Download Expression and activity of hexokinase in the early mouse embryo

Molecular Human Reproduction vol.2 no.10 pp. 793-798, 1996
Expression and activity of hexokinase in the early mouse embryo
F.D.Houghton1-3, B.Sheth2, B.Moran2, H.J.Leese1 and T.P.Fleming2
department of Biology, University of York, PO Box 373, York YO1 5YW, and department of Biology,
University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK
^o whom correspondence should be addressed
The maximal activity and Michaelis constant. KM, of hexokinase have been measured in the peri-implantation
mouse embryo using an ultramicrofluorescence technique. In addition, transcript detection of the predominant
isoenzyme hexokinase I has been determined in single preimplantation mouse embryos at successive stages
of development using reverse transcriptase-mediated cDNA amplification. Maximal hexokinase activity
decreased dramatically peri-implantation, from 0.97 ± 0.19 nmol/ng protein/h at the blastocyst stage to
0.31 ± 0.05 nmol/|i.g protein/h on day 6.5. The KM remained relatively low and constant over this period
(0.23-0.39 mM), indicating the absence of the hexokinase type IV isoenzyme. The pattern of hexokinase
activity resembled that of glucose consumption suggesting a possible regulatory role for the enzyme during
this period of development. Hexokinase I mRNA was detected in the oocyte and all preimplantation stages
of development. The blastocyst polymerase chain reaction (PCR) product, when cloned and sequenced was
found to be 98% homologous with mouse tumour hexokinase I. Taken together, these data suggest that the
hexokinase gene is not under transcriptional control during early mouse embryo development but plays a
significant role in the regulation of glucose consumption. A role for hexokinase in the phosphate-induced
inhibition of early embryo development is also proposed.
Key words: enzyme activity/hexokinase/mouse embryo/polymerase chain reaction
Introduction
Pyruvate is required to support the first cleavage division of
mouse preimplantation embryos and is the predominant energy
substrate utilized until the morula stage (Brinster, 1965a;
Biggers et al., 1967; Whitten and Biggers, 1968; Leese and
Barton, 1984; Gardner and Leese, 1986). Glucose as the sole
energy source is unable to support development until the 4—
8-cell stage (Brinster, 1965b; Brinster and Thomson, 1966)
but becomes the main substrate at the blastocyst stage. The
switch from pyruvate to glucose occurs at ~99 h after human
chorionic gonadotrophin (HCG) administration (Martin and
Leese, 1995). Immediately after implantation, glucose remains
the predominant energy substrate and the majority of glucose
consumed can be accounted for by lactate appearance in
embryos from the mouse (Clough and Whittingham, 1983;
Houghton et al., 1996) and rat (Ellington, 1987). The glucose
transporter, GLUT 1, is present throughout mouse preimplantation development and glucose entry into the cell is unlikely to be
impeded (Hogan, 1991). Thus, the block to glucose utilization
during early preimplantation development is more likely to
reside with the enzymatic control of glucose metabolism.
Three enzymes of glycolysis, which catalyse reactions far
from equilibrium, are traditionally thought to be rate limiting;
hexokinase, phosphofructokinase and pyruvate kinase
(Newsholme and Start, 1973; Newsholme and Leech, 1989).
In the mammalian embryo, measurements of maximal enzyme
activity have suggested a possible regulatory role for hexo© European Society for Human Reproduction and Embryology
kinase, the first enzyme of glycolysis, in glucose utilization,
while regulation by phosphofructokinase cannot be disregarded
due to its allosteric properties (Barbehenn et al., 1974, 1978).
In the mouse, hexokinase activity increases from the 8—16cell to the blastocyst stage (Hooper and Leese, 1989; Ayabe,
1994), a rise coincident with that of glucose uptake (Leese
and Barton, 1984). The low activity of hexokinase during
the early preimplantation stages has been suggested as an
explanation of the inability of these embryos to consume
glucose (Brinster, 1968; Barbehenn, 1974, 1978; Hooper and
Leese, 1989).
There are four isoenzymes of hexokinase in mammalian
tissues; types I-IV, but biochemical measurements of enzyme
activity are unable to differentiate between the various types.
Hexokinase I—III are 100 kDa proteins with a low Michaelis
constant, KM, for glucose, whereas hexokinase IV is a 50 kDa
protein with a high KM for glucose (Preller and Wilson, 1992).
The relative proportions of the isoenzymes vary in different
tissues: hexokinase I is the predominant isoenzyme in glucosedependent tissues such as the brain (Schwab and Wilson,
1989); hexokinase II predominates in skeletal muscle (Thelen
and Wilson, 1991) and other insulin-sensitive tissues; hexokinase III, with the exception of pig erythrocytes (Magnani
et al., 1983; Stocchi et al, 1983), has not been found to
predominate in any cell type; hexokinase IV (glucokinase) is
found only in liver (Katzen and Schimke, 1965) and pancreatic
fj-cells (Magnuson and Shelton, 1989). It is thought that the
100 kDa proteins have evolved from gene duplication and
793
F.D.Houghton et al.
fusion of an ancestral form of the yeast hexokinase (Ureta,
1982). Hexokinase I has been the most extensively studied
(largely in the rat) and is the only isoenzyme whose DNA
sequence is available for mouse, derived from tumour tissue
(Arora et al., 1990). The gene consists of two structural halves,
both coding for proteins containing an ATP and a glucose
binding site (Arora et al, 1990). The C-terminal half provides
the catalytic function (Schirch and Wilson, 1987; White and
Wilson, 1989) with the A'-terminal half providing enzyme
regulation by binding glucose-6-phosphate (White and Wilson,
1990). There is also a hydrophobic region, necessary for
binding hexokinase to the outer mitochondrial membrane. To
date, there have been no reports on the gene expression of
hexokinase in preimplantation embryos.
We have investigated maximal hexokinase activity in single
mouse blastocysts and in single postimplantation embryos on
6.5 and 7.5 days of gestation using an ultramicrofluorescence
assay based on that of Martin et al. (1993). The enzyme
kinetics of hexokinase have also been examined to determine
the A"M and V,™,, during the peri-implantation period to discover
whether the type IV (high KM) isoenzyme is present. In
addition, hexokinase I mRNA analysis in single mouse embryos
at successive stages of preimplantation development has been
determined by reverse transcriptase-mediated cDNA amplification using a technique based on that of Collins and Fleming
(1995). The polymerase chain reaction product from blastocysts
was cloned, sequenced and sequence homology with mouse
tumour hexokinase I cDNA determined.
Materials and methods
Ovulation was stimulated in virgin mice, 6-8 weeks old of the strain
CBA/Ca using 5 IU (0.1 ml) pregnant mare's serum gonadotrophin
(PMSG, Folligon; Intervet, Cambridge, UK) administered by i.p.
injection between 1200-1400 h. This was followed 48 h later by an
i.p. injection of 5 IU (0.1 ml) of HCG (Chorulon; Intervet). Females
were immediately placed with MF1 males and the presence of a
vaginal plug the following morning was taken as an indication that
mating had occurred.
Embryo recovery
Embryos were recovered from the dam at 1400 h on day 2 postfertilization when they were at the 2-cell stage. Embryos were
retrieved by flushing the oviducts with H6, a HEPES-buffered
medium before being transferred into T6 medium (Whittingham,
1971) containing 5.5 mM glucose, 0.25 mM pyruvate and 2.5 mM
lactate, and cultured under pre-equilibrated paraffin oil at 37°C in a
humidified atmosphere of 5% CO2 in air.
Extraction of poly (A)* mRNA
mRNA was extracted from single preimplantation mouse embryos
according to the method of Sheardown (1992). To avoid the amplification of any contaminating DNA all solutions were subjected to
5000X100 UJ/cm of UV-irradiation (Spectrolinker XL-1000; Scotlab,
Strathclyde, UK). Embryos were removed from culture and placed
onto 2 mm squares of messenger affinity paper (MAP; Amersham
International, Amersham, UK) in a minimal volume of T6 medium.
The RNA was extracted from the embryos by the addition of 10 (J.1
Tris-buffered 4 M guanidinium isothiocyanate (pH 7.5) containing
1% (J-mercaptoethanol, dispensed in 1 u.1 droplets. The samples were
794
1
51l
4
- N-tennlnal half
-X-
Sequences
poly A
tail
C-tamliul half •
Position
1 - CACACAACATCGTGCACG
344-361
2 - CATTACGAATTCGATCACGTCCCTG
382-394
3 - CATTACCAATTCCATGTAGCAAGC
706-716
4 - GTCGATGTGTCGCACTTC
721-738
Figure 1. Primers used for DNA amplification designed to mouse
hepatoma hexokinase I cDNA (Arora et al., 1990). Arrowheads
mark the position of primers (sequences below) and direction of
cDNA synthesis. Nested primers were designed with EcoRl
restriction sites underlined, for cloning of products. A hydrophobic
domain ( • ) , ATP binding domains (•) and glucose binding
domains (0) are also indicated.
washed by vortexing three times in 400 ul NaCl followed by two
washes in 80% ethanol before being stored under ethanol at -70°C
for a maximum of 2 weeks.
Reverse transcription
The production of a first strand cDNA template and product amplification were conducted according to the method of Collins and Fleming
(1995). First strand cDNA synthesis was performed in a total volume
of 20 ul. The reaction mixture contained 50 mM Tris-HCl pH 8.3,
75 mM KC1, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 1 mM of
each dNTP, 1 uM outer antisense hexokinase primer 4 (Figure 1),
35 IU RNAguard ribonuclease inhibitor (Pharmacia, St Albans, UK)
and 200 IU Moloney-murine leukaemia virus (M-MLV) reverse
transcriptase (Gibco-BRL, Paisley, UK). The samples were incubated
for 10 min at 27°C followed by 45 min at 37°C and 5 min at 95°C.
First stage cDNA amplification
Amplification of the first strand cDNA product was performed using
outer hexokinase primers 1 and 4 (Figure 1) in a total volume of
45 ul. The reagents were added above solidified Dynawax (Flourgen
Instruments Ltd, Lichfield, UK) and contained 4.5 u.1 10X Vent buffer
(100 mM KC1, 100 mM (NH^SC^, 200 mM Tris-HCl pH 8.8,
20 mM MgSO4, 1% Triton X-100) as supplied with Vent DNA
polymerase (New England Biolabs, Hitchin, UK), 0.6 uM of the
outer antisense and 1 uM of the sense outer primer. The first strand
template (20 u.1) was added and the samples heated to 65°C for 5 min
(hot start). After cooling the samples on ice, false priming was
eliminated by adding 1 IU of Vent polymerase in 5 (il IX Vent buffer
above solidified wax. The reaction was cycled 30 times at 95°C for
30 s, 72°C for 60 s and 56°C for 60 s.
Second stage cDNA amplification
Further amplification of the first stage product was performed using
nested hexokinase primers 2 and 3 (Figure 1). For each sample, a
43 uJ reaction mixture was prepared containing 4.5 ul 10X Vent
buffer, 10 mM dNTPs, 1 uM of each primer and 2 ul of the first
stage template. 1 IU of Vent polymerase was again added above
solidified wax using hot start as described above. The reaction was
cycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s.
Two control samples were performed concurrently with each
experiment; a MAP control conducted in the absence of an embryo
and a reagent control performed in the absence of MAP. These
eliminate any potential involvement of environmentally introduced
DNA contamination of samples. The technique has also been shown
Hexokinase in the mouse embryo
to eliminate genomic DNA contamination from the embryos (Collins
and Fleming, 1995). Amplified cDNA products were analysed on 1%
agarose gels in Tris borate EDTA (pH 8.0) buffer, stained with 1 (ig/ml
ethidium bromide and photographed using a Polaroid DS34 instant
camera on 667 Polaroid film.
Cloning and sequencing reaction
The cDNA amplification product from blastocysts was digested with
EcoRl, purified on a Wizard polymerase chain reaction (PCR) column
(Promega, Southampton, UK) and ligated into a pGEX:lXT vector
(Pharmacia). The ligation reaction was dialysed over 10% glycerol
before being electroporated into DH5ct competent cells (Cambridge
Bioscience, Cambridge, UK). The transformed cells were grown and
plasmid DNA purified using an alkaline lysis method (Sambrook
et al., 1989). The orientation of the insert was determined by digestion
with BamHl and Bsaml. A total of five clones with the insert in
both the correct and incorrect orientation were further purified using
a Wizard miniprep purification system (Promega) and sequenced
using the sequenase version 2.0 kit (Amersham, Little Chalfont,
UK) with a 5' pGEX primer (CTGGCAAGCCACGTTTGGTG).
Sequences were read in both directions and analysed using a DNAStar
computer programme (DNAStar Ltd, London, UK).
Procedure to extract enzymes from early mouse embryos
Individual day 4 freshly flushed blastocysts were transferred to a
microcapillary tube containing between 1-2 |il of enzyme extraction
buffer [25% glycerol, 1 mM EDTA, 100 mM K2HPO4) 5 mM
2-mercaptoethanol, 2 mg/ml bovine serum albumin (BSA), 0.5%
Triton X-100 pH 7.5]. These volumes were sufficient to perform both
sample and control experiments. The ends of the microcapillary tubes
were sealed with parafilm and immediately stored at -70°C. Single
postimplantation embryos on day 6.5 and 7.5 post-fertilization were
transferred to microcentrifuge tubes containing 15-30 u.1 of enzyme
extraction buffer and homogenized before being stored at -70°C. The
extraction buffer was based on that from Chi et al. (1988) and Martin
et al. (1993) and acted to release and solubilize the enzymes as well
as protect against degradation.
Measurement of maximal hexokinase (EC 2.7.1.1) activity
After thawing on ice, the embryo extract was expelled under oil on
a siliconized microscope slide. A 0.2-1.0 |il sample of the embryo
extract was placed on a clean siliconized microscope slide and 0.20.5 ul of reaction media (5 mM MgCl2, 5 mM ATP, 1.5 mM NADP + ,
I mM glucose, 100 mM triethanolamine, 5 IU/ml glucose-6-phosphate
dehydrogenase, pH 7.6) added. This was immediately taken up in a
5 |il microcapillary tube and the ends sealed with parafilm. The rate
of reaction was assessed with time by measuring the appearance of
NADPH. The samples were excited at 340 nm and the emitted
light collected at 459 nm and above using a Fluovert fluorescence
microscope with photomultiplier and photometer attachments (Leica,
Milton Keynes, UK). Reactions were conducted at 20°C over a period
of ~60 min. There was a linear rate of reaction and an increase in
fluorescence as the reaction proceeded due to the reduction of NADP +
to NADPH. For each measurement of maximal enzyme activity a
control sample was also run, using a reaction mixture containing all
the reagents with the exception of the enzyme substrate. This allowed
any endogenous oxidation or reduction of co-factors to be determined.
The increase in fluorescence was measured against an NADH standard
curve over the range of 0-0.2 mM. Kinetic experiments were
performed to calculate the KM and V ^ of hexokinase at the
blastocyst, day 6.5 and 7.5 stage, using reaction mixtures containing
glucose in the range O-l.O mM. Data were expressed as LineweaverBurk plots; l/s versus l/v.
oocytt
2-c*ll
8-ctU
moral* bUatocyit day 6J
dxy 7.5
Figure 2. Relationship between maximal hexokinase activity ( • )
and glucose consumption (O) by the early mouse embryo. Values
of hexokinase activity for the oocyte to morula stage embryos are
taken from Hooper and Leese (1989), the figures for glucose
consumption from Houghton et al. (1996). Values are the mean of
between six and nine observations ± SEM.
Statistical analysis
Maximal enzyme activities were expressed as pmol/embryo/h or
pmol/ng protein/h. Values of protein content for blastocysts were
those of Sellens et al. (1981) and for postimplantation embryos, from
Houghton et al. (1996). Hexokinase activity between stages was
compared by one-way analysis of variance; differences between
individual means were compared by Fisher's test.
Results
Maximal hexokinase activity has been determined in extracts
of single blastocysts, day 6.5 and 7.5 embryos. Hexokinase
activity increased from 0.025 ± 0.005 nmol/embryo/h on day
4 to 1.33 ± 0.22 on day 6.5 before increasing significantly
(P < 0.01) to 7.92 ± 0.87 nmol/embryo/h on day 7.5. To
compare the activity between the peri-implantation stages, it
was necessary to take into account the protein content of these
embryos. Figures for protein content at the blastocyst stage
were obtained from Sellens et al. (1981); those at day 6.5 and
7.5 from Houghton et al. (1996), who found an increase in
protein of 170-fold and 4.5-fold between the blastocyst and
day 6.5 embryo, and the day 6.5 and day 7.5 embryos
respectively. When this was performed, hexokinase activity
decreased significantly {P <0.01) from 0.97 ± 0 . 1 9 nmol/|ig
protein/h at the blastocyst stage to 0.31 ± 0.05 nmol/(ig
protein/h on day 6.5 (Figure 2). On day 7.5, hexokinase activity
was 0.42 ± 0.05 nmol/flg protein/h, significantly lower (P
<0.01) than that at the blastocyst stage but not from that on
day 6.5. The KM for hexokinase was determined over the periimplantation stages by measuring the maximal activity at
varying substrate concentrations (Figure 3). The KM was 0.39,
0.23 and 0.23 mM glucose for the blastocyst, day 6.5 and day
7.5 stages respectively.
The presence of mRNA for hexokinase I in the preimplantation mouse embryo was characterized by reverse transcription
(RT)-cDNA amplification using primers designed against
mouse tumour hexokinase I cDNA (Arora et al., 1990). Using
these primers, the /V-terminal glucose binding domain of
hexokinase I was amplified from single-staged embryos. Transcripts were detected at all stages of development with the
production of a single 334 bp cDNA fragment (Figure 4) from
795
F.D.Houghton et al.
0.30-
E o
0.20-
§•!•
I
1
. 4 - 2
0
2
4
6
8
10
12
14
1
1/substrate concentration (mM' )
1 m
Figure 4. Detection of hexokinase transcripts by reverse
transcription-cDNA amplification of single mouse embryos
throughout preimplantation development. Lanes (a, m) 100 bp
markers, arrowheads at 600 bp; (b) oocyte; (c) zygote; (d) 2-cell;
(e) 4-cell; (f) pre-compact 8-cell; (g) compact 8-cell; (h) 16-cell;
(i) morula; (j) blastocyst; (k) no template control; (1) reagent
control.
-6-4-2
0
2
4
6
8
10 12 14 16 18 20 22
1/substrate concentration (mM''l
S
10 12 14 16 IS 20 22
1
l-ll
1/substrate concentration (mM'
)
Figure 3. Lineweaver-Burk plot of hexokinase by the blastocyst
(•), day 6.5 (A) and day 7.5 (O) embryo. Values are the mean of
four to six determinations ± SEM.
the oocyte and zygote to the blastocyst stage (n = 2 5 determinations for each developmental stage). When the
blastocyst PCR product from five separate clones, with the
cDNA insert cloned in both orientations, was sequenced and
analysed by the Wilbur and Lipman method (1983) using a
DNAStar computer programme, it was found to be 98%
homologous with mouse tumour hexokinase I (Arora et al.,
1990).
Discussion
Hexokinase activity has previously been measured in preimplantation embryos from the mouse (Brinster, 1968; Chi
et al., 1988; Hooper and Leese, 1989; Ayabe et al, 1994) and
human (Chi et al., 1988; Martin et al., 1993). All these reports
found that activity increases at the blastocyst stage when
796
glucose consumption rises, suggesting a possible role for this
enzyme in regulating glucose metabolism.
Our values for the maximal hexokinase activity for mouse
blastocysts were comparable to those obtained by Hooper and
Leese (1989) who used a similar technique, but ~30% higher
than those of Ayabe et al. (1994) who used a freeze drying
method and performed enzyme recycling techniques to amplify
the fluorescence signal.
The hexokinase activity of early mouse postimplantation
embryos has not previously been reported. Activity over the
peri-implantation period was found broadly to parallel that of
glucose consumption suggesting a regulatory role for hexokinase during this time. At each stage, blastocyst, day 6.5
and day 7.5, hexokinase activity exceeded that of glucose
consumption by factors of 3.4, 1.4 and 2.5 respectively. During
the preimplantation period, prior to the blastocyst stage,
hexokinase activity is initially very low but then increases
(Hooper and Leese, 1989) coincident with a rise in glucose
consumption (Leese and Barton, 1984). It is likely, however,
that hexokinase activity in vivo is below the maximal in-vitro
rates measured, due to feedback inhibition from glucosesphosphate and other factors. The true ratio of hexokinase to
glucose consumption in vivo, is therefore likely to be closer
to unity.
Our limited kinetic characterization of mouse hexokinase
indicates that hexokinase IV, which has a high KM for glucose,
~10 mM, is unlikely to be present. The KM obtained for all
peri-implantation stages was low (0.23—0.39 mM) indicating
a high binding capacity and therefore the possible presence of
hexokinase I, II or III. Hexokinase II predominates in insulin
sensitive tissues and although insulin increases protein synthesis and cell number in the early mouse embryo (Gardner
and Kaye, 1991), it has no effect on glucose consumption in
the peri-implantation mouse embryo (F.D.Houghton et al.,
unpublished observation). This is not surprising, since the
insulin sensitive glucose transporter GLUT 4 is not expressed
at this stage of development (Hogan, 1991). The presence of
hexokinase HI is also unlikely, since with the exception of pig
erythrocytes, this isoenzyme has only been found in very small
Hexokinase in the mouse embryo
Table I. Sequence homology between mouse blastocyst cDNA hexokinase
product and other isoenzymes
Species/hexokinase
isoenzyme
Homology with Reference
PCR product (%)
Mouse tumour I
Rat brain I
Rat skeletal muscle II
Rat liver HI
Rat pancreatic f}-cell IV
98
93
72
64
71
Arora et al. (1990)
Schwab and Wilson (1989)
Thelen and Wilson (1991)
Schwab and Wilson (1991)
Magnuson and Shelton (1989)
PCR = polymerase chain reaction.
amounts in mammalian cells. We therefore investigated the
gene expression of hexokinase I in the preimplantation
mouse embryo.
The RT-PCR data indicated the presence of hexokinase I
mRNA throughout all stages of preimplantation development.
When cloned and sequenced, the PCR product was 98%
homologous with mouse tumour hexokinase I and displayed a
high degree of homology with rat hexokinase I (Table I). At
the present time, there are no sequence data available for
mouse hexokinase II-TV, although when compared with rat
isoenzymes II, m and IV the results obtained were consistent,
with -70% homology, suggesting that it is a member of the
same family (Deeb et al, 1993).
Since the hexokinase I gene is switched on and transcription
occurs throughout preimplantation development, the increase
in hexokinase activity seen at the blastocyst stage cannot be
attributed to de novo synthesis of hexokinase I mRNA. The
RT-PCR technique used in this report simply indicates the
presence or absence of transcripts and does not quantitate or
measure stability of the mRNA. Hence, it is feasible that an
increase in the stability of hexokinase I mRNA at the morula
stage, could result in increased translation of the hexokinase I
protein. This in turn could account for the significant increase
in enzyme activity observed at the blastocyst stage. Temporal
regulation of hexokinase activity in the late morula is therefore
distinct from that of other genes upregulated at this stage, such
as desmocollin (DSC2) and ZO-1 oc+ isoform. These proteins
are involved in intercellular adhesion and mRNA transcripts
from their genes are first expressed at the morula stage (Collins
et al, 1995; Sheth et al, 1995). These transcripts are then
rapidly translated and the proteins assembled at the junctions,
indicating that they are controlled at the transcriptional level.
Further studies to investigate the gene regulation of hexokinase
I would require a complete DNA sequence; experiments to
measure the influence of regulatory proteins on the stability
of the mRNA could then be conducted.
When represented on a pmol/|ig protein/h basis, hexokinase
activity at the postimplantation stages is comparable to that of
the morula—a stage of development where there is a transition
from a metabolism based on pyruvate to one dependent on
glucose. These considerations and the decrease in hexokinase
on days 6.5 and 7.5 suggest that glucose is not a major energy
substrate in day 6.5 and 7.5 mouse embryos.
Hexokinase and the role of inorganic phosphate in
early mouse embryo development
Barnett and Bavister (1996) reported that glucose and inorganic
phosphate (Pj) were inhibitory to hamster 2-cell embryo
development. Since P, is known to stimulate glycolysis, a
pathway potentially deleterious to the embryo (Gardner and
Leese, 1990; Leese, 1991), the most likely explanation for this
phenomenon is that conversion of glucose to lactate is
enhanced. Hexokinase, the first enzyme of glycolysis, is
inhibited by its product, glucose 6-phosphate, an inhibition
relieved by P, (Uyeda and Racker, 1965). We postulate that
omitting P, from embryo culture media allows glucose 6phosphate to inhibit hexokinase and in this way limit the
extent of glycolysis. This proposition is obviously testable.
In conclusion, the maximal activity and KM of hexokinase
has been measured in single peri-implantation mouse embryos.
The profile of activity had a similar pattern to glucose
consumption over this period. In addition using RT-PCR,
hexokinase I mRNA was detected at all stages of preimplantation development.
Acknowledgements
The authors wish to thank Mark Hay for his technical assistance
during this study. F.D.H. is a recipient of a BBSRC Studentship.
Further financial support was obtained from grants by the Wellcome
Trust and MRC to T.P.F.
References
Arora, K.K., Fanciulli, M. and Pedersen, P.L. (1990) Glucose phosphorylation
in tumor cells. J. Biol. Chem., 265, 6481-6488.
Ayabe, T, Tsutsumi, O and Taketani, Y. (1994) Hexokinase activity in mouse
embryos developed in vivo and in vitro. Hum. Reprod., 9, 347—351.
Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1974) The explanation for
the blockage of glycolysis in early mouse embryos. Proc. Nail. Acad. Sci.
USA, 71, 1056-1060.
Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1978) Measurement of
metabolites in single preimplantation embryos: a means to study metabolic
control in early embryos. J. Emb. Expt. Morph., 43, 29—46.
Barnett, D.K. and Bavister, B.D. (1996) Inhibitory effect of glucose and
phosphate on the second cleavage division of hamster embryos: is it linked
to metabolism? Hum. Reprod., 11, 177-183.
Biggers, J.D., Whittingham, D.G. and Donahue, R.P. (1967) The pattern of
energy metabolism in the mouse oocyte and zygote. Proc. Nail. Acad. Sci.
USA, 58, 560-567
Bnnster, R.L. (1965a) Studies on the development of mouse embryos in vitro.
II The effect of energy source. J. Exp. Zool., 158, 59-68.
Brinster, R.L. (1965b) Studies on the development of mouse embryos in vitro.
IV Interaction of energy source. /. Reprod. Fertil., 10, 227-240.
Brinster, R.L. (1968) Hexokinase activity in the preimplantation mouse
embryo. Enzymologia, 34, 304-308.
Brinster, R.L. and Thomson, J.L. (1966) Development of eight-cell mouse
embryos in vitro. Exp. Cell. Res., 42, 308-315.
Chi, M.M.-Y., Manchester, J.K., Yang, V.C. et al. (1988) Contrast in levels
of metabolic enzymes in human and mouse ova. Biol. Reprod., 39,295—307.
Clough, J.R. and Whittingham, D.G. (1983) Metabolism of [MC] glucose by
postimplantation mouse embryos in vitro. J. Embryol. Exp. Morphol., 74,
133-142.
Collins, J.E. and Fleming, T.P. (1995) Specific mRNA detection in single
lineage-marked blastomercs from preimplantation embryos. Trends Genet.,
• 11, 5-7.
Collins, J.E., Lorimer, J.E., Garrod, D.R. et al. (1995) Regulation of
desmocollin transcription in mouse preimplantation embryos. Development,
121, 743-753.
Deeb, S.S., Malkki, M. and Laakso, M. (1993) Human hexokinase II: sequence
and homology to other hexokinases. Biochem. Biophys. Res. Commun.,
197, 68-74.
Ellington, S.K.L. (1987) In vitro analysis of glucose metabolism and embryonic
growth in postimplantation rat embryos. Development, 100, 431-439.
797
F.D.Houghton et al.
Gardner, D.K. and Leese, HJ. (1986) Non-invasive measurement of nutrient
uptake by single cultured preimplantation mouse embryos. Hum. Reprod.,
1, 25-27.
Gardner, D.K. and Leese, HJ. (1990) Concentrations of nutrients in mouse
oviductal fluid and their effects on embryo development and metabolism.
J. Reprod. Fertil., 88, 361-368.
Gardner, H.G. and Kaye, P.L. (1991) Insulin increases cell numbers and
morphological development in mouse preimplantation embryos m vitro.
Reprod. Fertil. Dev., 3, 79-91.
Hogan, A. et al (1991) Glucose transporter gene expression in early mouse
embryos. Development, 113, 363-372.
Hooper, M.A.K. and Leese, HJ. (1989) Activity of hexokinase in mouse
oocytes and preimplantation mouse embryos. Biochem. Soc. Trans., 629,
546-547.
Houghton, F.D., Thompson, J.E., Kennedy, CJ. and Leese, HJ. (19%) Oxygen
consumption and energy metabolism of the early mouse embryo. Mol.
Reprod. Dev., 44, 476-485.
Katzen, H.M. and Schimke, R.T. (1965) Multiple forms of hexokinase in the
rat: tissue distribution, age dependency and properties. Proc. Natl. Acad.
Sci. USA, 54, 1218-1225.
Leese, HJ. (1991) Metabolism of the preimplantation mammalian embryo. In
Milligan, S.R. (ed.), Oxford Reviews of Reproduction, Oxford University
Press, New York, pp. 35-72.
Leese, HJ. and Barton, A.M. (1984) Pynivate and glucose uptake by mouse
ova and preimplantation embryos. J. Reprod. Fertil., 72, 9—13.
Magnani, M. et al. (1983) Pig red blood cells hexokinase: regulatory
characteristics and possible physiological role. Arch. Biochem. Biophys.,
266, 377-387.
Magnuson, M.A. and Shelton, fCD. (1989) An alternate promoter in the
glucokinase gene is active in the pancreatic beta cell. /. Biol. Chem., 264,
15936-15942.
Martin, K.L. and Leese, HJ. (1995) Role of glucose in mouse preimplantation
embryo development. Mol. Reprod. Dev., 40, 436-443.
Martin, K.L., Hardy, K., Winston, R.H.L. and Leese, HJ. (1993) Activity of
enzymes of energy metabolism in single human preimplantation embryos.
/. Reprod. Fertil, 99, 259-266.
Newsholme, E.A. and Leech, A.R. (1989) Biochemistry for the Medical
Sciences. John Wiley and Sons Ltd, London.
Newsholme, E.A. and Start, C. (eds) (1973) Regulation in Metabolism. John
Wiley and Sons Ltd, London.
Preller, A. and Wilson, J.E. (1992) Localisation of the type III isozyme of
hexokinase at the nuclear periphery. Arch. Biochem. Biophys., 294,482—492.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (eds) (1989) Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
Schirch, D.M. and Wilson, J.E. (1987) Rat brain hexokinase: localisation of
the substrate hexose binding site in a structural domain at the C-terminus
of the enzyme. Arch. Biochem. Biophys., 254, 385-396.
Schwab, D.A. and Wilson, J.E. (1989) Complete amino acid sequence of rat
brain hexokinase, deduced from the cloned cDNA, and proposed structure
of a mammalian hexokinase. Proc. Natl. Acad. Sci. USA, 86, 2563-2567.
Schwab, D.A. and Wilson, J.E. (1991) Complete amino acid sequence of the
type III isozyme of rat hexokinase deduced from the cloned cDNA. Arch.
Biochem. Biophys., 285, 365-370.
Sellens, M.H., Stein, S. and Sherman, M.I. (1981) Protein and free amino
acid content in preimplantation mouse embryos and in blastocysls under
various culture conditions. J. Reprod. Fertil., 61, 307-315.
Sheardown, S.A. (1992) A simple method for affinity purification and PCR
amplification of poly(A)+ mRNA. Trends Genet., 8, 121.
Sheth, B., Collins, J.E. and Fleming, T.P. (1995) Expression of tight junction
protein, ZO-1, in mouse embryos. Mol Biol Cell, 6, 193.
Stocchi, V, Magnani, M., Novelli, G. et al. (1983) Pig red blood cell
hexokinase: evidence for the presence of hexokinases type II and III, and
their purification and characterisation. Arch. Biochem. Biophys., 266,
365-376.
Thelen, A.P. and Wilson, J.E. (1991) Complete amino acid sequence of the
type II isozyme of rat hexokinase, deduced from the cloned cDNA:
Comparison with a hexokinase from Novikoff ascites tumor. Arch. Biochem.
Biophys., 286,645-651.
Ureta, T. (1982) The comparative isozymology of vertebrate hexokinases.
Comp. Biochem. Physiol, 71B, 549-555.
Uyeda, K. and Racker, E. (1965) Coordinated stimulation of hexokinase and
phosphofructokinase by phosphate in a reconstituted system of glycolysis.
In Chance, B., Estabrook, R.W. and Williamson, J.R. (eds), Control of
Energy Metabolism. Academic Press, New York, pp. 127-137.
798
White, T.K. and Wilson, J.E. (1989) Isolation and characterisation of the
discrete N- and C-terminal halves of rat brain hexokinase: retention of full
catalytic activity in the isolated C-terminal half. Arch. Biochem. Biophys.,
274, 375-393.
White, T.K. and Wilson, J.E. (1990) Binding of nucleoside triphosphates,
inorganic phosphates and other polyanionic ligands to the W-terminal region
of rat brain hexokinase: relationship to regulation of hexokinase activity
by antagonistic interactions between glucose-6-phosphate and inorganic
phosphate. Arch. Biochem. Biophys., 277, 26-34.
Whitten, W.K. and Biggers, J.D. (1968) Complete development in vitro of the
preimplantation stages of the mouse in a simple chemically defined medium.
J. Reprod. Fertil, 17, 399-401.
Whittingham, D.G. (1971) Culture of mouse ova. J. Reprod. Fert., 14, Suppl.,
7-21.
Wilbur, WJ. and Lipman, DJ. (1983) Rapid similarity searches of nucleic
acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80, 726-730.
Received on May 20, 1996; accepted on August 20, 1996