., Landry, J., Kauer, M.,
Tackett, A. J., Chait, B. T., Badenhorst, P., Wu, C., and Allis, C. D. (2006) A PHD finger
of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature
442, 86-90.
(33)
Taverna, S. D., Ilin, S., Rogers, R. S., Tanny, J. C., Lavender, H., Li, H., Baker, L.,
Boyle, J., Blair, L. P., Chait, Brian T., Patel, D. J., Aitchison, J. D., Tackett, A. J., and
Allis, C. D. Yng1 PHD Finger Binding to H3 Trimethylated at K4 Promotes NuA3 HAT
Activity at K14 of H3 and Transcription at a Subset of Targeted ORFs. Mol Cell 24, 785796.
(34)
Matthews, J. M., Bhati, M., Lehtomaki, E., Mansfield, R. E., Cubeddu, L., and Mackay,
J. P. (2009) It Takes Two to Tango: The Structure and Function of LIM, RING, PHD and
MYND Domains. Current Pharmaceutical Design 15, 3681-3696.
(35)
Fink, M., Imholz, D., and Thoma, F. (2007) Contribution of the Serine 129 of Histone
H2A to Chromatin Structure. Mol Cell Biol 27, 3589-3600.
(36)
Jakob, B., Splinter, J. r., Conrad, S., Voss, K.-O., Zink, D., Durante, M., Labrich, M., and
Taucher-Scholz, G. DNA double-strand breaks in heterochromatin elicit fast repair
protein recruitment, histone H2AX phosphorylation and relocation to euchromatin.
Nucleic Acids Res 39, 6489-6499.
141
Chapter 5
142
Concluding Remarks
5.1 Arabidopsis WAPL is Essential for the Prophase Removal of
Cohesin During Meiosis
Wapl was first identified in Drosophila as a protein that can control heterochromatin
organization. Inactivation of Wapl causes the chromosomes to appear as parallel structures and
centromeric cohesion to be lost (1). Recent studies have characterized Wapl in several
organisms, including fly, fungi and vertebrates (2-4). Multiple sequence alignment of Wapl
proteins from different species show that it has a conserved C-terminus and divergent N-termini
which are important for Pds5 binding (2, 3).Wapl mutants exhibit different phenotypes in
different organisms, which suggests that we do not understand the exact function of Wapl.
Moreover, wapl defects have only been studied during mitosis and very little to nothing is
known how this protein functions during meiosis. It was therefore important to know the
function of Wapl in Arabidopsis thaliana.
Arabidopsis contains two copies of WAPL, unlike other organism which contain only a
single copy of the Wapl gene. In Chapter 2 we investigated the role(s) of the two WAPL genes in
Arabidopsis. Inactivation of each individual WAPL gene has no effect on vegetative and
reproductive growth, which suggests that the two genes share an overlapping function in
Arabidopsis. Double homozygous Atwapl1.1wapl2 plants grew slower than wild type and
exhibited a reduction in fertility, which results from defects in both male and female meiosis.
Root tip spreading showed defects in mitosis of Atwapl1.1wapl2 plants, but there was no obvious
difference between root growth when compared to wild type plants. A small percentage of root
tip cells, displayed altered mitotic structures including the presence of unresolved and sticky
chromosomes at metaphase, which in turn produce chromosome bridges, lagging chromosomes
and chromosome fragments at later stages. A real time PCR analysis showed that AtWAPL1
transcripts are not present in Atwapl1.1wapl2 plants but low levels of truncated AtWAPL2
transcripts are produced in Atwapl2 plants raising the possibility that a truncated, partially
functional version of AtWAPL2 may be produced. Further experiments are required to determine
143
if residual WAPL activity is present in the plants and determine if WAPL is in fact essential for
vegetative growth. It is not clear why WAPL does not appear to be essential in yeast and plants,
whereas it is essential in flies and vertebrates. Further investigation is needed to actually
decipher the role of the Wapl protein.
We showed that cohesin release is normal in somatic cells while in meiotic cells cohesin
release is delayed in wapl inactivated plants. “Sticky chromosomes” observed at the metaphase
I/ anaphase I transition displayed a strong SYN1/REC8 signal, while the SYN1 signal is
undetectable at late diakinesis and the beginning of prometaphase I in wild type meiocytes (5).
The majority of
Atwapl1.1wapl2 metaphase II chromosomes did not show SYN1 signal,
suggesting that arm-cohesin is ultimately removed at telophase I/metaphase II, probably by the
protease separase. The chromosome structure abnormalities what we observe in Atwapl1.1wapl2
meiosis resemble those caused by depletion of WAPL during mitosis in flies and vertebrates (6).
In both Drosophila and human cell lines depletion of Wapl blocks the removal of cohesin which
in turn produces poorly resolved chromosomes (1, 6). While in yeast Wpl/Rad61 does not play a
critical role in the removal of cohesin complexes during mitotic prophase but the steady state
cohesin level were found to be high (7, 8).
Previously it has been shown in Drosophila wapl neuroblasts, that the heterochromatic
chromosomes 4 and Y display a precocious loss of cohesion, while other chromosomes maintain
arm cohesion and arrest at prometaphase (1). In Chapter 2, we show that the majority of
Atwapl1.1wapl2 meiocytes contained more than the expected ten centromere signals at
metaphase I/anaphase I, which suggests that centromere cohesion is prematurely released even
though there was delayed removal of arm cohesion. The centromere signals were clustered
during prophase in Atwapl1.1wapl2 meiocytes, which suggests that Arabidopsis WAPL is
essential for heterochromatin dissociation. In flies and budding yeast Wapl is required for
heterochromatin organization and chromosome condensation respectively (1) which suggests
that WAPL plays a important role in controlling chromosome structure in several organisms.
144
5.2 WAPL antagonizes the role of Arabidopsis CTF7
We show in Chapter 3 that inactivation of WAPL suppresses the lethality associated with ctf7
mutations in Arabidopsis, which is similar to the situation in other organisms (8-12). Previously
it has been shown that inactivation of AtCTF7 results in embryo lethality (13); however,
homozygous ctf7 mutant plants can be obtained at a very low frequency (14). Vegetatively ctf7
plants exhibit severe developmental abnormalities and are dwarf. The ctf7 plants are sterile and
also display severe mitotic defects and premature dissociation of cohesin from meiotic
chromosomes, which in turn produces univalent chromosomes and premature separation of
chromosomes (14). Remarkably, plants, triple homozygous for the Atwapl1.1wapl2ctf7-1
mutations exhibit normal vegetative growth and development and produce 10-15 viable seed/
silique. The growth rate and overall size of Atwapl1.1wapl2ctf7-1 plants is same as wild type,
indicating that inactivation of WAPL suppresses most of the effects of CTF7 inactivation in
somatic cells. However, the overall fertility of Atwapl1.1wapl2ctf7-1 plants is similar to that
observed for Atwapl1.1wapl2Ctf7+/- plants, which is lower than Atwapl1.1wapl2 plants. Cohesin
immunolocalization using SYN1 antibody showed that cohesin release during anaphase is
somewhat recovered in wapl1wapl2ctf7-1 plants. Our
results demonstrate that WAPL is
important for the timely release of cohesin during meiosis and that inactivation of WAPL
eliminates the requirement for SMC3 acetylation by CTF7.
The removal of cohesin from meiotic chromosomes in Arabidopsis involves a prophase step,
which we show in Chapter 2 is dependent on WAPL. This suggests that the process may also be
dependant on the phosphorylation of SCC3. In higher eukaryotes Aurora B and Polo-like kinase
are important for cohesin removal during the prophase pathway (15). Further investigation is
required to test this hypothesis and determine if an Aurora B or Polo-like kinase is involved in
this process in Arabidopsis. Another cohesin subunit, which is present in Xenopus and Human, a
sororin ortholog does not appear to be present in the Arabidopsis genome, suggesting that
acetylation of SMC3 may solely interfere with WAPL binding to cohesin. However, it is also not
known for certain that Arabidopsis SMC3 is acetylated by CTF7. Further experiments are
necessary to test this hypothesis. Finally, five potential PDS5 orthologs are present in the
Arabidopsis genome, which may function with WAPL in cohesin maintenance and the control of
sister chromatid cohesion. Plants homozygous for mutations in PDS5-1, PDS5-2, PDS5-3,
PDS5-4, and PDS5-5 have no obvious fertility defects. Interestingly, pds5-1 plants showed an
145
abnormally small petiole development phenotype (De, Makaroff, unpublished). Double
homozygous plants for PDS5-3 and PDS5-4 display an early flowering phenotype which
suggests that these two genes might be important for transcription (De, Auman, Vargo and
Makaroff, unpublished). Plants double homozygous for PDS5-5 and PDS5-1 and triple
homozygous for PDS5-1, PDS5-3 and PDS5-5 show fertility defects (De, Auman, Vargo and
Makaroff, unpublished). Two RNAi constructs 35S-PDS5-2 RNAi and meiosis-specific DMC1
PDS5-2 RNAi were generated and transformed to wild type, single homozygous, double
homozygous and triple homozygous plants (De, Auman, Vargo, Fischer and Makaroff,
unpublished). Interestingly, only the 35S-PDS5-2 RNAi construct transformed in wild type
plants can survive after Basta treatment, and the other plants were lethal, which suggests that
PDS5 may have an overlapping function. The phenotype of DMC1-PDS5-2 RNAi plants is
currently being investigated. Therefore, the role of five putative PDS5 (PDS5-1, PDS5-2, PDS53, PDS5-4 and PDS5-5) orthologs in Arabidopsis still needs to be investigated further.
A model predicting how WAPL, CTF7 and PDS5 may interact in the maintenance and
removal of cohesin in Arabidopsis is shown in Figure 5.1.
Figure 5.1: Proposed model of prophase pathway in plants
Prior to DNA replication cohesin binds the chromatin in a reversible manner that is not able to
establish sister chromatid cohesion. Stable cohesin binding to the chromosomes and the
146
establishment of cohesion, which occurs during DNA replication, involves the inactivation of the
Wapl-dependent anti-establishment activity probably through the Ctf7-dependent acetylation of
critical lysine residues in SMC3. A sororin ortholog has not been detected in plants where
acetylation may directly inactivate the Wapl releasing activity and result in tight binding of
cohesin to the chromosomes.
5.3 MMDL-1 and MMDL-2 have overlapping functions which encodes a PHD
finger transcription factor
It has been previously shown that the Arabidopsis genome contains a gene MMD1, which
encodes a PHD finger protein. A mmd1 mutation triggers cell death during male meiosis (16). A
protein, MS1 that is similar to MMD1, was shown to control transcription and play a role in
anther development (16, 17). In Chapter 4 we present studies designed to characterize two
additional MMD1 and MS1 homologous genes, which contain PHD domains and might be
important for chromatin remodelling and regulation of gene transcription in Arabidopsis. The
homozygous mutants mmdl1-/- or mmdl2-/- resemble normal wild type (Col) plants, while
interestingly heterozygous Mmdl1+/- and Mmdl2+/- plants show reduced fertility both on the male
and female side. This phenomenon is quite rare. To our knowledge we are the first group to show
that heterozygous plants exhibit severe abnormalities in fertility, while the homozygous plants
resemble wild type. One possible explanation for this may be that a dosage effect exists for these
two genes. To test this possibility, we created constitutive 35S- and meiosis-specific DMC1
promoter-MMDL2 RNAi constructs and transformed wild type and Atmmdl1-/-Mmdl2+/- plants.
Introduction of the RNAi into wild type plants recapitulates the phenotype of Mmdl2+/-, while the
ovule abortion phenotype in Atmmdl1-/-Mmdl2+/- is rescued in DMC1-MMDL2-RNAi mmdl1-/Mmdl2+/- plants. Pollen abortion ranging from 28% to 45% is observed (n=800) in DMC1MMDL2-RNAi in wild type transformed plants. This suggests that the phenotype in AtMmdl2+/plants is due to a dosage effect. A tetrad analysis showed no abnormalities in tetrad formation,
which suggests that there is no problem in meiosis in DMC1-MMDL2-RNAi, but that the
problem may be post-meiotic. Future studies on pollen development and mRNA transcript
analysis of the RNAi plants may provide insights into the pollen lethality.
As previously mentioned MMDL1 and MMDL2 show significant homology to MS1 (17)
and MMD1 (16). All the above mentioned genes contain PHD domains which contain Cys4-His147
Cys3 sequences, and which are thought to coordinate with two zinc ions. Studies in yeast and
animals revealed that some PHD fingers are found in histone methyltransferases, histone
acetyltransferases, chromatin binding and DNA binding proteins (18). PHD finger proteins in
animals are essential for tumorigenesis, DNA repair and DNA recombination (19). Finally, in
Chapter 4 we show by pull down assay, MALDI analysis and western blotting that the MMD1PHD preferentially binds histone H2A. Future studies on these genes in Arabidopsis will provide
structural insights and help us to understand how PHD containing genes are involved in
chromatin remodelling and the regulation of gene transcription.
5.4 References
(1)
Verni, F., Gandhi, R., Goldberg, M. L., and Gatti, M. (2000) Genetic and Molecular
Analysis of wings apart-like (wapl), a Gene Controlling Heterochromatin Organization in
Drosophila melanogaster. Genetics 154, 1693-1710.
(2)
Ouyang, Z., Zheng, G., Song, J., Borek, D. M., Otwinowski, Z., Brautigam, C. A.,
Tomchick, D. R., Rankin, S., and Yu, H. Structure of the human cohesin inhibitor Wapl.
Proceedings of the National Academy of Sciences 110, 11355-11360.
(3)
Chatterjee, A., Zakian, S., Hu, X. W., and Singleton, M. R. (2013) Structural insights into
the regulation of cohesion establishment by Wpl1. Embo Journal 32, 677-687.
(4)
Cunningham, M. D., Gause, M., Cheng, Y. Z., Noyes, A., Dorsett, D., Kennison, J. A.,
and Kassis, J. A. (2012) Wapl antagonizes cohesin binding and promotes Polycombgroup silencing in Drosophila. Development 139, 4172-4179.
(5)
Cai, X., Dong, F. G., Edelmann, R. E., and Makaroff, C. A. (2003) The Arabidopsis
SYN1 cohesin protein is required for sister chromatid arm cohesion and homologous
chromosome pairing. J Cell Sci 116, 2999-3007.
(6)
Gandhi, R., Gillespie, P. J., and Hirano, T. (2006) Human Wapl Is a Cohesin-Binding
Protein that Promotes Sister-Chromatid Resolution in Mitotic Prophase. Current biology
: CB 16, 2406-2417.
(7)
Bernard, P., Schmidt, C. K., Vaur, S., Dheur, S., Drogat, J., Genier, S., Ekwall, K.,
Uhlmann, F., and Javerzat, J. P. (2008) Cell-cycle regulation of cohesin stability along
fission yeast chromosomes. Embo Journal 27, 111-121.
148
(8)
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009) Budding Yeast
Wpl1(Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing
Reaction. Current Biology 19, 492-497.
(9)
Ben-Shahar, T. R., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M., and Uhlmann,
F. (2008) Eco1-Dependent Cohesin Acetylation During Establishment of Sister
Chromatid Cohesion. Science 321, 563-566.
(10)
Rowland, B. D., Roig, M. B., Nishino, T., Kurze, A., Uluocak, P., Mishra, A., Beckouet,
F., Underwood, P., Metson, J., Imre, R., Mechtler, K., Katis, V. L., and Nasmyth, K.
(2009) Building Sister Chromatid Cohesion: Smc3 Acetylation Counteracts an
Antiestablishment Activity. Molecular Cell 33, 763-774.
(11)
Unal, E., Heidinger-Pauli, J. M., Kim, W., Guacci, V., Onn, I., Gygi, S. P., and Koshland,
D. E. (2008) A molecular determinant for the establishment of sister chromatid cohesion.
Science 321, 566-569.
(12)
Zhang, J. L., Shi, X. M., Li, Y. H., Kim, B. J., Jia, J. L., Huang, Z. W., Yang, T., Fu, X.
Y., Jung, S. Y., Wang, Y., Zhang, P. M., Kim, S. T., Pan, X. W., and Qin, J. (2008)
Acetylation of Smc3 by Eco1 is required for S phase sister chromatid cohesion in both
human and yeast. Molecular Cell 31, 143-151.
(13)
Jiang, L., Yuan, L., Xia, M., and Makaroff, C. A. (2010) Proper Levels of the
Arabidopsis Cohesion Establishment Factor CTF7 Are Essential for Embryo and
Megagametophyte, But Not Endosperm, Development. Plant Physiology 154, 820-832.
(14)
Bolaños-Villegas, P., Yang, X., Wang, H.-J., Juan, C.-T., Chuang, M.-H., Makaroff, C.
A., and Jauh, G.-Y. Arabidopsis CHROMOSOME TRANSMISSION FIDELITY 7
(AtCTF7/ECO1) is required for DNA repair, mitosis and meiosis. The Plant Journal, n/an/a.
(15)
Sumara, I., Vorlaufer, E., Stukenberg, P. T., Kelm, O., Redemann, N., Nigg, E. A., and
Peters, J.-M. (2002) The Dissociation of Cohesin from Chromosomes in Prophase Is
Regulated by Polo-like Kinase. Molecular Cell 9, 515-525.
(16)
Yang, X., Makaroff, C. A., and Ma, H. (2003) The Arabidopsis male meiocyte death1
gene Is required for male meiosis and encodes a novel putative chromatin remodeling
factor. Plant Cell 15, 1281-1295.
149
(17)
Wilson, Z., Morroll, S., Dawson, J., Swarup, R., and Tighe, P. (2001) The Arabidopsis
MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis,
with homology to the PHD-finger family of transcription factors. Plant J 28, 27-39.
(18)
Bienz, M. (2006) The PHD finger, a nuclear protein-interaction domain. Trends
Biochemical Sci 31, 35-40.
(19)
Aasland, R., Gibson, T., and Stewart, F. (1995) The PHD finger: implications for
chromatin-mediated transcriptional regulation. Trends in Biochem Sci 20, 50-59.
150