Download Marrow-Derived Facilitating Cells Transplantation: Role of Bone

This information is current as
of June 18, 2017.
Induction of FoxP3+CD4+25+ Regulatory T
Cells Following Hemopoietic Stem Cell
Transplantation: Role of Bone
Marrow-Derived Facilitating Cells
Kendra N. Taylor, Vivek R. Shinde-Patil, Evan Cohick and
Yolonda L. Colson
J Immunol 2007; 179:2153-2162; ;
doi: 10.4049/jimmunol.179.4.2153
http://www.jimmunol.org/content/179/4/2153
Subscription
Permissions
Email Alerts
This article cites 53 articles, 34 of which you can access for free at:
http://www.jimmunol.org/content/179/4/2153.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
The Journal of Immunology
Induction of FoxP3ⴙCD4ⴙ25ⴙ Regulatory T Cells Following
Hemopoietic Stem Cell Transplantation: Role of Bone
Marrow-Derived Facilitating Cells1,2
Kendra N. Taylor, Vivek R. Shinde-Patil, Evan Cohick, and Yolonda L. Colson3
B
one marrow transplantation (BMT)4 is an established
therapy for the treatment of many hematologic malignancies. However, the clinical application of this therapy is
limited to those patients with a closely matched donor. Allogeneic
BMT across multiple major histocompatability (MHC) disparities
is characterized by the high mortality and morbidity associated
with the development of severe graft-vs-host disease (GVHD) and
engraftment failure. The severity of these complications has prevented the application of clinical allogeneic BMT to many nonmalignant hematologic maladies and to the induction of solid organ transplantation tolerance (1, 2).
Studies using murine BMT models have demonstrated that these
limitations can potentially be overcome with the use of purified
Division of Thoracic Surgery, Department of Surgery Brigham and Women’s Hospital, Boston, MA 02115
Received for publication April 3, 2007. Accepted for publication May 31, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This research was supported by the National Institutes of Health Grant R01
HLO74150 (to Y.L.C.).
2
K.N.T. conceptualized, designed, and performed research, and wrote the manuscript; V.R.S. designed and performed research; E.C. performed research and compiled data; and Y.L.C. is the corresponding author and performed the conception and
execution of research and manuscript editing.
3
Address correspondence and reprint requests to Dr. Yolonda L. Colson, Division of
Thoracic Surgery, Department of Surgery, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 02115. E-mail address: [email protected]
4
Abbreviations used in this paper: BMT, bone marrow transplantation; MHC, multiple major histocompatability; GVHD, graft-vs-host disease; FC, facilitating cells;
BM, bone marrow; SC, stem cell; FoxP3, forkhead/winged helix transcription factor;
DC, dendritic cell; p-preDC, plasmacytoid precursor DC; Tr1, T regulatory 1; TBM,
BM T cells; ODN, oligodeoxynucleotide; CSM, cell sort media.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
www.jimmunol.org
cell populations. Facilitating cells (FC), isolated as CD8 positive
(CD8␣⫹) and ␣␤␥␦ TCR negative (␣␤␥␦TCR⫺) are bone marrow
(BM)-derived cells that reliably promote purified allogeneic stem
cell (SC) reconstitution with resulting transplantation tolerance
across complete MHC barriers without clinical or histological evidence of GVHD (3– 6). Therefore, FC permit the reconstitution of
the donor immune system within allogeneic recipients. However,
the mechanisms associated with donor FC function in SC engraftment and induction of tolerance, are not yet clear. Previous reports
have demonstrated that FC transplantation result in increased gene
expression of regulatory T cell-associated factors forkhead/winged
helix transcription factor (FoxP3), GITR, and CTLA4. The increased gene expression was detected within the spleen of recipients and suggested the induction of a regulatory response (4). The
mechanisms by which such a regulatory network could arise after
SC plus FC transplantation have not yet been characterized.
The FC population contains a subset that expresses markers consistent with a plasmacytoid dendritic cell (DC) phenotype (5). In
an inactivated state, immature pDC are called plasmacytoid precursor DC (p-preDC) (7). Upon activation, p-preDC differentiate
and are capable of activating naive CD4⫹25⫺ T cell differentiation. To date, pDC have been characterized as the principal inducers of CD4⫹25⫺ T cell differentiation into regulatory CD4⫹25⫹
and T regulatory 1 (Tr1) cells capable of suppressing effector T
cell proliferation (7–14). In vitro studies have demonstrated that
activation of TLR-9 on p-preDC induces their differentiation and
ability to prime naive CD4⫹25⫺ T cells and induce development
into regulatory CD4⫹25⫹ or Tr1 regulatory T cells (15–18). We
hypothesize that the donor FC population may have a similar function following transplantation. Although similarities between BMderived FC and p-preDC have been described, recent findings have
identified markers on the FC population that are not present on
p-preDC (5, 19, 20). These findings showed that FC are distinct
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The establishment of donor cell lineages following allogeneic bone marrow transplantation is frequently associated with the
development of graft-vs-host disease (GVHD). The identification of cell populations that are capable of supporting allogeneic stem
cell (SC) engraftment and the induction of tolerance without inducing GVHD could expand the use of this therapy. CD8ⴙTCRⴚ
facilitating cells (FC) have been shown to promote allogeneic SC engraftment with resulting transplantation tolerance across
complete MHC barriers without inducing GVHD. Although donor reconstitution in SC plus FC recipients is associated with the
induction of regulatory T cell-associated factors, it is not known whether an induction of regulatory T cells and subsequent
tolerance is a direct effect of the FC. The current study demonstrates that 1) SC plus FC transplantation results in the induction
of donor CD4ⴙ25ⴙ regulatory T cells and that FC are present in the spleen of recipients before the induction of these cells, 2)
activation of FC with CpG-oligodeoxynucleotide promotes CD4ⴙ25ⴚ T cell differentiation into CD4ⴙ25ⴙ regulatory T cells in
vitro, as demonstrated by cytokine and forkhead/winged helix transcription factor (FoxP3) gene and protein expression, and 3)
direct contact between FC and CD4ⴙ25ⴚ T cells is required for FoxP3ⴙCD4ⴙ25ⴙ regulatory T cell induction and is dependent
on CD86 expression on FC. This is the first report to demonstrate a mechanism for FC in the induction of regulatory T cells
following allogeneic SC plus FC transplantation. The transplantation of donor FC may provide an alternative approach to
permit clinical SC engraftment and induction of transplantation tolerance in the future. The Journal of Immunology, 2007,
179: 2153–2162.
2154
Materials and Methods
Animals
Six- to 8-wk-old female C57BL/6 (B6) and B10.BR mice were purchased
from The Jackson Laboratory. All animals were housed in a specific pathogen and viral-free facility at the Dana-Farber Cancer Institutes under the
guidelines of the National Institutes of Health for care and use of laboratory
animals.
BM cell preparation
BM preparation was performed as previously described (19, 20). In brief,
BM was isolated from the long bones of mice by flushing with cold HBSS
(Invitrogen Life Technologies). After washing with HBSS, BM cells were
resuspended in sterile cell sort medium (Invitrogen Life Technologies; cell
sort media (CSM): HBSS without phenol red, 2% FBS, 2 ␮g/ml HEPES
buffer, and 30 ␮g/ml gentamicin).
Monoclonal Abs
The following mAbs were used to sort CD8⫹TCR⫺ FC: anti-CD8␣ (536.7) PE, anti-TCR␤-chain (H57–597) FITC, and anti-TCR␥␦ chain (GL3)
FITC. To sort spleen CD4⫹25⫺ or CD4⫹25⫹ cells, the following were
used: anti-CD4 (GK1.5) FITC and anti-CD25 (PC61) allophycocyanin. To
sort B220⫹CD11b⫺CD11c⫹ p-preDC, the following were used: antiCD45R/B220 (RA3-6B2) allophycocyanin, anti-CD11b (M1/70) FITC, and
anti-CD11c biotin, with streptavidin PE-Cy5. To sort Sca-1⫹/c-kit⫹/Lin⫺ stem
cells, Lin⫺ were all FITC conjugated as follows: B220, CD8␣, Gr-1, MAC-1,
␣␤ TCR, and ␥␦TCR. Purified anti-mouse CD3␧ (145-2C11) and CD28
(37.51) were used in the proliferation assays. FITC-conjugated anti-mouse
H-2Kb (AF6 – 88.5) and H-2Kk (36-7-5) were used for donor chimerism analysis. CD86 (GL1) PE-Cy5 and FoxP3 (FJK-16s) PE with isotype control Rat-
IgG were purchased from eBiosciences, San Diego, CA. All other sort mAbs
were purchased from BD Biosciences, San Jose, CA.
Purified p-preDC and T cell isolation
p-preDC from BM and CD4⫹25⫺ or CD4⫹25⫹ T cells from spleen were
sorted as previously described (5, 20). In brief, cells were incubated for 30
min at 4°C with mAbs. After incubation, the cells were washed twice with
CSM and resuspended to a final concentration of 2 ⫻ 108 cells/ml in CSM
before multiparameter sterile live cell sorting within the conventional lymphoid gate on a MoFlo flow cytometric cell sorter (DakoCytomation). Postsort purity was determined with respect to forward and side scatter parameters and the designated cell surface markers. Postsort purity for p-preDC
was 90 –95% and spleen T cells was ⬎95%.
Purified SC and FC isolation and transplantation
SC, FC, and BM T cells (TBM) were isolated from donor BM as described
previously (3, 4, 19, 20). SC were sorted on a MoFlo cell sorter as Sca1⫹/c-kit⫹/Lin⫺ (Lin: B220, CD8␣, Gr-1, MAC-1, ␣␤ TCR, and ␥␦TCR)
cells within the lymphoid cell gate. FC and TBM were also sorted within
the lymphoid gate as CD8⫹/␣␤␥␦TCR⫺ and CD8⫹/␣␤␥␦TCR⫹ populations, respectively. The range for postsort purity was 88 –98%. Lethally
irradiated (950cGy) B10.BR recipients were reconstituted with 10,000 B6derived SC alone, or together with 50,000 B6-derived FC (SC plus FC) or
TBM (SC plus TBM). Ablated B6 mice transplanted with 2,000 B6-derived SC served as syngeneic controls. Allogeneic SC reconstitution was
determined by PBL typing of donor (H-2b) MHC Ag expression 28 days
following BMT and expressed as percentage of donor chimerism.
RNA isolation and reverse transcription
Total RNA was isolated from sorted cell populations or whole spleen using
the RNeasy System, (Qiagen) and converted to cDNA, (Ambion), as recommended by the manufacturers’ instructions.
Conventional PCR
The primer sequences for IL2 (internal constitutive control): (sense, CT
AGGCCACAGATTGAAAGATCT and anti-sense, GTAGGTGGAAAT
TCTAGCATCATCC) and GFP (sense, AAGTTCATCTGCACCACCG
and anti-sense, TCCTTGAAGAAGATGGTGCG) were used for analysis
of gene transcripts. Conventional PCR was performed for 40 cycles for 1
min at 94°C, followed by 1-min incubations of 60°C and 72°C, with a final
10-min extension at 72°C. Products were visualized on a 1.5% agarose gel
stained with ethidium bromide.
Real-time quantitative PCR
Real-time PCR was performed using 3–10 ␮l cDNA mixed with diethyl
pyrocarbonate-treated water, PCR master mix (Applied Biosystems), and
the primer pairs. The gene-specific, real-time PCR products were measured
for 40 cycles using the Gene Amp 5700 Sequence Detection System. Nontemplate controls and dissociation curves were used to detect nonspecific
amplification and the formation of primer-dimers. All experiments were
run in duplicate and gene expression was normalized to the expression of
the housekeeping gene, GAPDH.
CpG-oligodeoxynucleotide (ODN) and FC stimulation assay
Phosphorothioate-modified CpG-B ODN 2006: 5⬘ TCGTCGTTTTGTCGT
TTTGTCGTT 3⬘ (18) was obtained from Invitrogen Life Technologies
(modified nucleotides are underlined). FC were cultured in presence or
absence of CpG-ODN at 10 ␮g/ml. Cultures were harvested for analysis of
gene expression or cytokine production by ELISA and flow cytometry.
ELISA
Cell-free supernatants of 48-h cultures of FC in the presence or absence of
CpG-ODN were collected. The amount of cytokines produced was determined by ELISA multiplex for IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL10,
IL12p70, IL13, ⌴IP1␣, MIP2, IFN-␥, and TNF-␣. Supernatants from two
independent experiments were analyzed using Pierce Diagnostic Services.
Flow cytometry
Cell suspensions were incubated at 4°C with fluorophore- or biotin-conjugated primary mAbs directed against designated surface markers. Biotinylated mAbs were detected with streptavidin-PE-Cy5 secondary mAbs.
For analysis of extracellular expression of CD86, FC cells were sorted
as previously described, stimulated with CpG-ODN and harvested in FACS
buffer (HBSS with 0.05% BSA and 0.05% sodium azide). Cell suspensions
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
from p-preDC in that the FC population expresses TCR␤ and
CD3␧ and p-preDC do not. These receptors are also required for
FC function in vivo. The TCR␤-chain expression is unique to the
FC, in that instead of expressing the conventional ␣␤ TCR heterodimer, FC express a unique heterodimer composed of the
TCR␤-chain disulfide linked to a 33kDa protein named FCp33
(19). Furthermore, in a fully allogeneic murine model of SC plus
p-preDC or SC plus FC transplantation, p-preDC are much less
efficient at facilitating SC engraftment than the FC population (5).
These findings demonstrate that there are functional characteristics
unique to the FC population. However, FC and p-preDC may share
the ability to induce regulatory T cells.
Numerous reports have documented CD4⫹25⫹ regulatory T cell
involvement in the promotion of hemopoietic cell reconstitution
(21), GVHD suppression (22–24), and the establishment of selftolerance (25–28). Specifically, CD4⫹25⫹ regulatory T cell transplantation resulted in allogeneic hemopoietic cell engraftment with
increased long-term multilineage donor chimerism in sublethally
irradiated murine recipients (21). These findings demonstrate a
role for CD4⫹25⫹ regulatory T cells in allogeneic hemopoietic
cell reconstitution across fully mismatched MHC barriers. Although the mechanisms of regulatory T cell function are not completely clear, the development and activation of CD4⫹25⫹ regulatory T cells have been linked to interactions with pDC.
The present study investigates the development of regulatory T
cells following allogeneic SC plus FC transplantation in vivo and
assesses the ability of FC to directly induce naive CD4⫹25⫺ T cell
differentiation into CD4⫹25⫹ regulatory T cells in vitro. We report
that 1) FoxP3⫹CD4⫹25⫹ regulatory T cells are induced within the
spleen of SC plus FC recipients postarrival of FC to the spleen,
2) activated FC induce CD4⫹25⫺ T cell differentiation into
FoxP3⫹CD4⫹25⫹ regulatory T cells in vitro, and 3) direct cell-cell
contact between FC and CD4⫹25⫺ T cells is required for FCmediated regulatory T cell development in vitro. These findings
provide the first mechanistic evidence that FC can induce the generation of FoxP3⫹CD4⫹25⫹ regulatory T cells and may have a
role in the subsequent development of transplantation tolerance
in vivo.
FC INDUCE REGULATORY T CELLS
The Journal of Immunology
2155
of CpG-stimulated and unstimulated FC were incubated with the mAb for
CD86 (anti-CD86 PE-Cy5) or isotype control (Rat-IgG PE-Cy5) for 30
min at 4°C. The cells were washed twice with FACS buffer and then fixed
with 2% paraformaldehyde in PBS. For analysis of FoxP3 protein, intracellular labeling was used. Cells were first labeled for extracellular CD4
and CD25 receptors, followed by fixation of cells in cells 2% paraformaldehyde, permeabilization using 0.05% Triton X-100 in PBS, and then labeled for intracellular FoxP3 with anti-FoxP3 mAb. The isotype control
was Rat-IgG. For all studies, fluorescence of 10,000 cells within the lymphoid gate was assessed on a FACSCalibur flow cytometer (BD
Biosciences).
T cell functional assays
CD4⫹CD25⫹ and CD4⫹CD25⫺ cells were purified from splenocytes via
cell sorting. CD90⫹ depleted cells were recovered from naive spleens by
magnetic depletion (Miltenyi Biotec), irradiated at 3000cGy and used as
accessory cells. Cells were cultured in RPMI 1640 supplemented with 10%
heat-inactivated FBS, penicillin (100 U/ml), streptomycin (100 mg/ml), 2
mM L-glutamine, (all from Invitrogen Life Technologies) and 50 ␮M
2-ME (Sigma-Aldrich). Purified cell populations were tested for proliferative potential in presence of anti-CD3 mAb, anti-CD28 mAb, and rIL-2
(PeproTech) as described previously (29). CD4⫹CD25⫹ regulatory T cell
suppressive function was tested by coculturing CD4⫹CD25⫺ T cells with
increasing ratios of CD4⫹CD25⫹ cells (1:0, 1:0.1:0.25 and 1:1) in the
presence of anti-CD3 mAb and accessory cells in flat-bottom 96-well
plates. Cultures were maintained in a humidified incubator at 37°C, 5%
CO2, for 72 h and labeled with [3H] (8-h pulse) to ascertain the level of
proliferation. Data are expressed as mean ⫾ SEM cpm.
In vitro stimulation of naive CD4⫹25⫺ T cells
Spleen CD4⫹25⫺ T cells were incubated with FC or p-preDC at a 10:1
ratio in 96-well plates with or without CpG-ODN in medium (RPMI 1640
supplemented with 10% FBS, and 2 mM L-glutamine) for up to 6 days. As
negative controls, naive CD4⫹25⫺ T cells were cultured alone, with FC, or
with CpG. The cocultures were harvested and the generated CD4⫹25⫹ T
cells were sorted and analyzed for FoxP3 and cytokine gene transcripts
using real-time PCR.
CD86 blockade assay
In vitro stimulation of CD4⫹25⫺ T cells was performed as previously
described in the absence or presence of anti-CD86 Ab at 1 ␮g/ml. As
negative controls, naive CD4⫹25⫺ cells alone or with FC were cultured
with anti-CD86 Ab. The cells were cocultured up to 6 days, harvested, and
the generated CD4⫹25⫹ T cells were sorted and analyzed for FoxP3 gene
expression.
Statistical analysis
Survival fractions were determined using Kaplan-Meier analysis. Means
and variances for real-time PCR data were estimated using JMP statistical
software (SAS Institute). Significant differences ( p ⱕ 0.05) were ascertained via Student’s t test.
Results
SC plus FC recipients are characterized by an in vivo induction
of donor FoxP3⫹CD4⫹CD25⫹ regulatory T cells
It is well established that FC promote purified allogeneic SC engraftment and subsequent transplantation tolerance across complete MHC barriers without clinical or histological evidence of
GVHD (3– 6). However, the mechanisms associated with FC function are not yet clear. Given that donor SC engraftment and tolerance following SC plus FC transplantation parallel the outcome
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. CD4⫹CD25⫹ T cells derived from SC plus FC recipients express FoxP3 and display a functional regulatory phenotype. A, Flow cytometric
analysis of spleens (top row) and BM (bottom) from SC plus FC and SC plus TBM recipients were used to detect CD4⫹CD25⫹ populations within the
lymphoid cell compartment of these tissues. Fluorescence intensities of fluorophore-conjugated CD4 and CD25 mAbs are plotted on x- and y-axes,
respectively. Representative panels from spleens and BM of SC plus FC and SC plus TBM recipients are included with percentages of stained populations
in each quadrant. B, CD4⫹25⫹ splenocytes from SC plus FC recipients (left dot plot) were assessed for intracellular FoxP3 coexpression. The right
histogram represents FoxP3 coexpression (open histogram) in gated CD4⫹CD25⫹ T cells overlaid on a corresponding isotype control histogram (filled).
C, SC plus FC-derived CD4⫹CD25⫹ and CD4⫹CD25⫺ T cells grown in either medium alone (RPMI 1640), or medium with anti-CD3 mAb (CD3),
anti-CD3 mAb and IL-2 (CD3/IL2), or anti-CD3 and anti-CD28 mAbs (CD3/CD28) were analyzed for proliferation. [3H] incorporation by proliferating
cells was averaged and shown as cpm (⫻103). Averaged data from four experiments are presented as mean ⫾ SEM; ⴱ, Statistically significant differences
(p ⬍ 0.05). D, CD4⫹CD25⫺ T cells were either incubated alone (1:0) or with increasing ratios of CD4⫹CD25⫹ cells (1:0.1, 1:0.25, and 1:1). Suppression
was assessed using a [3H] incorporation assay and expressed in cpm (⫻103). Values represent mean ⫾ SEM of triplicate samples.
2156
FC INDUCE REGULATORY T CELLS
FIGURE 3. TLR9 gene expression within freshly isolated FC. Realtime PCR was used for analysis of TLR9 gene transcript in freshly isolated
FC, p-preDC, mature DC, NK cells, and T cells (T). The TLR9 gene expression levels in FC and p-preDC are similar and both are higher than the
expression found in DC, NK, and T cells. The data are representative of
average values of duplicate samples with SEM of three independent experiments and is shown as percentage of GAPDH gene expression.
of CD4⫹CD25⫹ regulatory T cell-mediated engraftment of allogeneic hemopoietic cells and subsequent tolerance, we hypothesized that FC function may result in an induction of CD4⫹CD25⫹
regulatory T cells. The current studies first investigated CD4⫹25⫹
T cell development following SC plus FC transplantation.
CD8⫹TCR⫺ FC vs BM-derived CD8⫹TCR⫹ TBM were used in a
fully allogeneic (C57BL/6 3 irradiation conditioned B10.BR)
mouse model. TBM recipients develop GVHD and fail to survive
beyond 7 wk. Splenocytes and BM from recipients were assessed
for CD4 and CD25 coexpression using flow cytometric analysis.
As reflected in the representative panel in Fig. 1A, a significantly
higher frequency of CD4⫹CD25⫹ T cells was present in the lymphoid populations of whole spleens (2.03 ⫾ 0.28%) and BM
(1.03 ⫾ 0.29%) in SC plus FC recipients (n ⫽ 12, p ⫽ 0.01)
compared with spleens (1.07 ⫾ 0.29%) and BM (0.35 ⫾ 0.1%) of
surviving SC plus TBM recipients (n ⫽ 7). This represents a nearly
2- and 3-fold increase in CD4⫹CD25⫹ frequency in the spleens
and BM of SC plus FC recipients, respectively. Given that an
increased incidence of recruited or proliferating non-T cell types
could also decrease the frequency of CD4⫹CD25⫹ T cells in SC
plus TBM, CD4⫹CD25⫹ T cells were also assessed as a fraction
of the total CD4⫹ cell pool. CD4⫹CD25⫹ T cells accounted for
11.3 ⫾ 1.3% and 5.7 ⫾ 0.9% of the total splenic CD4⫹ cell pool
in SC⫹FC and SC⫹TBM recipients respectively, reflecting a
2-fold increase in the number of CD4⫹CD25⫹ splenic cells in SC
plus FC recipients. Therefore, in contrast to TBM recipients that
develop GVHD, FC recipients show a significant induction of
CD4⫹25⫹ cells within the spleen.
Given that the hemopoietic system of the recipient is ablated
with total body irradiation before transplantation, it is not surprising that the majority of CD4⫹25⫹ cells in SC plus FC recipients
are of donor origin, as demonstrated by the flow cytometric anal-
CD4⫹25⫹ T cells derived from SC plus FC recipients are
anergic and suppress the activity of CD4⫹25⫺ T cells in vitro
We next investigated the functional regulatory activity of
CD4⫹CD25⫹ T cells sorted from the spleen of SC plus FC recipients. CD4⫹CD25⫹ and CD4⫹CD25⫺ cells isolated from SC plus
FC spleens were incubated with purified anti-CD3 mAb alone, or
in combination with IL2 or anti-CD28 mAb. As shown in Fig. 1C,
the CD4⫹CD25⫺ T cells are not anergic; rather, these cells are
functional and capable of proliferation in the presence of CD3
mAb alone. Furthermore, the functional capability is enhanced by
the addition of IL2 or anti-CD28 mAb. In contrast, the
CD4⫹CD25⫹ T cells are anergic, exhibiting a decreased proliferative response to anti-CD3 mAb, even in the presence of IL2.
Importantly, these CD4⫹CD25⫹ cells are potent functional regulatory T cells, as evident by their ability to exhibit a nearly 100fold inhibition of CD4⫹CD25⫺ T cell proliferation during coculture at a 1:1 ratio (Fig. 1D).
Donor FC are present in the spleen of recipients before
FoxP3⫹CD4⫹25⫹ regulatory T cell induction
Given the current demonstration that regulatory T cells are induced
within the spleen of SC plus FC recipients, we investigated
whether FC were also present in recipient spleens following transplantation. To identify donor FC within an in vivo model of allogeneic transplantation, B6-derived GFP⫹ FC were transplanted
with GFP⫺ SC into irradiation-conditioned B10.BR recipients.
Splenocytes were harvested from SC plus GFP⫹ FC recipients 2
and 4 wk following transplantation. GFP transcript was detected
by conventional PCR. Amplification of the IL2 transcript was used
as an internal control for PCR conditions. As demonstrated in Fig.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. Donor FC precede FoxP3⫹CD4⫹25⫹ regulatory T cell induction within the spleen of SC plus FC recipients. Conventional and realtime PCR were performed using cDNA from splenocytes derived from
2-wk-old (n ⫽ 3) and 4-wk-old (n ⫽ 3) B10.BR recipients of C57BL/6derived SC and GFP⫹ FC. A, GFP transcripts were amplified from spleen
samples using conventional PCR. GFP⫹ and GFP⫺ splenic cDNA were
used as controls. PCR products were visualized by ethidium bromide staining. Product sizes are 173 bp (GFP) and 324 bp (IL2; internal control). B,
FoxP3 gene expression was analyzed using real-time PCR and is shown as
percentage of GAPDH gene expression. The data are representative of
average values of duplicate samples with SEM of three independent
experiments.
ysis of H-2b surface expression. The percentage of CD4⫹CD25⫹
T cells of donor origin in SC⫹FC vs SC⫹TBM recipients was
72.3 ⫾ 1.8% and 86.9 ⫾ 7.0% in the spleen and 74.9 ⫾ 2.6% and
57.8 ⫾ 7.6% in the BM, respectively. However, it is important to
confirm that these CD4⫹CD25⫹ cells are regulatory T cells and
not just an activated phenotype. Given that FoxP3 plays a key role
in CD4⫹25⫹ regulatory T cell development, and serves as the
most reliable identification marker for these cells, intracellular
staining for FoxP3 protein was assessed. As demonstrated in Fig.
1B, FoxP3⫹ cells represent ⬎50% of splenic CD4⫹CD25⫹ T cells
in SC plus FC recipients. Therefore, FC-mediated facilitation of
allogeneic SC engraftment results in an increase in donor
CD4⫹CD25⫹ T cells as a percentage of total CD4⫹ cells. Moreover, more than half of the CD4⫹25⫹ population expresses FoxP3
suggesting the induction of regulatory T cells following FC
transplantation.
The Journal of Immunology
2157
2A, GFP⫹ donor FC are readily detected in recipient spleens as
early as 2 wk posttransplantation. Importantly, concurrent analysis
of FoxP3 gene expression in these samples by real-time PCR revealed that the induction of FoxP3 gene expression did not occur
until 4 wk following FC transplantation (Fig. 2B). The current
findings demonstrate that FoxP3⫹CD4⫹25⫹ regulatory T cell induction and/or recruitment follows the arrival of donor FC within
the recipient spleen.
FC induce the generation of CD4⫹25⫹ regulatory T cells in
vitro
Given that the identification of FC within the spleen of SC plus FC
recipients is followed by an induction of regulatory T cells of
donor origin, we addressed the possibility that FC directly induce
the development of CD4⫹25⫹ regulatory T cells. The basis is formulated from the demonstration that the FC population contains a
subset of cells that is B220⫹CD11c⫹, a phenotype that is characteristic of p-preDC. In vitro studies have demonstrated that activation of TLR9 on p-preDC result in their differentiation and ability to induce naive CD4⫹25⫺ T cell differentiation into regulatory
CD4⫹25⫹ or Tr1 regulatory T cells (15–18). We have chosen to
use a similar assay to test the FC ability to induce CD4⫹25⫹ regulatory T cells in vitro as a possible mechanism for the observed
induction of CD4⫹25⫹ regulatory T cells following SC plus FC
transplantation. As demonstrated in the current studies, the majority of splenic CD4⫹25⫹ T cells of SC plus FC recipients are of
donor origin. Therefore, we have analyzed the interactions between donor cell types and our subsequent in vitro studies used a
syngeneic in vitro model for analysis of FC-mediated induction of
CD4⫹25⫹ regulatory T cells. For these studies, FC and CD4⫹25⫺
T cells were isolated from the bone marrow and spleen of
C57BL/6 mice. It is our hypothesis that similar to p-preDC the in
vitro activation of TLR9 on FC in coculture with CD4⫹25⫺ T cells
results in T cell differentiation into CD4⫹25⫹ regulatory T cells.
We began our investigation by contrasting TLR9 gene expression
within the FC population to p-preDC, mature DC, NK, and T cells.
In this study, we demonstrate that purified FC and p-preDC have
similar TLR9 gene expression levels (Fig. 3) and, as expected, the
gene expression within these populations is greater than expression
levels within mature DC and NK cells that are other potential
immune-modulating cell populations (5). Therefore, in subsequent
studies, FC were stimulated with the TLR9 ligand CpG-ODN
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Analysis of FoxP3 in CD4⫹25⫹ T cells
generated following FC coculture. CD4⫹25⫺ T cells
from the spleen of C57BL/6 mice were cocultured with
FC alone, CpG alone, or CpG and FC in medium for up
to 6 days. The resulting CD4⫹25⫹ T cells were sorted
by flow cytometry. A, The number of CD4⫹25⫹ T cells
generated from the coculture of CD4⫹25⫺ T cells with
FC plus CpG were significantly greater than cocultures
without CpG. ⴱ, Statistically significant differences (p ⫽
0.001). The data are shown as percentage of total CD4⫹
cells recovered. Cell recovery from CpG-stimulated FC
T cell cocultures ranged from 1300 to 3600 CD4⫹25⫹
cells and 90,000 to 200,000 CD4⫹25⫺ cells. B, The
CD4⫹25⫹ T cells were analyzed for gene expression of
FoxP3 using real-time PCR. The positive control for
regulatory T cell induction was CD4⫹25⫺ T cells cocultured with p-preDC plus CpG. As expected, the positive
control generated CD4⫹25⫹ T cells that express the
FoxP3 transcript. The T cell cocultures with FC plus
CpG generated CD4⫹25⫹ T cells that also expressed the
FoxP3 transcript. The data are representative of average
values of duplicate samples with SEM of three independent experiments. C, FoxP3 protein expression was analyzed in cocultures of FC and CD4⫹25⫺ T cells in the
presence or absence of CpG. Cocultures in the presence
of CpG generated CD4⫹25⫹ cells that expressed higher
levels of FoxP3 protein compared with cocultures without CpG. The average values of three independent experiments are shown. D, The FC-generated CD4⫹25⫹ T
cells expressed higher levels of IL2 and significantly
higher levels of IL4 than p-preDC-generated or freshly
isolated native CD4⫹25⫹ T cells. ⴱ, Statistically significant differences (p ⫽ 0.047). Gene expression levels
for IL10, IL15, TGF-␤, and TNF-␣ were similar for all
samples. The data are representative of average values
of duplicate samples with SEM of three independent
experiments.
2158
2006, a B-type ODN previously shown to stimulate p-preDC in
coculture with CD4⫹25⫺ T cells (18, 30 –33). CD4⫹25⫺ T cells
from the spleen of B6 mice were cocultured with FC alone, CpG
alone, or FC and CpG in medium for up to 6 days. The T cells
cultured with FC alone generated few CD4⫹25⫹ cells as represented by 0.4 ⫾ 0.2% of total CD4⫹ T cells recovered (Fig. 4A).
In contrast, CpG-stimulated FC T cell cocultures resulted in increased T cell differentiation into CD4⫹25⫹ T cells as represented
by 1.82 ⫾ 0.10% of total CD4⫹ T cells recovered ( p ⫽ 0.001).
Therefore, the current findings demonstrate a nearly 5-fold difference in the number of generated CD4⫹25⫹ T cells. Because FoxP3
is preferentially expressed in CD4⫹25⫹ regulatory T cells and is
associated with both the development and suppressive function of
these cells (34), FoxP3 gene and protein expression were evaluated
within CD4⫹25⫹ T cells generated from cocultures using real-time
PCR and flow cytometric analysis, respectively (Fig. 4, B and C).
The real-time PCR analysis revealed that the CD4⫹25⫹ T cells
generated from CpG-stimulated FC in CD4⫹25⫺ T cell cocultures
expressed the FoxP3 transcript at similar levels to T cell cocultures
with CpG-stimulated p-preDC. The T cell cocultures with p-preDC
and CpG were used as positive controls for the assay. In contrast,
the CD4⫹25⫹ T cells generated from the coculture of CD4⫹25⫺ T
FIGURE 6. Direct interaction between FC and naive CD4⫹25⫺ T cells
is required for generation of FoxP3 expressing CD4⫹25⫹ regulatory T
cells. CD4⫹25⫺ T cells were cocultured with FC plus CpG or separated by
transwell membranes in medium for up to 6 days. The cocultures and
separated cultures were harvested and the resulting CD4⫹25⫹ T cells were
sorted by flow cytometry for analysis of FoxP3 transcript. A, The number
of CD4⫹25⫹ T cells generated from FC-CD4⫹25⫺ T cell coculture was
significantly greater than the number generated in cultures separated by
transwell. ⴱ, Statistically significant differences (p ⫽ 0.008). The data are
shown as the percentage of total CD4⫹ cells recovered. The total number
of CD4⫹ T cells recovered after coculture or separated culturing was similar. B, The CD4⫹25⫹ T cells generated from both coculture and transwell
well cultures were analyzed for gene expression of FoxP3 using real-time
PCR. The CD4⫹25⫹ T cells generated from the separation of FC-CpG and
T cells did not express the FoxP3 transcript. The real-time PCR data represent average values of duplicate samples with SEM of three independent
experiments.
cells with FC alone expressed very little to no FoxP3 transcript.
The gene expression data were supported with analysis of FoxP3
protein expression. As demonstrated in Fig. 4C, of the total
CD4⫹25⫹ T cells generated from CpG-stimulated FC-T cell cocultures, 20 ⫾ 3% expressed the FoxP3 protein. In contrast, 3.3 ⫾
1% of the CD4⫹25⫹ T cells generated from FC T cell cocultures
without CpG-expressed FoxP3 protein. These findings demonstrated that CpG-stimulated FC induced the generation of
FoxP3⫹CD4⫹25⫹ T cells. The FC-generated FoxP3⫹CD4⫹25⫹ T
cells were further analyzed for gene expression of cytokines associated with the regulatory T cell phenotype. Interestingly, real-time
PCR analysis of cytokine transcripts within the FC generated
CD4⫹25⫹ T cells revealed a significantly higher level of IL4 transcript in contrast to expression within freshly isolated native
CD4⫹25⫹ T cells or p-preDC induced CD4⫹25⫹ T cells (Fig. 4D).
These findings support previous reports demonstrating that the
CD4⫹25⫹ T cells generated from the induction of naive CD4⫹25⫺
T cell differentiation in the spleen express higher levels of IL4
when compared with native CD4⫹25⫹ T cells (35, 36). Importantly, although FC have previously been characterized as having
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. CpG-ODN-stimulated FC produce cytokines associated
with DC activation and the induction of regulatory T cells. FC were cultured in medium in the presence or absence of CpG. Cytokine production
by CpG-stimulated FC was assessed using ELISA. A and B, CpG stimulation of FC induces protein expression of TNF-␣ and markedly high expression of IL6 with nearly no difference in IL12p70 production compared
with unstimulated FC samples. C, The cytokine expression of IL10 and
IFN-␥ are increased but not IL2 and IL4 following CpG stimulation of FC.
The graphs are representative of duplicate samples in two independent
experiments.
FC INDUCE REGULATORY T CELLS
The Journal of Immunology
2159
a p-preDC like subset (5), FC-generated CD4⫹25⫹ T cells express
a significantly higher level of IL4 transcript compared with ppreDC generated CD4⫹25⫹ T cells ( p ⫽ 0.047). Taken together,
these finding demonstrate that CpG-stimulated FC are capable of
inducing the differentiation of naive CD4⫹25⫺ T cells into
CD4⫹25⫹ T cells that express FoxP3. Furthermore, the FC-generated regulatory T cells display a cytokine gene expression profile
consistent with the induction of CD4⫹25⫹ regulatory T cells
within the spleen.
CpG-ODN-stimulated FC express cytokines associated with the
induction of CD4⫹25⫹ regulatory T cells
We have demonstrated that the in vitro stimulation of FC in coculture with CD4⫹25⫺ T cells results in T cell differentiation into
FoxP3⫹CD4⫹25⫹ regulatory T cells. We next investigated the
mechanism of this FC-mediated induction by assessing whether
CpG-stimulated FC express cytokines that are associated with the
induction of regulatory T cells as similarly demonstrated with ppreDC. Supernatants from CpG-stimulated and unstimulated FC
were collected and assayed via ELISA for the presence of cytokines. Fig. 5, A and B, show an induction of TNF-␣ and IL6 protein secretion and no increase in the production of IL12p70. IL10
along with IFN-␥ are increased within stimulated FC (Fig. 5C).
However, IL2 and IL4 were not detected following stimulation of
the FC population. In addition, FC produced high levels of MIP1␣
but did not produce IL1, IL5, and IL13 (data not shown). Prior
studies have demonstrated that CpG-stimulated p-preDC secrete
inflammatory cytokines such as IL6, TNF-␣, and IL12 mostly for
autocrine function. Our observation that CpG-stimulated FC also
secrete these inflammatory cytokines suggest a requirement not
only for FC differentiation but also for subsequent FC-mediated
induction of CD4⫹25⫹ regulatory T cells. The observed production of cytokines supports the induction of a cytokine milieu previously implicated in the differentiation of p-preDC and p-preDCmediated induction of regulatory T cells.
FC-mediated differentiation of CD4⫹25⫺ T cells requires direct
cell interaction
To assess whether FoxP3⫹CD4⫹25⫹ regulatory T cell induction
was merely due to cytokine production via CpG-stimulated FC or
if direct cell-cell interaction between FC and CD4⫹25⫺ T cells
was required, CD4⫹25⫺ T cells were cocultured with FC plus
CpG or separated from FC plus CpG by transwell membranes. As
shown in Fig. 6A, in FC-T cell cocultures 2.26 ⫾ 0.44% of total
CD4⫹ T cells recovered were CD4⫹25⫹ T cells. In contrast, only
0.84 ⫾ 0.11% of total CD4⫹ T cells recovered from the separated
culture were CD4⫹25⫹ T cells, demonstrating that the separation
of FC and CD4⫹25⫺ T cells in culture by transwell resulted in a
nearly 3-fold decrease in the number of generated CD4⫹25⫹ T
cells ( p ⫽ 0.008). Of note, the total numbers of CD4⫹ T cells
recovered were similar for both cocultures and separated cultures.
Importantly, the CD4⫹25⫹ T cells generated from separated cultures did not express the FoxP3 transcript (Fig. 6B), suggesting
that cell-cell contact is required for the development of FoxP3
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 7. CD86 expression is required for the generation of FoxP3⫹CD4⫹25⫹ regulatory T cells. CD86
expression was assessed within unstimulated and CpGstimulated FC. A, Flow cytometric analysis of CD86
demonstrates the increased protein expression of CD86
on FC following CpG-stimualtion (n ⫽ 3). B, Real-time
PCR analysis was performed using equal concentrations
of cDNA from FC that were unstimulated or CpGstimulated for 3 h. The gene expression of CD86 was
normalized to GAPDH expression and is shown as the
percentage of GAPDH. CD86 gene expression is upregulated within CpG-stimulated FC (n ⫽ 3). The realtime data represent average values of duplicate samples
with SEM of three independent experiments. C, AntiCD86 Ab was used in CD4⫹25⫺ T cell cocultures to
assess the direct role of CD86 in FC generation of
FoxP3⫹CD4⫹25⫹ T cells. As expected, the CD4⫹25⫺
T cell cocultures with FC plus CpG and without antiCD86 Ab generated FoxP3⫹CD4⫹25⫹ T cells. In contrast, cocultures with anti-CD86 generated CD4⫹25⫹ T
cells that did not express the FoxP3 transcript. The negative controls (CD4⫹25⫺ T cell cocultures with FC plus
anti-CD86 or anti-CD86 only) did not express the
FoxP3 transcript within the few generated CD4⫹25⫹ T
cells. The real-time PCR data represent average values
of duplicate samples with SEM of three independent
experiments.
2160
expressing CD4⫹25⫹ regulatory T cells. These findings demonstrate that the cytokines produced from stimulated FC are sufficient
to induce the generation of some CD4⫹25⫹ T cells albeit at reduced numbers, whereas direct contact between FC and CD4⫹25⫺
T cells is required for the sustained development of FoxP3⫹
CD4⫹25⫹ regulatory T cells.
CD86 expression on FC is required for the development of
FoxP3⫹CD4⫹25⫹ regulatory T cells
Discussion
FC are currently characterized by their unique ability to promote
the reconstitution of purified allogeneic hemopoietic SC in completely MHC-disparate recipients, without inducing clinical or histological evidence of GVHD, and while conferring transplantation
tolerance (3– 6). Therefore, FC may have a key role in the induction
of immune responses. Previous reports have suggested that the
transfer of FC lead to the development of a regulatory T cell response that is potentially associated with the induction of tolerance
following transplantation (4, 5). However, until now, there has
been no direct evidence to link FC function to a possible role in the
development of regulatory T cells. In the current studies, we have
demonstrated: 1) the induction of donor FoxP3⫹CD4⫹25⫹ regulatory T cells within the spleen of recipients following FC transplantation in vivo, 2) the ability of activated FC to induce
CD4⫹25⫺ T cells to develop into FoxP3⫹CD4⫹25⫹ regulatory T
cells during coculture, and 3) the requirement for direct cell-cell
contact between FC and CD4⫹25⫺ T cells for FC-mediated regulatory T cell development. These findings provide new insights to
understanding the immune regulatory effects of FC transplantation
and the potential therapeutic application in the induction of transplantation tolerance.
Recent emphasis has been placed on the characterization of cells
that permit transplantation tolerance in mouse models with the
intention of developing markers for the clinical induction of tolerance and molecular targets for immune-modulating therapies.
CD4⫹25⫹ regulatory T cells have a critical role in maintaining
immune tolerance and have been described as having a protective
role in GVHD by inhibiting the proliferation and cytokine secretion of CD4⫹ and CD8⫹ effector T cells (22, 24, 37– 40). In al-
logeneic transplantation, only donor CD4⫹25⫹ regulatory T cells
and not host can provide protection against GVHD (22). Therefore, it is important to explore the mechanisms associated with
CD4⫹25⫹ regulatory T cell function following allogeneic hemopoietic cell transplantation. Given that FC transplantation results in
increased donor SC engraftment and induction of tolerance without GVHD similar to that described for CD4⫹25⫹ regulatory T
cell transplantation (22), we hypothesized that the transplantation
of FC may result in the induction of CD4⫹25⫹ regulatory T cells.
In line with these studies using a fully allogeneic (C57BL/6 3
irradiation-conditioned B10.BR) mouse model of SC plus FC
transplantation we have shown that donor CD4⫹25⫹ T cells are
increased in recipients following SC plus FC transplantation when
compared with recipients of SC plus TBM that fail to exhibit longterm donor SC engraftment and also suffer from GVHD. Of note,
the current studies demonstrated that over half of the CD4⫹CD25⫹
T cells that were detected in the spleen of SC plus FC recipients
expressed FoxP3 protein, thus providing evidence of a regulatory
phenotype following FC transplantation (Fig. 2A). Moreover, we
have demonstrated that the CD4⫹25⫹ T cells isolated from the
spleen of SC plus FC recipients dramatically inhibit T cell proliferation in vitro (Fig. 2B). These findings suggest that FC transplantation results in the activation of a regulatory immune response through the induction of CD4⫹25⫹ regulatory T cells.
One way that the immune system can achieve tolerance is through
the induction of peripheral CD4⫹25⫹ regulatory T cells (41, 42).
The induction of Tr1 and CD4⫹25⫹ regulatory T cells, within
peripheral tissue such as the spleen, mediated by activated
p-preDC has been reported (15–18, 43). Although nearly 60% of
the FC population expresses the B220 and CD11c markers that are
also present on p-preDC (5, 20), previous reports have shown that
FC are distinct from p-preDC. These findings demonstrated that
although FC express CD3␧ and the TCR␤-chain, the BM-derived
p-preDC population does not (19, 20).
Given that the spleen represents a primary site for plasmacytoid
DC-mediated peripheral regulatory T cell induction, we hypothesized that if the FC population is directly involved in CD4⫹25⫹
regulatory T cell induction in situ, donor FC should be present
within the spleen of SC plus FC recipients. The current studies
have demonstrated that the induction of peripheral CD4⫹25⫹ regulatory T cells is preceded by the presence of the donor FC within
the recipient spleen as early as 2 wk post-transplantation (Fig. 3).
Importantly, the majority of splenic CD4⫹25⫹ T cells of SC
plus FC recipients are of donor origin and the overall donor chimerism of each recipient was greater than 95%. Therefore, the
interactions between donor cell types are important during immune
responses and our subsequent in vitro studies used a syngeneic in
vitro model for analysis of FC-mediated induction of CD4⫹25⫹
regulatory T cells using FC and CD4⫹25⫺ T cells from C57BL/6
mice. Given that following transplantation, donor FC are present
within the spleen during CD4⫹25⫹ regulatory T cell induction, we
investigated the possible direct role of FC in the differentiation of
naive CD4⫹25⫺ T cells into CD4⫹25⫹ T cells. The establishment
of a cell population that is distinct from p-preDC yet capable of
inducing the development of regulatory T cells will be important to
understanding the role of various cell populations in the activation
of immune response following transplantation. We now have evidence to support a direct role of FC in the generation of CD4⫹25⫹
regulatory T cells, a function previously described as a characteristic of p-preDC.
The function of p-preDC cells is largely dependent upon the
signals that induce their activation and differentiation (7). Activation and maturation signals for p-preDC are cytokines such as IL6,
TNF-␣ and IL12, or TLR activators that include bacterial and viral
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Given the current demonstration that FC and CD4⫹25⫺ T cell
direct interaction is required for the development of FoxP3⫹
CD4⫹25⫹ regulatory T cells in vitro, we hypothesized that the B7
receptor, CD86, would be required for FC function. Therefore, we
evaluated the expression of CD86 on the CpG-stimulated and unstimulated FC population. As demonstrated in Fig. 7A, flow cytometric analysis revealed that the expression of CD86 was increased within CpG-stimulated FC. Furthermore, the protein
expression data were supported with real-time PCR analysis of
CD86 transcript. An increase in the gene expression of CD86 was
detected following CpG-stimulation (Fig. 7B).
To investigate the direct role of CD86 in FC-mediated T cell
differentiation and the subsequent development into regulatory T
cells, CD4⫹25⫺ T cells were cocultured with FC plus CpG in the
presence or absence of anti-CD86 mAb to block any CD86-mediated interaction between FC and the CD4⫹25⫺ T cells. As expected, the CD4⫹25⫹ T cells generated from CpG-stimulated FC
T cell cocultures in the absence of anti-CD86 Ab expressed the
FoxP3 transcript (Fig. 7C). In contrast, the CD4⫹25⫹ T cells generated from cocultures in the presence of anti-CD86 Ab did not
express the FoxP3 transcript. Importantly, these findings demonstrate that FC-T cell interaction is required and dependent on CD86
expression on the FC for the development of FoxP3⫹CD4⫹25⫹ regulatory T cells.
FC INDUCE REGULATORY T CELLS
The Journal of Immunology
stimulation. Furthermore, CD86 expression is required for FCmediated generation of FoxP3⫹CD4⫹25⫹ regulatory T cells. The
current in vitro findings have established that the FC population
can differentiate into an active phenotype and is capable of providing the cytokine milieu and the increased CD86 expression
as required for naive CD4⫹25⫺ T cell differentiation into
FoxP3⫹CD4⫹25⫹ regulatory T cells. Therefore, a mechanism of
FC-mediated peripheral FoxP3⫹CD4⫹25⫹ regulatory T cell induction during SC plus FC reconstitution is suggested. For the first
time, we have linked the function of FC previously described as a
promoter of purified allogeneic SC engraftment in vivo, to the
direct induction of FoxP3⫹CD4⫹25⫹ regulatory T cells. These
findings suggest that the transplantation of FC result in immune
responses that are associated with the induction of splenic
FoxP3⫹CD4⫹25⫹ regulatory T cells. Although we have demonstrated that FC directly induce the generation of FoxP3⫹CD4⫹25⫹
regulatory T cells in vitro, the induction of these cells following
SC plus FC transplantation may not solely be due to FC, as there
are other immune responses and cell-cell interactions that may
parallel FC function and result in the induction or maintenance of
regulatory T cells. Furthermore, other regulatory cells such as Tr1
have been described as having a role in transplantation tolerance
and may be induced following FC transplantation.
In summary, the current studies demonstrate that purified FC are
capable of inducing the generation of FoxP3⫹CD4⫹25⫹ regulatory T cells from naive CD4⫹25⫺ T cells. Thus, suggesting that
the induction of transplantation tolerance in SC plus FC recipients
may be linked to an induction of FoxP3⫹CD4⫹25⫹ regulatory T
cells. Therefore, a mechanism for the role of FC in the induction
of transplantation tolerance following SC plus FC transplantation
has been suggested. Although the direct transplantation of donor
CD4⫹25⫹ regulatory T cells offers great promise, a large number
of unmanipulated fresh donor regulatory T cells and/or ex vivo
manipulation are required before transplantation (22, 24, 53), thus
potentially limiting the use of this therapy. Therefore, the transplantation of limited numbers of donor FC to facilitate allogeneic
SC engraftment and induce FoxP3⫹CD4⫹25⫹ regulatory T cells
in vivo can potentially offer a useful and clinically feasible approach to induce transplantation tolerance and avoid GVHD while
achieving SC engraftment across major histocompatible barriers.
Acknowledgments
We thank the staff at the Smith Animal Facility/Dana Farber Cancer Institute (DFCI) for outstanding animal care. We also thank Peter Schow at
the Dana-Farber Cancer Institute Flow Cytometry Core Facility for cell
sorting and technical assistance.
Disclosures
The authors have no financial conflict of interest.
References
1. Slavin, S., A. Nagler, E. Naparstek, Y. Kapelushnik, M. Aker, G. Cividalli,
G. Varadi, M. Kirschbaum, A. Ackerstein, S. Samuel, et al. 1998. Nonmyeloablative stem cell transplantation and cell therapy as an alternative to conventional
bone marrow transplantation with lethal cytoreduction for the treatment of malignant and nonmalignant hematologic diseases. Blood 91: 756 –763.
2. Hentschke, P., L. Barkholt, M. Uzunel, J. Mattsson, P. Wersall, P. Pisa,
J. Martola, N. Albiin, A. Wernerson, M. Soderberg, et al. 2003. Low-intensity
conditioning and hematopoietic stem cell transplantation in patients with renal
and colon carcinoma. Bone Marrow Transplant. 31: 253–261.
3. Kaufman, C., Y. Colson, S. Wren, S. Watkins, R. Simmons, and S. Ildstad. 1994.
Phenotypic characterization of a novel bone-marrow derived cell that facilitates
engraftment of allogeneic bone marrow stem cells. Blood 84: 2436 –2466.
4. Colson, Y. L., K. Christopher, J. Glickman, K. N. Taylor, R. Wright, and
D. L. Perkins. 2004. Absence of clinical GVHD and the in vivo induction of
regulatory T cells after transplantation of facilitating cells. Blood 104:
3829 –3835.
5. Fugier-Vivier, I. J., F. Rezzoug, Y. Huang, A. J. Graul-Layman, C. L. Schanie,
H. Xu, P. M. Chilton, and S. T. Ildstad. 2005. Plasmacytoid precursor dendritic
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
product such as LPS and nucleic acids. In the current model of SC
plus FC transplantation, it is likely that TLR9 activation on FC
occurs as a result of recipient irradiation-conditioning that makes
nucleic acid products available, such as nonmethylated DNA, for
association with the TLR9 receptor. Therefore, similar to p-preDC,
cytokines and TLR receptor stimulation are important for FC activation and function. As demonstrated in Fig. 4, CpG-stimulated
FC in coculture with CD4⫹25⫺ T cells result in the generation of
CD4⫹25⫹ T cells that express FoxP3. Further analysis of the FCgenerated CD4⫹25⫹ T cells revealed a cytokine gene expression
profile that is consistent with reports that showed CD4⫹25⫹ regulatory T cells generated from naive CD4⫹25⫺ T cells in the periphery expressed higher levels of IL4 when compared with native
CD4⫹25⫹ regulatory T cells (35, 36). Similarly, IL4 gene expression is higher in FC-generated CD4⫹25⫹ T cells than p-preDC
generated T cells. Thus, arguing that FC are not merely p-preDC
but in fact BM-derived FC and p-preDC populations are distinct.
We next examined the production of cytokines by CpG-stimulated FC. An increase in the production of ⌻⌵F-␣ and a markedly
high production of IL6 was observed (Fig. 5, A and B). Therefore,
similar to p-preDC that produce TNF-␣ and IL6 for autocrine
function, FC may differentiate in the presence of TNF-␣ and IL6.
There was no increase in IL12p70 protein, which consists of the
p35 and p40 subunits (Fig. 5A). This may be due to the high production of IL6, as studies have demonstrated that high IL6 expression inhibits IL12p70 production in DC (44 – 46). Secondly, FC
may be similar to thymic-derived plasmacytoid DC that do not
up-regulate IL12p70 expression upon CpG stimulation (47). In
fact, not only are FC present in the spleen, FC have been noted to
migrate to the thymus where they have been thought to play a role
in self-nonself discrimination (48). IL10 is an important immunoregulatory cytokine with a role in the down-regulation of immune
responses. IL10 produced by DC can be used for autocrine function in the alteration of DC maturation for the development of
tolerogenic DC or for the induction of regulatory T cells (49 –51).
Results from the present study indicate an increase in production
of IL10 by FC following CpG stimulation.
Evidence from similar studies demonstrated that TGF-␤ converts naive CD4⫹24⫺ T cells to CD4⫹25⫹ regulatory T cells as
demonstrated by the induction of FoxP3 expression (42). We have
observed that TGF-␤ gene expression is increased in CpG-stimulated FC when compared with unstimulated cells (data not shown).
The findings of the current study demonstrate that activated FC
produce cytokines required for the subsequent generation of
CD4⫹25⫹ regulatory T cells.
We next examined whether the FC-mediated induction of
FoxP3⫹CD4⫹25⫹ regulatory T cells requires direct cell contact or
if it is merely the production of cytokines by activated FC. Using
transwell cocultures, we established that CpG-stimulated FC produce a cytokine environment that facilitates naive CD4⫹25⫺ T cell
differentiation into CD4⫹25⫹ T cells. However, without FC-T cell
contact, fewer of these cells were generated and none expressed
the FoxP3 transcript. Thus, demonstrating that direct FCCD4⫹25⫺ T cell interaction is required for the generation of
FoxP3⫹CD4⫹25⫹ T cells.
The B7 receptors, CD80 and CD86, are required for maintenance or development of a stable population of CD4⫹25⫹ regulatory T cells as studies have demonstrated that B7-deficient mice
have marked reduction in the number of CD4⫹25⫹ regulatory T
cells (25, 52). It is interesting that the regulatory T cell induction
function of the FC is dependent on the direct FC-CD4⫹25⫺ T cell
contact and suggests a possible costimulatory requirement. Therefore, the requirement for CD86 was explored. We have demonstrated that CD86 expression on FC is increased following CpG-
2161
2162
6.
7.
8.
9.
10.
11.
12.
13.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29. Thornton, A. M., and E. M. Shevach. 1998. CD4⫹CD25⫹ immunoregulatory T
cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2
production. J. Exp. Med. 188: 287–296.
30. Gursel, M., D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman. 2002. Differential and competitive activation of human immune cells by distinct classes of
CpG oligodeoxynucleotide. J. Leukocyte Biol. 71: 813– 820.
31. Hara, M., C. I. Kingsley, M. Niimi, S. Read, S. E. Turvey, A. R. Bushell,
P. J. Morris, F. Powrie, and K. J. Wood. 2001. IL-10 is required for regulatory T
cells to mediate tolerance to alloantigens in vivo. J. Immunol. 166: 3789 –3796.
32. Kingsley, C. I., M. Karim, A. R. Bushell, and K. J. Wood. 2002. CD25⫹CD4⫹
regulatory T cells prevent graft rejection: CTLA-4- and IL-10-dependent immunoregulation of alloresponses. J. Immunol. 168: 1080 –1086.
33. Sawitzki, B., C. I. Kingsley, V. Oliveira, M. Karim, M. Herber, and K. J. Wood.
2005. IFN-␥ production by alloantigen-reactive regulatory T cells is important for
their regulatory function in vivo. J. Exp. Med. 201: 1925–1935.
34. Ziegler, S. F. 2006. FOXP3: of mice and men. Annu. Rev. Immunol. 24: 209 –226.
35. Li-Weber, M., M. Giasi, and P. H. Krammer. 1998. Involvement of Jun and Rel
proteins in up-regulation of interleukin-4 gene activity by the T cell accessory
molecule CD28. J. Biol. Chem. 273: 32460 –32466.
36. Siefken, R., S. Klein-Hessling, E. Serfling, R. Kurrle, and R. Schwinzer. 1998. A
CD28-associated signaling pathway leading to cytokine gene transcription and T
cell proliferation without TCR engagement. J. Immunol. 161: 1645–1651.
37. Edinger, M., P. Hoffmann, J. Ermann, K. Drago, C. G. Fathman, S. Strober, and
R. S. Negrin. 2003. CD4⫹CD25⫹ regulatory T cells preserve graft-versus-tumor
activity while inhibiting graft-versus-host disease after bone marrow transplantation. Nat. Med. 9: 1144 –1150.
38. Hoffmann, P., T. J. Boeld, B. Piseshka, and M. Edinger. 2005. Immunomodulation after allogeneic bone marrow transplantation by CD4⫹CD25⫹ regulatory T
cells. Microbes Infect. 7: 1066 –1072.
39. Barthlott, T., H. Moncrieffe, M. Veldhoen, C. J. Atkins, J. Christensen, A.
O’Garra, and B. Stockinger. 2005. CD25⫹ CD4⫹ T cells compete with naive
CD4⫹ T cells for IL-2 and exploit it for the induction of IL-10 production. Int.
Immunol. 17: 279 –288.
40. von Boehmer, H. 2005. Mechanisms of suppression by suppressor T cells. Nat.
Immunol. 6: 338 –344.
41. Waldmann, H., T. C. Chen, L. Graca, E. Adams, S. Daley, S. Cobbold, and
P. J. Fairchild. 2006. Regulatory T cells in transplantation. Semin. Immunol. 18:
111–119.
42. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and
S. M. Wahl. 2003. Conversion of peripheral CD4⫹CD25- naive T cells to
CD4⫹CD25⫹ regulatory T cells by TGF-␤ induction of transcription factor
Foxp3. J. Exp. Med. 198: 1875–1886.
43. Yamazaki, S., T. Iyoda, K. Tarbell, K. Olson, K. Velinzon, K. Inaba, and
R. M. Steinman. 2003. Direct expansion of functional CD25⫹ CD4⫹ regulatory
T cells by antigen-processing dendritic cells. J. Exp. Med. 198: 235–247.
44. Takenaka, H., S. Maruo, N. Yamamoto, M. Wysocka, S. Ono, M. Kobayashi,
H. Yagita, K. Okumura, T. Hamaoka, G. Trinchieri, and H. Fujiwara. 1997.
Regulation of T cell-dependent and -independent IL-12 production by the three
Th2-type cytokines IL-10, IL-6, and IL-4. J. Leukocyte Biol. 61: 80 – 87.
45. La Flamme, A. C., A. S. MacDonald, and E. J. Pearce. 2000. Role of IL-6 in
directing the initial immune response to schistosome eggs. J. Immunol. 164:
2419 –2426.
46. Dodge, I. L., M. W. Carr, M. Cernadas, and M. B. Brenner. 2003. IL-6 production
by pulmonary dendritic cells impedes Th1 immune responses. J. Immunol. 170:
4457– 4464.
47. Okada, T., Z. X. Lian, M. Naiki, A. A. Ansari, S. Ikehara, and M. E. Gershwin.
2003. Murine thymic plasmacytoid dendritic cells. Eur. J. Immunol. 33:
1012–1019.
48. Gangopadhyay, N. N., H. Shen, R. Landreneau, J. D. Luketich, and M. J.
Schuchert. 2004. Isolation and tracking of a rare lymphoid progenitor cell which
facilitates bone marrow transplantation in mice. J. Immunol. Methods 292:
73– 81.
49. Steinbrink, K., M. Wolfl, H. Jonuleit, J. Knop, and A. H. Enk. 1997. Induction of
tolerance by IL-10-treated dendritic cells. J. Immunol. 159: 4772– 4780.
50. Caux, C., C. Massacrier, B. Vanbervliet, C. Barthelemy, Y. J. Liu, and
J. Banchereau. 1994. Interleukin 10 inhibits T cell alloreaction induced by human
dendritic cells. Int. Immunol. 6: 1177–1185.
51. Carbonneil, C., H. Saidi, V. Donkova-Petrini, and L. Weiss. 2004. Dendritic cells
generated in the presence of interferon-␣ stimulate allogeneic CD4⫹ T-cell proliferation: modulation by autocrine IL-10, enhanced T-cell apoptosis and T regulatory type 1 cells. Int. Immunol. 16: 1037–1052.
52. Lohr, J., B. Knoechel, S. Jiang, A. H. Sharpe, and A. K. Abbas. 2003. The
inhibitory function of B7 costimulators in T cell responses to foreign and selfantigens. Nat. Immunol. 4: 664 – 669.
53. Taylor, P. A., R. J. Noelle, and B. R. Blazar. 2001. CD4⫹CD25⫹ immune regulatory cells are required for induction of tolerance to alloantigen via costimulatory blockade. J. Exp. Med. 193: 1311–1318.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
14.
cells facilitate allogeneic hematopoietic stem cell engraftment. J. Exp. Med. 201:
373–383.
Gandy, K. L., J. Domen, H. Aguila, and I. L. Weissman. 1999. CD8⫹TCR⫹ and
CD8⫹TCR⫺ cells in whole bone marrow facilitate the engraftment of hematopoietic stem cells across allogeneic barriers. Immunity 11: 579 –590.
Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cells in
immunity. Nat. Immunol. 5: 1219 –1226.
Sparwasser, T., R. M. Vabulas, B. Villmow, G. B. Lipford, and H. Wagner. 2000.
Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent
cytotoxic T cell responses to soluble proteins. Eur. J. Immunol. 30: 3591–3597.
Bauer, M., V. Redecke, J. W. Ellwart, B. Scherer, J. P. Kremer, H. Wagner, and
G. B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of
human CD11c⫺, CD123⫹ dendritic cells. J. Immunol. 166: 5000 –5007.
Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan,
and Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different
toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:
863– 869.
Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K.
Ballas, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Identification of CpG
oligonucleotide sequences with high induction of IFN-␣/␤ in plasmacytoid dendritic cells. Eur. J. Immunol. 31: 2154 –2163.
Krieg, A. M. 2003. CpG motifs: the active ingredient in bacterial extracts? Nat.
Med. 9: 831– 835.
Verthelyi, D., and R. A. Zeuner. 2003. Differential signaling by CpG DNA in
DCs and B cells: not just TLR9. Trends Immunol. 24: 519 –522.
Lutz, M. B., and G. Schuler. 2002. Immature, semi-mature and fully mature
dendritic cells: which signals induce tolerance or immunity? Trends Immunol. 23:
445– 449.
Jonuleit, H., E. Schmitt, G. Schuler, J. Knop, and A. H. Enk. 2000. Induction of
interleukin 10-producing, nonproliferating CD4⫹ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells.
J. Exp. Med. 192: 1213–1222.
Roncarolo, M. G., M. K. Levings, and C. Traversari. 2001. Differentiation of T
regulatory cells by immature dendritic cells. J. Exp. Med. 193: F5–F9.
Wakkach, A., N. Fournier, V. Brun, J. P. Breittmayer, F. Cottrez, and H. Groux.
2003. Characterization of dendritic cells that induce tolerance and T regulatory 1
cell differentiation in vivo. Immunity 18: 605– 617.
Moseman, E. A., X. Liang, A. J. Dawson, A. Panoskaltsis-Mortari, A. M. Krieg,
Y. J. Liu, B. R. Blazar, and W. Chen. 2004. Human plasmacytoid dendritic cells
activated by CpG oligodeoxynucleotides induce the generation of CD4⫹CD25⫹
regulatory T cells. J. Immunol. 173: 4433– 4442.
Schuchert, M. J., R. D. Wright, and Y. L. Colson. 2000. Characterization of a
newly discovered T-cell receptor ␤-chain heterodimer expressed on a CD8⫹ bone
marrow subpopulation that promotes allogeneic stem cell engraftment. Nat. Med.
6: 904 –909.
Taylor, K. N., V. R. Shinde Patil, and Y. L. Colson. 2006. Reconstitution of
allogeneic hemopoietic stem cells: the essential role of FcR␥ and the TCR
␤-chain-FCp33 complex. J. Immunol. 177: 1444 –1450.
Hanash, A. M., and R. B. Levy. 2005. Donor CD4⫹CD25⫹ T cells promote
engraftment and tolerance following MHC-mismatched hematopoietic cell transplantation. Blood 105: 1828 –1836.
Hoffmann, P., J. Ermann, M. Edinger, C. G. Fathman, and S. Strober. 2002.
Donor-type CD4⫹CD25⫹ regulatory T cells suppress lethal acute graft-versushost disease after allogeneic bone marrow transplantation. J. Exp. Med. 196:
389 –399.
Cohen, J. L., A. Trenado, D. Vasey, D. Klatzmann, and B. L. Salomon. 2002.
CD4⫹CD25⫹ immunoregulatory T Cells: new therapeutics for graft-versus-host
disease. J. Exp. Med. 196: 401– 406.
Taylor, P. A., C. J. Lees, and B. R. Blazar. 2002. The infusion of ex vivo activated
and expanded CD4⫹CD25⫹ immune regulatory cells inhibits graft-versus-host
disease lethality. Blood 99: 3493–3499.
Salomon, B., D. J. Lenschow, L. Rhee, N. Ashourian, B. Singh, A. Sharpe, and
J. A. Bluestone. 2000. B7/CD28 costimulation is essential for the homeostasis of
the CD4⫹CD25⫹ immunoregulatory T cells that control autoimmune diabetes.
Immunity 12: 431– 440.
Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, and M. Toda. 1995. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor
␣-chains (CD25): breakdown of a single mechanism of self-tolerance causes
various autoimmune diseases. J. Immunol. 155: 1151–1164.
Thornton, A. M., and E. M. Shevach. 2000. Suppressor effector function of
CD4⫹CD25⫹ immunoregulatory T cells is antigen nonspecific. J. Immunol. 164:
183–190.
Piccirillo, C. A., and E. M. Shevach. 2001. Cutting edge: control of CD8⫹ T
cell activation by CD4⫹CD25⫹ immunoregulatory cells. J. Immunol. 167:
1137–1140.
FC INDUCE REGULATORY T CELLS