Download The qSD12 Locus Controls Offspring Tissue-Imposed

Copyright Ó 2008 by the Genetics Society of America
DOI: 10.1534/genetics.108.092007
The qSD12 Locus Controls Offspring Tissue-Imposed
Seed Dormancy in Rice
Xing-You Gu,*,1 E. Brent Turnipseed* and Michael E. Foley†
*Plant Science Department, South Dakota State University, Brookings, South Dakota 57007 and †Biosciences Research
Laboratory United States Department of Agriculture, Agricultural Research Service, Fargo, North Dakota 58105
Manuscript received May 28, 2008
Accepted for publication June 12, 2008
ABSTRACT
Seed component structures were grouped into maternal and offspring (embryo and endosperm) tissues to
characterize a dormancy quantitative trait locus (QTL) for tissue-specific function using a marker-assisted
genetic approach. The approach was devised to test if genotypic/allelic frequencies of a marker tightly linked
to the QTL deviate from Mendelian expectations in germinated and nongerminated subpopulations
derived from a segregation population of partially after-ripened seeds and was applied to the dormancy QTL
qSD12 and qSD7-1 in a nearly isogenic background of rice. Experimental results unambiguously demonstrated that qSD12 functions in the offspring tissue(s) and suggested that qSD7-1 may control dormancy
through the maternal tissues. These experiments also provide the first solid evidence that an offspring tissueimposed dormancy gene contributes to the segregation distortion in a mapping population developed from
partially after-ripened seeds and, in part, to the germination heterogeneity of seeds from hybrid plants.
Offspring and maternal tissue-imposed dormancy genes express in very early and late stages of the life cycle,
respectively, and interact to provide the species with complementary adaptation strategies. The qSD12 locus
was narrowed to the region of 600 kbp on a high-resolution map to facilitate cloning and marker-assisted
selection of the major dormancy gene.
S
EEDS are dormant under the conditions conducive
for germination because embryo emergence is
blocked by its surrounding structures (i.e., coat-imposed
dormancy) or repressed by inhibitory factors within the
embryo (i.e., embryo dormancy) (Bewley and Black
1994). Wild or weedy species developed these dormancy
mechanisms during evolution to enhance their survival
under adverse natural or in human-disturbed environments by selection for an optimum time to germinate.
In contrast, many crop species have lost part or all dormancy mechanisms due to the selections for rapid,
uniform germination during domestication and breeding activities (Harlan et al. 1973). Lack of seed dormancy
causes preharvest sprouting (PHS) in cereal crops
(Gubler et al. 2005). The variation in this adaptive or
domestication-related trait is controlled by multiple
genetic factors ( Johnson 1935), which are known as
quantitative trait loci (QTL). Many QTL for seed dormancy have been identified for crop and model plants
since the early 1990s (Anderson et al. 1993; Ullrich
et al. 1993; Lin et al. 1998; Alonso-Blanco et al. 2003).
These QTL are yet to be related to coat-imposed or
embryo dormancy to understand their underlying
mechanisms.
1
Corresponding author: Plant Science Department, South Dakota State
University, SNP248D, Box 2140C, Brookings, SD 57007.
E-mail: [email protected]
Genetics 179: 2263–2273 (August 2008)
Structures surrounding the embryo include endosperm, pericarp, and testa. Grass seeds are also covered
by a lemma and a palea (or hull). It has been difficult to
distinguish effects of individual component tissues on
seed dormancy. Researchers have resorted to excising
embryos and removing the hull or pericarp/testa tissues
from dormant seeds to infer coat-imposed or embryo
dormancy in barley (Romagosa et al. 1999), wild oats
(Simpson 1990; Foley 1992), rice (Takahashi 1963;
Seshu and Dadlani 1991), and wheat (Morris et al.
1989; Lan et al. 2005). The detected effects using a
somatic approach may be confounded with wounding,
inhibitor leaching, and other effects. A genetic approach, which is based on the difference in germinability between reciprocal hybrid F1 seeds, was also used to
infer dormancy types (Nair et al. 1965; Noll et al. 1982;
Seshu and Sorrells 1986; Flintham 2000). Reciprocal
difference detected by the genetic approach may be
difficult to attribute to a single locus if its genetic
background is unknown or when the parental lines
differ in multiple loci controlling seed dormancy.
Consequently, additional approaches are needed to
characterize QTL for dormancy types on the basis of
intact seeds in a known genetic background.
Seed dormancy, as a key adaptive trait in natural
populations, has not been related to segregation distortion, the phenomenon of selective advantage and
frequently reported for experimental populations from
2264
X.-Y. Gu, E. B. Turnipseed and M. E. Foley
TABLE 1
Genotypes for component tissues of seeds from plants heterozygous for a dormancy (D/d) locus tagged
by a codominant marker (M/m) and hypothesis tests for the allelic frequencies FD and Fd
Offspring tissues
Maternal tissue
(2n) genotypea
DM/dm (NGS)
Endosperm (3n)
Embryo (2n)
Hypothesis testing for embryo genotypes
in subpopulationsc
Genotype
Frqb
Genotype
Frqb
Germinated
Nongerminated
DM/DM/DM
DM/DM/dm
DM/dm/dm
dm/dm/dm
0.25
0.25
0.25
0.25
DM/DM
DM/dm
0.25
0.50
H0: FD ¼ Fd ¼ 0.50;
or HA: FD , 0.50
and Fd . 0.50
H0: FD ¼ Fd ¼ 0.50;
or HA: FD . 0.50
and Fd , 0.50
dm/dm
0.25
a
No genotypic segregation (NGS) for the tissues includes hull, pericarp, and testa; the letter n indicates the gametic number of
chromosomes; the D and M (or d and m) alleles are linked in coupling.
b
Expected genotypic frequencies for a population of fully after-ripened seeds.
c
The subpopulations are obtained by germinating partially after-ripened seeds; allelic frequencies FD and Fd are estimated on
the basis of marker genotypes for the embryos; and H0 or HA are null or alternative hypotheses.
distant crosses (Lyttle 1991; Taylor and Ingvarsson
2003). Segregation distortion refers to deviations of
allelic and genotypic frequencies from Mendelian
expectations in an experimental population. Biological
mechanisms for distorted segregations are explained
as preferential fertilization of male or female gametes
or zygotic difference in viability resulting from gene
or chromosomal mutations (Oka 1988; Lyttle 1991;
Taylor and Ingvarsson 2003). Segregation distortion
loci (SDL) were reported for all 12 chromosomes in rice
(Xu et al. 1997). Most of the SDL are related to gameophyte or zygote sterility genes contributing to interspecific or subspecific differentiations and the biological
bases for remaining SDL are uncertain (Oka 1988; Xu
et al. 1997). We observed segregation distortions in our
research on seed dormancy, which was characterized by
reduced germination rate. This preliminary observation
was made in a nearly isogenic background in which there
is no detectable reproductive barrier or viability problem.
Therefore, the observed segregation distortion may have
something to do with the dormancy QTL or partial
dormancy release.
Rice (Oryza sativa) is a model species for seed dormancy
research. More than 30 QTL associated with seed dormancy or PHShave been reported for cultivated (Lin et al.
1998; Dong et al. 2003; Guo et al. 2004; Wan et al. 2005,
2006), wild (Cai and Morishima 2000; Thomson et al.
2003; Lee et al. 2005; Li et al. 2006), and weedy (Gu et al.
2004) rice, but none of them has been associated with
seed component tissues. We introduced a set of dormancy
QTL alleles, including those at the qSD12 and qSD7-1 loci,
from weedy into cultivated rice (Gu et al. 2006a). The
qSD12 locus might have played a major role in rice
domestication and obviously harbors a key dormancy
gene that likely imparts resistance to PHS, because it
explained .50% of the phenotypic variance in the nearly
isogenic background and its effect on seed dormancy was
enhanced by relatively high temperatures during seed
development (Gu et al. 2006a,b). The objectives of this
research were (1) to develop a marker-assisted genetic
approach to characterize a QTL for maternal or offspring
tissue-imposed seed dormancy, (2) to determine the
relationship of the qSD12 dormancy QTL with segregation distortion, and (3) to develop a high-resolution
map for the qSD12 region to facilitate cloning, molecular characterization, and marker-assisted selection of
the major dormancy gene.
MATERIALS AND METHODS
Genetic assumptions: Seed structures are grouped into
maternal (2n) and offspring tissues, with the latter consisting
of triploid (3n) endosperm and diploid (2n) embryo (Table 1).
It is assumed that in a diploid species (1) a population of seeds is
harvested from plants heterozygous for the same selected
dormancy QTL region(s) and grown under the same conditions, and accordingly these seeds are identical for their
maternal tissue genotype and macro (between-plants) environmental variation in germination; (2) the dormancy locus (D/d)
completely or tightly links to a codominant marker (M/m), with
the D (M) and d (m) alleles derived from the dormant and
nondormant parents, respectively; (3) in the QTL region there
is no gametophytic/sporophytic sterility gene or other gene
resulting in preferential fertilization and zygotic selection; and
(4) the seeds are partially after-ripened (i.e., stored in warm, dry
conditions for given days) so that they can be divided into
germinated and nongerminated subpopulations by a germination experiment. In the above population, there is no segregation for the maternal genotype and there is an association
between endosperm and embryo genotypes due to the double
fertilization. Genotypic identification with the marker is much
easier for embryo than for endosperm tissues because the
embryonic genotype can be identified with the seedling tissue.
Therefore, hypothesis testing can be conducted on the basis of
segregation ratios or allelic frequencies for embryonic genotypes in the subpopulations (Table 1). There are three
possibilities for a dormancy gene to express in (1) only the
maternal tissue(s), (2) only the offspring tissue(s), and (3) both
the maternal and offspring tissues. If the QTL associates with
dormancy imposed by the maternal tissues (i.e., possibility 1),
the segregation ratio (DD:Dd:dd ¼ 1:2:1) or allelic (FD ¼ Fd ¼
Offspring Tissue-Imposed Seed Dormancy
0.50) frequencies of the embryos follow the Mendelian expectations in either of the subpopulations. If the QTL controls
dormancy imposed by the offspring tissues (i.e., possibility 2),
the segregation ratio or allelic frequencies would deviate from
the expectations. The deviation varies in magnitude with degree
of dormancy or germination rates (the lower the germination,
the higher the magnitude of deviation) and in the parental
direction between germinated (Fd . FD) and nongerminated
(FD . Fd) subpopulations (Table 1). If the QTL controls dormancy through the maternal and offspring tissues (i.e., possibility 3), the deviations due to the offspring tissue would be the
same as those for possibility 2, and the maternal effect on dormancy cannot be detected because of no genotypic segregation
for the covering tissues. Therefore, accepting the null (H0) and
rejecting the alternative (HA) hypotheses imply the QTL may control dormancy through the maternal tissue(s), and rejecting the
H0 and accepting the HA suggest involvement of the QTL in
offspring tissue-imposed dormancy. A partially after-ripening treatment may be used to manipulate the germination rate to better
test the hypotheses (Table 1). Tests for both germinated and
nongerminated subpopulations are necessary to verify if other
distortion factors, such as gamete preferential fertilization genes,
are present in the dormancy QTL region. A deviation due to a
distorter unrelated to germination would favor the same parent
in both the germinated and nongerminated subpopulations.
Plant materials and cultivation: This research started with
selection for the plant heterozygous for the qSD12 and qSD7-1
regions from the advanced backcross (BC4F3) population (Gu
et al. 2006a). The donor parent of the dormancy alleles at the
QTL is the weedy rice (O. sativa) accession SS18-2, originated
from Thailand and the recipient parent of the alleles is the
nondormant indica line EM93-1. The qSD12 and qSD7-1 QTL
peak positions are closest (,1 cM) to the markers RM270 and
RM5672, respectively, on chromosomes 12 and 7, respectively
(Gu et al. 2004, 2005). The genetic background of the selected
dihybrid is identical to EM93-1, which was checked with 150
markers that are relatively evenly distributed along the framework genetic map (Gu et al. 2004, 2006a). A preliminary experiment was conducted with a sample of seeds harvested from
the dihybrid plant. After 21 days of after-ripening (DAR) at
room temperature (25°), the seeds were germinated to
develop a segregation population for preliminary research.
Follow-up experiments focused on the qSD12 region. The
initial plant containing one copy of the weedy rice-derived
segment from RM3331 through RM235 (Figure 2B) was selected
from the BC4F4 population (Gu et al. 2006a). This monohybrid
plant was multiplied by a ratooning technique to increase seeds.
Seeds were harvested at 40 days after flowering and air-dried in a
greenhouse for 3 days. Dried seeds were partially after-ripened at
room temperature for 10, 20, and 30 days prior to germination.
Germinated seeds from each germination experiment were
collected as a germinated subpopulation and the seedlings
genotyped with RM3331, RM270, and RM235. Segregation ratios
of the markers from each subpopulation were used to test the
hypotheses (Table 1). Recombinants between the markers were
transplanted into 13-cm pots (one plant per pot) filled with a
mixture of clay and greenhouse medium to harvest seeds.
To narrow qSD12 and estimate its gene effects on germination, three recombinants (i.e., nos. 1–3 in Figure 2C), which
are different in length from the SS18-2-derived segments
containing the qSD12 peak position, were determined for seed
dormancy by progeny testing. Fully after-ripened seeds from
each recombinant were germinated to develop a progeny
population. Individual seedlings derived from recombinant
nos. 1 and 3 were genotyped with selected markers on the
introgression segments (Figure 2C). Plant cultivation and seed
harvest and drying were conducted as described above. Dried
seeds were stored at 20° to maintain the dormancy status.
2265
Because recombinant no. 3 has the shortest segment from
the weedy rice parent (Figure 2C), it was used to develop a
high-resolution map for the narrowed qSD12 region. In
addition, the two recombinant-derived homozygotes (refer
to the DD and dd genotypes in Figure 3B) were selected as the
isogenic lines for the dormancy (ILSD12DD ) and nondormancy
(ILSD12dd ) alleles, respectively. Furthermore, seeds from the
recombinant-derived heterozygous plants (refer to the Dd
genotype in Figure 3B) were bulked to develop a large
segregation population to test the hypotheses (Table 1).
Identification of seed dormancy and development of
germinated and nongerminated subpopulations: Seed dormancy was quantified by germination percentage. Seed samples were maintained at 25° for the given periods of time for
partial after-ripening. Fifty seeds were placed in a 9-cm petri
dish lined with Whatman no. 1 filter paper, wetted with 10-ml
deionized water, and then incubated at 30° and 100% relative
humidity in the dark. Germination was evaluated visually by
protrusion of the radicle or coleoptile from the hull by $3 mm
at day 7 or daily for a period of 10 days, depending on the
purpose of the experiment. Three replications were used for a
germination experiment.
To prepare segregation populations for hypothesis testing,
germinated seeds were transferred to large containers lined
with three layers of moist germination paper and maintained
at room temperature in the light for 10 days. Seedlings
collected from one germination experiment were grouped as
a germinated subpopulation. The seeds not germinated after 7 days of incubation were collected and air-dried in a
greenhouse for .60 days to break dormancy. These dried
seeds were sterilized with 50% bleach for 15 min, rinsed with
running water for 30 min, and then incubated at 30° and 100%
relative humidity in the light to promote germination (about
90%). Germinated seeds from the second incubation were
transferred to the same conditions as the above germinated
subpopulation and the seedlings grouped as a nongerminated
subpopulation.
Marker development and genotypic identification: To delimit the initial introgression segment, 34 rice microsatellite
(RM) markers between RM309 and RM17 on chromosome 12
(McCouch et al. 2002) were screened for polymorphism
between EM93-1 and SS18-2. Polymorphic markers were used
to genotype the initial plant and then aligned against the
Nipponbare (a japonica variety of rice) genome sequence
(International Rice Genome Sequencing Project 2005)
to physically delimit the introgression segments. RM270 was
the marker nearest to the qSD12 QTL peak position (Gu et al.
2004) and its primers were designed on the basis of the cDNA
sequence from an indica variety of rice (Temnykh et al. 2001).
Unfortunately, RM270 was unable to be positioned on the
japonica genome ( J. Ni, personal communication). Therefore,
polymorphic markers on the introgression segment were used
to genotype available DNA samples from the population of 204
BC1 (EM93-1//EM93-1/SS18-2) plants (Gu et al. 2005) and
RM270 was positioned on the basis of its genetic distances to
the flanking markers estimated using MAPMAKER/EXP 3.0
(Lincoln et al. 1992).
Forty-five additional RM markers were developed to construct a high-resolution map for the narrowed qSD12 interval
between RM5479 and RM6123. The primers were designed to
target the same simple sequence repeats as those for the rice
RM markers on the Gramene Oryza sativa japonica MapView
(http://www.gramene.org) using the Primer3 software (Rozen
and Skaletsky 2000). The new primers were used to amplify
the same RM markers because the estimated sizes of PCR
products (231 6 43 bp) fit our electrophoresis system better
than those (255 6 138 bp) amplified using the recommended
primers (http://www.gramene.org). Markers polymorphic be-
2266
X.-Y. Gu, E. B. Turnipseed and M. E. Foley
TABLE 2
Information about new polymorphic markers
Marker name
RM28595
RM28603
RM28607
RM28608
RM28621
RM28638
RM28642
RM28643
RM28645
RM28651
RM28652
RM28656
RM28659
RM28661
RM28662
RM28664
RM28665
RM28682
RM28683
Position (bp)
Size (bp)
Forward primer
Reverse primer
24557835
24683314
24766244
24767480
24942198
25069797
25121458
25124840
25167389
25243158
25276121
25352787
25392037
25430188
25435457
25442822
25455125
25737201
25747576
240
207
250
248
249
288
237
190
231
250
219
363
220
169
195
243
220
192
183
tacaacgcaccccatctgta
cattggactcacctggaagg
agaactagagagatgagaaaggaaag
tgtgtattagtttccatatggtcttca
cacagtcgaattgcaaagga
ccatcctgcctctagcatgt
agctgctgagaacacaatcg
tgggggttgtactcttctcc
gggcgccagtattagtgttg
cttcctggcttcaactctgg
aacaacattctctgcaattttcc
gcacacagtggaagtacgtttg
aaacgcatgcagaagaacct
acagtgactttggccgtgtt
ttggagctgattttggagtttt
gccttagcttctccctgctt
tgcagatggtgaggaagttg
tctccgagagggtacgtgtc
tgcgtggtgaattgtgattt
gcccaatcatcttgcatctt
caccaatctccgccattact
ggcagctcaaccctttcatag
actacaatatggggcggatg
gccaaaaggtcagggttaca
ctgaagagctgcgagaatcc
gtacctctccacccatcgac
ccgatgttgagacaaggtga
acgcagcatgtaggagaggt
cggaactgccgtttattcat
tctcaattgcactccatcca
tccgattataccattgtattcgtt
ccatcgaaagatgtgtggaa
cgcgtgttgtatggtttcac
gttttaaggcccccatcatt
tgggaagcagaagagtttttg
ctcaaggacgtgtggaacg
tctcctctgcatcacaatcaa
aagtccgtctccgtcttcg
Markers were designed to target the same simple sequence repeats (SSR) as those for the rice microsatellite
(RM) markers listed on the Gramene Oryza sativa japonica MapView at http://www.gramene.org/Oryza_sativa_
japonica/mapview?chr¼12.
tween EM93-1 and SS18-2 were screened (Table 2) and used to
saturate the target region.
Genomic DNA was prepared from a leaf segment from the
individual seedlings at 3 weeks. DNA extraction, PCR conditions, and PCR product display were conducted using the
methods of Gu et al. (2004).
Genetic and statistic analyses: Germination percentage (y)
for a sample was transformed by sin1(y)0.5 and the transformed values were averaged over three replications for
genetic analysis. For the population segregating for both
qSD12 and qSD7-1 regions, the Cockerham’s model (Kao and
Zeng 2002) was used to partition the genetic effect and
variance of the two loci into the additive (a), dominance (d),
and epistatic components. The two QTL were represented by
their tightly linked markers RM270 and RM5672, respectively,
in the linear model. Regression analysis was performed using
the SAS REG procedure with a stepwise selection set at a
significant level of 5% (SAS Institute 1999). For the population segregating only for the qSD12 region, the genic effects
(a and d) and their standard errors were estimated following
the single-locus model (Gu et al. 2006a). Significance of the
estimates was determined by a t-test.
Genotypic frequencies FDD, FDd, and Fdd were estimated as
proportions of the numbers of DD, Dd, and dd seedlings,
respectively, to the total number (N) of the subpopulation.
Fitness of an observed segregation ratio was determined by chisquare testing against the 1:2:1 monogenic expectation. The
allelic frequency FD or Fd was estimated as FDD 1 12 FDd or Fdd 1
1
0.5
2 FDd and the standard error calculated as (FD 3 Fd/N) . A
binomial test was used to determine fitness of the observed
allelic frequencies to the 0.50 expectation.
A slight but statistically not significant segregation distortion was observed with markers near the qSD12 region in the
BC1 population (Gu et al. 2004). The multipoint mapping
method (Vogl and Xu 2000) was applied to available marker
genotype data to map the SDL. The likelihood distribution
generated by multipoint mapping was compared with the
distribution of test statistics computed by simple interval
mapping (Tinker and Mather 1995) for the same chromosomal region to determine the positional relation between the
SDL and qSD12.
RESULTS
Difference in segregation ratio between the qSD12
and qSD7-1 regions: About 70% of seeds from the
dihybrid plant were germinated after 21 DAR. A population of 177 seedlings from the germinated seeds was
genotyped for the RM270 and RM5672 loci, which mark
the qSD12 and qSD7-1 QTL,respectively. Segregation
distortion was detected for RM270, with the allelic
frequencies FD or Fd being significantly lower or higher
than the expected 0.50; whereas, the segregation ratio for
three RM5672 genotypes fits the 1:2:1 expectation in the
germinated subpopulation (Figure 1A). These results
imply that there may be a genetic factor in the qSD12, but
not in the qSD7-1 region, that reduced the frequency for
the allele from the dormant parent. This factor could be
the dormancy gene according to the hypothesis (Table 1).
Plants in the dihybrid-derived population varied in
their degree of seed dormancy, as determined by the
distribution of germination for 21-days after-ripened
seeds. Genotypic differences in germination are much
larger for qSD12 than for qSD7-1 (Figure 1B). Both loci
consisted of gene additive and dominance effects,
and qSD12 and qSD7-1 accounted for 82 and 8% of
phenotypic variance, respectively (Table 3). Because
qSD12 and qSD7-1 both had significant effects on
Offspring Tissue-Imposed Seed Dormancy
2267
TABLE 3
2
Contributions (R ) of qSD12 and qSD7-1 component gene
effects to the phenotypic variation in germination of
seeds after-ripened for 21 days
Componenta
m
a1
d1
a2
d2
Effectb
0.60
0.42
0.15
0.11
0.10
6
6
6
6
6
0.012
0.018
0.024
0.017
0.023
Total
t-value Probability R 2 (%)
49.6
22.9
6.2
6.4
4.4
,0.0001
,0.0001
,0.0001
,0.0001
,0.0001
NA
78
4
6
2
90
a
m, mean of the model; a1 (d1) and a2 (d2), gene additive
(dominance) effects for qSD12 and qSD7-1, respectively, in the
population segregating only for the two QTL-containing regions (Figure 1).
b
Arc-sin square root transformed germination (mean 6
standard deviation). The minus sign indicates that the weedy
rice-derived alleles reduce germination or enhance seed dormancy.
Figure 1.—Genotypic frequencies (A) and differences in
germination (B) in a population segregating only for the
qSD12 and qSD7-1 QTL regions. Germination was evaluated
for individual plants with their seeds partially after-ripened
for 21 days. RM270 and RM5672 are markers tightly linked
to the loci qSD12 on chromosome 12 and qSD7-1 on chromosome 7, respectively. Italic letters DD, Dd, and dd indicate
three genotypes of plants for qSD12 or qSD7-1 in the population, with D and d representing the alleles from the dormant
and nondormant parents, respectively. N is the population
size, P is the x2-test probability for fitness of an observed
dd:Dd:DD ratio to the 1:2:1 expectation, and FD and Fd are
D and d allelic frequencies.
germination but differed in segregation distortion, we
suspected that these two loci may be involved in the
genetic control of offspring and maternal tissue-imposed seed dormancy, respectively.
An overwhelming majority (78%) of the genetic
variance in the above population was contributed by
the additive effect of qSD12 (Table 3). Because of its
association with segregation distortion and major effect,
we focused on the qSD12 QTL.
Fine mapping and genic effects of qSD12: Fourteen
of the 34 markers were polymorphic between EM93-1
and SS18-2 (Figure 2A) and located on the introgression
segment in the initial plant (Figure 2B). The introgression segment ranges from 2.71 to 5.50 Mbp according to
the physical positions of markers flanking the segment
ends. RM270, which marked the qSD12 peak in previous
experiments (Gu et al. 2004, 2005), was located between
RM5479 and RM6265 (Figure 2A), with distances to the
two markers being 5 and 0.5 cM, respectively, on the
basis of the BC1 population (Gu et al. 2005).
About 20 recombinants between the RM3331,
RM270, and RM235 loci were identified from germinated subpopulations derived from the initial plant
(Figure 2B). These recombinants were genotyped for
the 14 polymorphic markers to determine the length of
retained introgression segments. None of the recombinants was for the RM270–RM3739 or RM270–RM3739
regions. One recombinant (no. 3) for the RM5479–
RM6123 region was most likely derived from a twocrossover event (Figure 2C). Three recombinants (nos.
1, 2, and 3) with different lengths of the introgression
segments containing the qSD12 peak position (Figure
2C) were confirmed for seed dormancy by progeny
testing. Both recombinants nos. 1 and 3 are heterozygous for the introgression segment (Figure 2C) and
their progeny lines segregated for seed dormancy
(Figure 3, A and B). The qSD12 locus had no significant
dominance effect but displayed predominant additive
effects, which reduced the germination rate by 22 and
36% in the recombinants nos. 1- and 3-derived populations, respectively (Figure 3, A and B). Recombinant no.
2 is homozygous for the qSD12 dormancy allele (Figure
2C), and its progeny line had a much longer duration of
dormancy than the parental line EM93-1, which was
evaluated with the seeds from both lines grown under
the same (winter) conditions in a greenhouse (solid
lines in Figure 3C). It took 4 and 1 weeks of afterripening for the recombinant no. 2-derived line and
EM93-1 to reach 90% germination, respectively. The
above progeny tests confirmed the dormancy gene was
retained in all three recombinants, indicating the
location of qSD12 on an overlapped interval of ,1.69
Mbp between RM5479 and RM6123 (Figure 2C).
Seeds from the recombinant no. 3-derived homozygotes DD and dd (Figure 3B) were selected as the
putative isogenic lines ILSD12DD and ILSD12dd, respectively. One more generation of progeny testing conducted in the summer season confirmed that ILSD12DD
and ILSD12dd are homozygous for the wild and mutant
alleles, respectively, at the dormancy locus, as reflected
by their difference in the germination profile (dotted
2268
X.-Y. Gu, E. B. Turnipseed and M. E. Foley
Figure 2.—Partial physical maps (A
and D) for the qSD12 QTL region and
graphic representation of genotypes
for selected recombinants (B and C)
and isogenic line (E). Rice microsatellite (RM) markers are placed according
to their positions on the Nipponbare genome sequence for chromosome 12 excluding RM270 (dotted line), which is
placed on the basis of its linkage to
the flanking markers as its physical position was not determined. The arrow indicates the putative peak position of
qSD12. A solid horizontal bar depicts
an introgression segment from the weedy rice accession SS18-2 in the genetic
background of the cultivated rice line
EM93-1 (open bar), and a shaded bar
indicates that the segment was not determined for its origin from SS18-2 or
EM93-1; the letters DD and Dd indicate
the individuals homozygous and heterozygous, respectively, for the SS18-2-derived segment.
lines in Figure 3C). Comparing the germination data
collected from the aforementioned winter and summer
seasons, ILSD12dd was similar to EM93-1, while ILSD12DD
displayed longer dormancy duration than the recombi-
nant no. 2-derived line (Figure 3C). The difference
between the recombinant no. 2-derived line and ILSD12DD
could be attributed to environmental variation, because
the effect of qSD12 on dormancy was enhanced by
Figure 3.—Germination profiles of
the qSD12 (D/d) genotypes. (A) Distribution of the recombinant no. 1-derived
population (Figure 2C) for germination
of seeds after-ripened for 7 days. Number of plants is indicated in parentheses
after the genotypes DD, Dd, and dd. (B)
Cumulative germination of seeds afterripened for 10 days from recombinant
no. 3-derived plants (Figure 2C). (C)
Duration of seed dormancy for the lines
homozygous for qSD12 dormancy (solid
circle) and nondormancy (open circle)
alleles. The recipient parent EM93-1 was
used as the nondormant control for recombinant no. 2 derivatives. ILSD12DD
and ILSD12dd are isogenic lines selected
from recombinants no. 3-derived DD
and dd genotypes (Figure 3B), respectively. An asterisk (*) and the letters
‘‘ns’’ indicate the gene additive (a)
and dominance (d) effects were significant at a probability level of P , 0.01
and not significant, respectively. Solid
and dotted lines indicate the seeds harvested in winter and summer seasons,
respectively. Bars indicate means and
standard deviations of 10 plants.
Offspring Tissue-Imposed Seed Dormancy
2269
TABLE 4
Observed genotypic frequencies for the markers linked to the qSD12 locus in germinated subpopulations
DAR (%
germination rate)a
Number of seedlings for genotypec
Fitness test for dd:Dd:DD ¼ 1:2:1
Allelic
frequencyd
Markerb
dd
Dd
DD
Total
x2 value
Prob.
10 (35)
RM3331
RM270
RM235
91
100
92
111
106
110
22
18
21
224
224
223
42.5
60.7
45.3
0.0000
0.0000
0.0000
FD ¼ 0.32
Fd ¼ 0.68
20 (79)
RM3331
RM270
RM235
52
58
51
101
99
103
40
36
39
193
193
193
1.9
5.1
2.4
0.3844
0.0763
0.3061
FD ¼ 0.44
Fd ¼ 0.56
30 (92)
RM3331
RM270
RM235
58
60
51
122
124
126
52
48
55
232
232
232
0.9
2.3
1.9
0.6278
0.3096
0.3941
FD ¼ 0.47
Fd ¼ 0.53
a
Days of after-ripening (DAR) prior to the germination experiments.
RM270 is nearest to the qSD12 peak position, and RM3331 and RM235 are 1.3 Mbp away from the peak (Figure 2A).
c
D and d indicate the alleles derived from the dormant and nondormant parents, respectively.
d
FD or Fd are D or d allelic frequencies for RM270.
b
relatively high temperatures during the seed development
in the previous research (Gu et al. 2006b).
Of the 45 newly designed markers, 21 and 11 are
polymorphic between EM93-1 and SS18-2 and between
ILSD12dd and ILSD12DD, respectively (Figure 2, D and E).
With these new markers, the introgression segment
retained in ILSD12DD was located between RM28595 and
RM28656 and its physical length ranges from 593 to 795
kbp.
Association of qSD12 with offspring tissue-imposed
seed dormancy: The 10-, 20-, and 30-DAR treatments
resulted in 35, 79, and 92% germination (Table 4),
respectively, for seeds sampled from the initial plant
(Figure 2B). The germinated seeds were genotyped with
the relatively loosely linked markers RM3331, RM270,
and RM235 (Figure 2A). This experimental design
provided a set of subpopulations to examine relationships of segregation deviation with degrees of dormancy
and linkage strengths between markers and dormancy
QTL. As expected, segregation distortion occurred with
linked markers in the three subpopulations (Table 4).
The most significant deviation occurred at 10 DAR,
when the frequency of the nondormant parent-derived
allele (0.68) was twice as much as that of the nondormant parent-derived allele (0.32) at RM270 in the
germinated subpopulation. The derivations diminished
with increased (79 to 92%) germination following longer periods of after-ripening. The degree of deviation
was greater for RM270 than for RM3331 or RM235, as
quantified by the chi-square values (Table 4). This
quantitative variation with the linked markers coincides
with the distribution of test statistics (TS) for the QTL
mapping where RM270 had higher TS value than the
remaining markers (Gu et al. 2004, 2005).
The above results were verified with separate experiments. The first verification was made with a small sam-
ple of 60 seedlings from the nongerminated seeds
collected from the experiments reported in Table 4.
The observed segregation ratio (dd:Dd:DD ¼ 8:19:33)
strongly skewed to the dormant homozygote, with FD
and Fd equal to 0.71 and 0.29, respectively. The second
verification was made with a large population segregating for the greatly narrowed qSD12 region (,800 kbp,
refer to Figure 2E). These seeds were harvested from the
recombinant no. 3-derived heterozygotes (Dd in Figure
3B) and divided into germinated and nongerminated
subpopulations by a 21-DAR treatment. Similar to the
above observations, FD and Fd were significantly lower
and higher than 0.50, respectively, in the germinated
subpopulation of 860 seedlings or higher and lower
than 0.50, respectively, in the nongerminated subpopulation of 2738 seedlings (Figure 3). We also noted that
a distorted segregation was not present in the recombinant no. 1-derived population (Figure 3A), which was
developed from fully after-ripened seeds. The above
results strongly indicate that in the qSD12 linkage region
there is no ‘‘segregation distorter’’ other than the dormancy gene.
The last verification was conducted with seeds also
from a recombinant no. 3-derived heterozygote, but the
germination was conducted with seeds immediately
removed from the freezer. After 10 days of incubation,
the sample had a cumulative germination rate of 15%,
yielding 139 seedlings for marker genotyping. In this
germinated subpopulation, the allelic frequencies dramatically skewed to the allele from the nondormant
parent (Fd ¼ 0.81). More interestingly, the nondormancy allele preferentially distributed in the early (2–5
days of incubation) germinated seeds and the dormancy
allele was detected only in the seeds that required $5
days of incubation (Figure 4). In summary, the dormancy effect of qSD12 on its allelic segregation could be
2270
X.-Y. Gu, E. B. Turnipseed and M. E. Foley
Figure 4.—Frequency distributions of the qSD12 dormancy
(D) and nondormancy (d) alleles in germinated and nongerminated subpopulations of partially after-ripened seeds. The
seeds were bulked from heterozygous (Dd) plants in the recombinant no. 3-derived population (Figure 3B) and genotyped with the marker RM28621 (Figure 2D). The letter N
indicates the number of genotyped seedlings and an asterisk
(*) indicates a frequency significantly (P , 0.0001) deviated
from the Mendelian expectation (horizontal dashed line).
detected with both germinated and nongerminated
subpopulations of partially after-ripened seeds and with
the seeds germinated after different days of incubation.
DISCUSSION
The marker-assisted genetic approach: Seed dormancy is imposed by the maternal or offspring tissues,
or a combination of both. We demonstrated that the
marker-assisted approach (Table 1) could be used to
determine if a QTL is involved in the genetic control of
seed dormancy imposed by the maternal or offspring
tissues. This approach, which combines marker genotyping with after-ripening and germination techniques
and is based on segregation populations of a reasonable
size, could be a component of experiments for QTL
allele introgression, fine mapping, and map-based cloning (Han et al. 1999; Bentsink et al. 2006; Gu et al.
2006a). This marker-assisted approach is reliable and
valuable, because it is based on Mendel’s first law and
can be used to directly characterize a dormancy gene/
QTL for tissue-specific expression at a phenotypic level.
Among the factors affecting the efficacy of this approach
could be the phenotypic effect and genetic background
of the dormancy QTL and its linkage strength with
selected markers. Although this marker-assisted approach was devised for research on seed dormancy in
diploid rice, it can be extended to polyploidy species
that follow a diploid segregation (e.g., wheat) or modified for research on other seed traits (e.g., seed desiccation tolerance, longevity, and vigor). Because the
allelic frequencies in this research were estimated on
the basis of seedling (or embryo) genotypes, a statistically significant effect could arise from the same gene
Figure 5.—Frequency distribution of the qSD12 (D/d) genotypes for time of incubation required for onset of germination. Seeds were taken from a recombinant no. 3-derived
heterozygous (Dd) plant (Figure 3B) and germinated without
an after-ripening treatment. The letter N indicates the number of total seedlings genotyped for the marker RM28621
(Figure 2D), and the asterisk (*) indicates the frequency of
dormancy (FD) or nondormancy (Fd) allele significantly (P ,
0.0001) deviated from the expected 0.50.
expressed in the embryo, endosperm, or both tissues
due to the double fertilization. Therefore, other methods, such as the triploid genetic models for generation
mean or variance analysis (Mo 1988), could be applied
to the populations developed from nearly isogenic lines
to distinguish endosperm from embryo effects of the
dormancy QTL.
A series of observations (Figures 1 and 4–6) were
made to test the hypotheses (Table 1) and conclude that
qSD12 is involved in offspring tissue-imposed seed
dormancy. The qSD7-1 underlying gene appeared to
control seed dormancy through the maternal tissue(s)
because a distorted segregation was not detected for
embryo genotypes of the linked marker when the QTL
effect was significant in the preliminary observation
(Figure 1 and Table 3). We are conducting additional
experiments to verify the preliminary observation on
the basis of qSD7-1 isogenic lines (X. Gu and M. Foley,
unpublished data) and will test the remaining dormancy
QTL isolated from weedy rice using the same approach.
Seed dormancy gene-related segregation distortion:
Allelic differentiation at the QTL associated with offspring tissue-imposed dormancy may cause segregation
distortion in an experimental population. The dormancy gene-related distortion differs from the segregation distortion due to meiotic drive or zygotic selections
(Lyttle 1991; Taylor and Ingvarsson 2003), which
can be exemplified by the rice qSD12 and ga-13 loci on
the long arm of chromosome 12. The ga-13 locus was
identified as a gametophyte gene by distorted segregation for the linked isozyme gene Acp1 in the indica/
japonica cross (Rha et al. 1994). The Acp1 locus is located at
67 cM on the classical genetic map (http://www.shigen.
nig.ac.jp/rice/oryzabase/genes/symbolDetailAction.do?
Offspring Tissue-Imposed Seed Dormancy
Figure 6.—Distributions of likelihood for a segregation distortion locus (SDL) (A) and test statistics for the qSD12 dormancy QTL (B). Original data were obtained from the BC1
population (Gu et al. 2004). Only part of chromosome 12 is
shown and open circles on the horizontal axes indicate
marker positions. Seed dormancy was measured by germination of seeds at 1, 11, and 21 days after-ripening (DAR). Arrows indicate the SDL and qSD12 peak positions detected
using multipoint mapping (Vogl and Xu 2000) and simple
interval mapping (Tinker and Mather 1995) strategies, respectively. The observed segregation ratio for the RM270
marker and its fitness test are shown because it is nearest
the peaks, and the letters D and d represent the alleles from
the dormant and nondormant parents, respectively.
mutantGeneld¼966) and qSD12 is estimated at 97 cM on
the basis of its tightly linked marker RM6265 (Figure 2D)
based on the molecular genetic map (McCouch et al.
2002). The ga-13-caused distortion favored the indica
allele, the distortion pattern did not change across the
three environments, and the distortion is due to the
genotypic difference of male gametes in competition for
fertilization (Rha et al. 1994). In sharp contrast, the
qSD12-related segregation distortion favored the alleles
from the nondormant parent in the germinated populations and the dormant parent in the nongerminated
subpopulations across generations (Table 4, Figures 1A, 4,
and 5) and did not occur in the populations developed
from fully after-ripened seeds (Table 4, Figure 3A). In
addition, the distortion is due to the gene expressed in
offspring tissue(s) and functions in a bilateral way during
the period from seed maturation to germination to adapt
to environmental variations.
Similar to the segregation distortions due to other
factors, a dormancy gene-related distortion also has a
selective advantage in natural populations and a negative impact on linkage analysis. Dormancy distributes
2271
germination over a period of time with nondormant
genotypes germinating earlier than the dormant ones
in the soil seed bank. This germination distribution
pattern coincides with the allelic distribution for the
gene expressed in the offspring tissues, in that the
nondormancy (mutant) allele has a higher frequency in
the early germinating subpopulation and the dormancy
(wild) allele has a higher frequency in the later germinating subpopulation due to the segregation distortion
(Figure 4). Natural selection may favor less dormant
seeds that can germinate and complete their life cycle in
the next season, but favor more dormant seeds when
environmental conditions are adverse. Apparently, the
wild allele, together with its flanking chromosomal
segments, would have a greater chance than the mutant
allele to be present in the next generation in adverse
environments. An experimental population is generally
developed from germinated seeds. Segregation distortion in a population due to offspring tissue-imposed
dormancy genes might occur if the seeds had not been
fully after-ripened. This distortion is more likely in
populations from crosses between cultivated and wild
accessions, as the latter usually have strong seed dormancy and biases the estimation for parameters such as
genetic distance and effects. To avoid the negative
impact on map construction and QTL analysis, germination evaluation under controlled conditions is necessary to determine the degree of dormancy for seeds used
to develop the mapping population.
On the other hand, marker genotyping data may be
employed to assist with identification of a dormancy
QTL. The available genotyping data for the markers on
the long arm of chromosome 12 from the BC1 population (Gu et al. 2004) were analyzed with the multipoint
mapping method (Vogl and Xu 2000) to prove the
above hypothesis. The modulated peak of the segregation distortion locus (Figure 6A) was identical to the
qSD12 peak (Figure 6B), which was computed using
simple interval mapping software (Tinker and Mather
1995). We noted that the observed segregation ratio
for the two RM270 (on the peak positions) genotypes
(dd:Dd ¼ 84:72) skewed in favor of the nondormant
parent (dd), but this observation is not different from the
1:1 expectation (Figure 6A). This was because the mapping population was developed with hybrid seeds that
received different after-ripening or dormancy-breaking
treatments, such as hull removal, warm drying, and soaking overnight with running water, before germination.
Implications of an offspring tissue-imposed dormancy gene: The qSD12 QTL is the first naturally
occurring locus that has been physically finely mapped
and unambiguously determined to regulate offspring
tissue-imposed seed dormancy. Discovery of the character of qSD12 provides an additional insight into the
genetic system controlling the adaptive trait. A population of seeds is characterized by heterogeneity of germination, which refers to the within-sample variation in
2272
X.-Y. Gu, E. B. Turnipseed and M. E. Foley
onset of germination or termination of dormancy
(Bewley and Black 1994). This heterogeneity has
been a key characteristic confounding research on seed
dormancy (Bewley 1997) and little is known about its
genetic basis (Squire et al. 1997). The qSD12 data
(Figures 4 and 5) clearly demonstrated that genotypic
differences of the QTL alone contribute, in part, to the
germination heterogeneity in the population of seeds
from the hybrid plant. Outcrossing species are characterized by heterozygosity, resulting in segregation at loci
including dormancy genes in the next generation of
seed population. Therefore, germination heterogeneity
in a sample of seeds from the same plant or panicle
cannot be simply attributed to environmental variation
when the plant genotype is unknown.
A multigenic system, such as the weedy rice parent,
most likely consists of both offspring and maternal
tissue-imposed dormancy genes (Figure 1), which function in early and late stages of the life cycle, respectively.
In other words, the genes expressed in offspring tissues
have an immediate dormancy effect on the seeds; while
the genes expressed in maternal tissues have a dormancy effect on the seeds belonging to the following
generation. In field conditions, outcrossing or gene
flow occurs between crops and their conspecific weeds
to produce hybrid seeds and fertile hybrid plants, such
as the case between rice and weedy (or red) rice
(Langevin et al. 1990; Gealy et al. 2003). It is expected
that hybrid seeds on the weedy plant are more dormant
than the reciprocal hybrid seeds on the crop plant,
because of the differences in both maternal tissue and
endosperm tissue genotypes between the hybrids. However, hybrid seeds on the crop plants may also survive the
soil seed bank to be potential ‘‘volunteer weeds’’ in the
following season. This potential exists because offspring
tissue-imposed dormancy genes confer a certain degree
of dormancy to the seeds even in the absence of maternal tissue-imposed dormancy genes such as qSD7-1.
Similar to the red pericarp color gene in cereal crops
that expresses not in the hybrid F1 seed but in the
pericarp tissue of the F2 seeds, a maternal tissueimposed dormancy gene in the F1 generation would
enhance overall dormancy of the F2 seeds. Therefore,
dormancy genes functioning in maternal and offspring
tissues provide the species with complementary adaptation strategies.
Genetic analysis for dormancy has been conducted on
the basis of the seed maternal (plant) genotypes almost
without exception. A QTL analysis based on a nonpermanent segregation population (e.g., BC1 or F2) may
bias estimates of genetic effects for the loci associated
with seed dormancy imposed by offspring tissues, such
as qSD12. This is because the phenotypic value for a
segregate is the mean germination of its progeny seeds,
which ignores the within-sample genotypic variation
resulting from gene dominance and epistatic effects.
Therefore, caution should be used to interpret the
estimates for dormancy QTL when the gene nonadditive effects are significant. The qSD12 locus was narrowed to an 600-kbp region (Figure 2E) suitable for
map-based cloning of the underlying gene. Molecular
characterization of the major dormancy gene will unravel an underlying mechanism regulating germination
in the offspring tissue(s).
We thank C. Vogl for help in data analysis, and Y. Wang, B. Carsrud,
S. Franklin, C. Doddivenaka, and K. Hagedorn for technical supports.
Funding for this research was supported by grants from United States
Department of Agriculture Cooperative State Research, Education, and
Extension Service (SD00074-G), South Dakota Agriculture Extension
Station (SD00H171-06IHG), and National Science Foundation (0641376).
LITERATURE CITED
Alonso-Blanco, C., L. Bentsink, C. J. Hanhart, H. B. E. Vries and
M. Koornneef, 2003 Analysis of natural allelic variation at seed
dormancy loci of Arabidopsis thaliana. Genetics 164: 711–729.
Anderson, J. A., M. E. Sorrells and S. D. Tanksley, 1993 RFLP
analysis of genomic regions associated with resistance to pre-harvest sprouting in wheat. Crop Sci. 33: 453–459.
Bentsink, L., J. Jowett, C. J. Hanhart and M. Koornneef,
2006 Cloning of DOG1, a quantitative trait locus controlling
seed dormancy in Arabidopsis. Proc. Natl. Acad. Sci. USA 103:
17042–17047.
Bewley, J. D., 1997 Seed germination and dormancy. Plant Cell 9:
1055–1066.
Bewley, J. D., and M. Black, 1994 Seeds: Physiology of Development and
Germination. Plenum Press, New York.
Cai, H. W., and H. Morishima, 2000 Genomic regions affecting
seed shattering and seed dormancy in rice. Theor. Appl. Genet.
100: 840–846.
Dong, Y., E. Tsozuki, H. Kamiunten, H. Terao, D. Lin et al.,
2003 Identification of quantitative trait loci associated with preharvest sprouting resistance in rice (Oryza sativa L.). Field Crops
Res. 81: 133–139.
Flintham, J. E., 2000 Different genetic components control coatimposed and embryo-imposed dormancy in wheat. Seed Sci.
Res. 10: 43–50.
Foley, M. E., 1992 Effect of soluble sugars and gibberellic acid in
breaking dormancy of excised wild oat (Avena fatua) embryos.
Weed Sci. 40: 208–214.
Gealy, D. R., D. H. Mitten and J. N. Rutger, 2003 Gene flow between red rice (Oryza sativa) and herbicide-resistant rice (O. sativa): implications for weed management. Weed Tech. 17: 627–
645.
Gu, X.-Y., S. F. Kianian and M. E. Foley, 2004 Multiple loci and epistases control genetic variation for seed dormancy in weedy rice
(Oryza sativa). Genetics 166: 1503–1516.
Gu, X.-Y., S. F. Kianian, G. A. Hareland, B. L. Hoffer and M. E.
Foley, 2005 Genetic analysis of adaptive syndromes interrelated with seed dormancy in weedy rice (Oryza sative L.). Theor.
Appl. Genet. 110: 1108–1118.
Gu, X.-Y., S. F. Kianian and M. E. Foley, 2006a Isolation of three
dormancy QTLs from weedy rice as Mendelian factors. Heredity
96: 93–99.
Gu, X.-Y., S. F. Kianian and M. E. Foley, 2006b Dormancy genes
from weedy rice respond divergently to seed development environments. Genetics 172: 1199–1211.
Gubler, F., A. A. Millar and J. V. Jacobsen, 2005 Dormancy release, ABA and pre-harvest sprouting. Curr. Opin. Plant Biol.
8: 183–187.
Guo, L., L. Zhu, Y. Xu, D. Zeng, P. Wu et al., 2004 QTL analysis of
seed dormancy in rice (Oryza sativa L.). Euphytica 140: 155–162.
Han, F., S. E. Ullrich, J. A. Clancy and I. Romogosa, 1999 Inheritance and fine mapping of a major barley seed dormancy QTL.
Plant Sci. 143: 113–118.
Harlan, J. R., J. M. J. de Wet and E. G. Price, 1973 Comparative
evolution of cereals. Evolution 27: 311–325.
Offspring Tissue-Imposed Seed Dormancy
International Rice Genome Sequencing Project, 2005 The
map-based sequence of the rice genome. Nature 436: 793–800.
Johnson, L. P. V., 1935 The inheritance of delayed germination in
hybrids of Avena fatua and A. sativa. Can. J. Res. 13: 367–387.
Kao, C.-H., and Z.-B. Zeng, 2002 Modeling epistasis of quantitative
trait loci using Cockerham’s model. Genetics 160: 1243–1261.
Langevin, S. A., K. Clay and J. B. Grace, 1990 The incidence and
effects of hybridization between cultivated rice and its related
weed red rice (Oryza sativa L.). Evolution 44: 1000–1008.
Lan, X.-J., Y.-M. Wei, D. C. Liu, Z.-H. Yan and Y.-L. Zheng,
2005 Inheritance of seed dormancy in Tibetan semi-wild wheat
accession Q1028. J. App. Genet. 46: 133–138.
Lee, S.-J., C.-S. Oh, J.-P. Suh, S. R. McCouch and S.-N. Ahn,
2005 Identification of QTL for domestication-related and agronomic traits in an Oryza sativa 3 O. rufipogon BC1F7 population.
Plant Breed. 124: 209–219.
Li, C., A. Zhou and T. Sang, 2006 Genetic analysis of rice domestication syndrome with the wild annual species, Oryza nivara. New
Phytol. 170: 185–193.
Lin, S.-Y., T. Sasaki and M. Yano, 1998 Mapping quantitative trait
loci controlling seed dormancy and heading date in rice, Oryza
sativa L., using backcross inbred lines. Theor. Appl. Genet. 96:
997–1003.
Lincoln, S., M. Daly and E. Lander, 1992 Constructing Genetic Maps
with MAPMAKER/EXP 3.0, Ed. 3. Whitehead Institute, Cambridge, MA.
Lyttle, T. W., 1991 Segregation distorters. Annu. Rev. Genet. 25:
511–557.
McCouch, S. R., L. Teytelman, Y. Xu, K. B. Lobos, K. Clare et al.,
2002 Development and mapping of 2240 new SSR markers for
rice (Oryza sativa L.). DNA Res. 9: 199–207.
Mo, H., 1988 Genetic expression for endosperm traits, pp. 478–487
in Proceedings of the Second International Conference on Quantitative
Genetics. Sinauer Associates, Sunderland, MA.
Morris, C. F., J. M. Moffatt, R. G. Sears and G. M. Paulsen,
1989 Seed dormancy and responses of caryopses, embryos,
and calli to abscisic acid in wheat. Plant Physiol. 90: 643–647.
Nair, V. G., B. W. X. Ponnaiya and V. S. Raman, 1965 Studies on
seed dormancy in certain short-duration rice varieties. India
J. Agric. Sci. 35: 234–246.
Noll, J. S., P. L. Dyck and E. Czarnecki, 1982 Expression of
RL4137 type of dormancy in F1 seeds of reciprocal crosses in
common wheat. Can. J. Plant Sci. 2: 153–187.
Oka, H. I., 1988 Origin of Cultivated Rice. Japan Scientific Society
Press, Tokyo.
Rha, E.-S., F.-S. Thseng and S.-T. Wu, 1994 Distorted segregation of
Acp-1 for acid phosphase in a wide cross of rice. Rice Genet.
Newsl. 11: 106.
Romagosa, I., F. Han, J. A. Clancy and E. Ullrich, 1999 Individual locus effects on dormancy during seed development
and after ripening in barley. Crop Sci. 39: 74–79.
Rozen, S., and H. J. Skaletsky, 2000 Primer3 on the WWW for general users and for biologist programmers, pp. 365–386 in Bioinformatics Methods and Protocols: Methods in Molecular Biology, edited by
S. Krawetz, and S. Misener. Humana Press, Totowa, NJ (http://
frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi).
2273
SAS Institute, 1999 Statview Reference Manual. SAS Institute, Cary,
NC.
Seshu, D. V., and M. E. Sorrells, 1986 Genetic studies on seed dormancy in rice, pp. 369–382 in Rice Genetics: Proceedings of the International Rice Genetics Symposium, edited by International Rice
Research Institute. Manila, Philippines.
Seshu, D. V., and M. Dadlani, 1991 Mechanism of seed dormancy
in rice. Seed Sci. Res. 1: 187–194.
Simpson, G. M., 1990 Seed Dormancy in Grasses. Cambridge University
Press, Cambridge, UK.
Squire, G. R., B. Marshall, G. Dunlop and G. Wright, 1997 Genetic basis of rate-temperature characteristics for germination in
oilseed rape. J. Exp. Bot. 48: 869–875.
Takahashi, N., 1963 Studies on the dormancy of wild rice seeds.
Part 2. Role of seed coat, embryo and endosperm in dormant
seeds, pp. 75–85 in The 241st Report of the Institute for Agricultural
Research. Tohoku University, Sendai, Japan.
Taylor, D. R., and P. K. Ingvarsson, 2003 Common features of segregation distortion in plants and animals. Genetica 117: 27–35.
Temnykh, S., G. DeClerck, A. Lukashova, L. Lipovich, S.
Cartinhour et al., 2001 Computational and experimental
analysis of microsatellites in rice (Oryza sativa L.): frequency,
length variation, transposon associations, and genetic marker potential. Genome Res. 11: 1441–1452.
Thomson, M. J., T. H. Tai, A. M. McClung, X. H. Lai, M. E. Hinga
et al., 2003 Mapping quantitative trait loci for yield, yield components and morphological traits in an advanced backcross population between Oryza rufipogon and the Oryza sativa cultivar
Jefferson. Theor. Appl. Genet. 107: 479–493.
Tinker, N. A., and D. E. Mather, 1995 MQTL: software for simplified composite interval mapping of QTL in multiple environments. J. Agr. Genomics 1: 2.
Ullrich, S. E., P. M. Hayes, W. E. Dyer, T. K. Blake and J. A.
Clancy, 1993 Quantitative trait locus analysis of seed dormancy in ‘Steptoe’ barley, pp. 136–145 in Pre-harvest Sprouting
in Cereals, edited by M. K. Walker-Simmons and J. L. Ried. American Association of Cereal Chemists, St. Paul, MN.
Vogl, C., and S. Xu, 2000 Multipoint mapping of viability and segregation distorting loci using molecular markers. Genetics 155:
1439–1447.
Wan, J. M., L. Jiang, J. Y. Tang, C. M. Wang, M. Y. Hou et al.,
2006 Genetic dissection of the seed dormancy trait in cultivated
rice (Oryza sativa L.). Plant Sci. 170: 786–792.
Wan, J. M., Y. J. Cao, C. M. Wang and H. Ikehashi, 2005 Quantitative trait loci associated with seed dormancy in rice. Crop
Sci. 45: 712–716.
Xu, Y., L. Zhu, J. Xiao, N. Huang and S. R. McCouch, 1997 Chromosomal regions associated with segregation distortion of molecular markers in F2, backcross, doubled haploid, and recombinant
inbred populations in rice (Oryza sativa L.). Mol. Gen. Genet.
253: 535–545.
Communicating editor: A. H. Paterson