* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Expression and activity of hexokinase in the early mouse embryo
Community fingerprinting wikipedia , lookup
Biosynthesis wikipedia , lookup
Gene expression wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Epitranscriptome wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cryobiology wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Mitochondrial replacement therapy wikipedia , lookup
Glyceroneogenesis wikipedia , lookup
Blood sugar level wikipedia , lookup
Biochemistry wikipedia , lookup
Molecular Human Reproduction vol.2 no.10 pp. 793-798, 1996 Expression and activity of hexokinase in the early mouse embryo F.D.Houghton1-3, B.Sheth2, B.Moran2, H.J.Leese1 and T.P.Fleming2 department of Biology, University of York, PO Box 373, York YO1 5YW, and department of Biology, University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK ^o whom correspondence should be addressed The maximal activity and Michaelis constant. KM, of hexokinase have been measured in the peri-implantation mouse embryo using an ultramicrofluorescence technique. In addition, transcript detection of the predominant isoenzyme hexokinase I has been determined in single preimplantation mouse embryos at successive stages of development using reverse transcriptase-mediated cDNA amplification. Maximal hexokinase activity decreased dramatically peri-implantation, from 0.97 ± 0.19 nmol/ng protein/h at the blastocyst stage to 0.31 ± 0.05 nmol/|i.g protein/h on day 6.5. The KM remained relatively low and constant over this period (0.23-0.39 mM), indicating the absence of the hexokinase type IV isoenzyme. The pattern of hexokinase activity resembled that of glucose consumption suggesting a possible regulatory role for the enzyme during this period of development. Hexokinase I mRNA was detected in the oocyte and all preimplantation stages of development. The blastocyst polymerase chain reaction (PCR) product, when cloned and sequenced was found to be 98% homologous with mouse tumour hexokinase I. Taken together, these data suggest that the hexokinase gene is not under transcriptional control during early mouse embryo development but plays a significant role in the regulation of glucose consumption. A role for hexokinase in the phosphate-induced inhibition of early embryo development is also proposed. Key words: enzyme activity/hexokinase/mouse embryo/polymerase chain reaction Introduction Pyruvate is required to support the first cleavage division of mouse preimplantation embryos and is the predominant energy substrate utilized until the morula stage (Brinster, 1965a; Biggers et al., 1967; Whitten and Biggers, 1968; Leese and Barton, 1984; Gardner and Leese, 1986). Glucose as the sole energy source is unable to support development until the 4— 8-cell stage (Brinster, 1965b; Brinster and Thomson, 1966) but becomes the main substrate at the blastocyst stage. The switch from pyruvate to glucose occurs at ~99 h after human chorionic gonadotrophin (HCG) administration (Martin and Leese, 1995). Immediately after implantation, glucose remains the predominant energy substrate and the majority of glucose consumed can be accounted for by lactate appearance in embryos from the mouse (Clough and Whittingham, 1983; Houghton et al., 1996) and rat (Ellington, 1987). The glucose transporter, GLUT 1, is present throughout mouse preimplantation development and glucose entry into the cell is unlikely to be impeded (Hogan, 1991). Thus, the block to glucose utilization during early preimplantation development is more likely to reside with the enzymatic control of glucose metabolism. Three enzymes of glycolysis, which catalyse reactions far from equilibrium, are traditionally thought to be rate limiting; hexokinase, phosphofructokinase and pyruvate kinase (Newsholme and Start, 1973; Newsholme and Leech, 1989). In the mammalian embryo, measurements of maximal enzyme activity have suggested a possible regulatory role for hexo© European Society for Human Reproduction and Embryology kinase, the first enzyme of glycolysis, in glucose utilization, while regulation by phosphofructokinase cannot be disregarded due to its allosteric properties (Barbehenn et al., 1974, 1978). In the mouse, hexokinase activity increases from the 8—16cell to the blastocyst stage (Hooper and Leese, 1989; Ayabe, 1994), a rise coincident with that of glucose uptake (Leese and Barton, 1984). The low activity of hexokinase during the early preimplantation stages has been suggested as an explanation of the inability of these embryos to consume glucose (Brinster, 1968; Barbehenn, 1974, 1978; Hooper and Leese, 1989). There are four isoenzymes of hexokinase in mammalian tissues; types I-IV, but biochemical measurements of enzyme activity are unable to differentiate between the various types. Hexokinase I—III are 100 kDa proteins with a low Michaelis constant, KM, for glucose, whereas hexokinase IV is a 50 kDa protein with a high KM for glucose (Preller and Wilson, 1992). The relative proportions of the isoenzymes vary in different tissues: hexokinase I is the predominant isoenzyme in glucosedependent tissues such as the brain (Schwab and Wilson, 1989); hexokinase II predominates in skeletal muscle (Thelen and Wilson, 1991) and other insulin-sensitive tissues; hexokinase III, with the exception of pig erythrocytes (Magnani et al., 1983; Stocchi et al, 1983), has not been found to predominate in any cell type; hexokinase IV (glucokinase) is found only in liver (Katzen and Schimke, 1965) and pancreatic fj-cells (Magnuson and Shelton, 1989). It is thought that the 100 kDa proteins have evolved from gene duplication and 793 F.D.Houghton et al. fusion of an ancestral form of the yeast hexokinase (Ureta, 1982). Hexokinase I has been the most extensively studied (largely in the rat) and is the only isoenzyme whose DNA sequence is available for mouse, derived from tumour tissue (Arora et al., 1990). The gene consists of two structural halves, both coding for proteins containing an ATP and a glucose binding site (Arora et al, 1990). The C-terminal half provides the catalytic function (Schirch and Wilson, 1987; White and Wilson, 1989) with the A'-terminal half providing enzyme regulation by binding glucose-6-phosphate (White and Wilson, 1990). There is also a hydrophobic region, necessary for binding hexokinase to the outer mitochondrial membrane. To date, there have been no reports on the gene expression of hexokinase in preimplantation embryos. We have investigated maximal hexokinase activity in single mouse blastocysts and in single postimplantation embryos on 6.5 and 7.5 days of gestation using an ultramicrofluorescence assay based on that of Martin et al. (1993). The enzyme kinetics of hexokinase have also been examined to determine the A"M and V,™,, during the peri-implantation period to discover whether the type IV (high KM) isoenzyme is present. In addition, hexokinase I mRNA analysis in single mouse embryos at successive stages of preimplantation development has been determined by reverse transcriptase-mediated cDNA amplification using a technique based on that of Collins and Fleming (1995). The polymerase chain reaction product from blastocysts was cloned, sequenced and sequence homology with mouse tumour hexokinase I cDNA determined. Materials and methods Ovulation was stimulated in virgin mice, 6-8 weeks old of the strain CBA/Ca using 5 IU (0.1 ml) pregnant mare's serum gonadotrophin (PMSG, Folligon; Intervet, Cambridge, UK) administered by i.p. injection between 1200-1400 h. This was followed 48 h later by an i.p. injection of 5 IU (0.1 ml) of HCG (Chorulon; Intervet). Females were immediately placed with MF1 males and the presence of a vaginal plug the following morning was taken as an indication that mating had occurred. Embryo recovery Embryos were recovered from the dam at 1400 h on day 2 postfertilization when they were at the 2-cell stage. Embryos were retrieved by flushing the oviducts with H6, a HEPES-buffered medium before being transferred into T6 medium (Whittingham, 1971) containing 5.5 mM glucose, 0.25 mM pyruvate and 2.5 mM lactate, and cultured under pre-equilibrated paraffin oil at 37°C in a humidified atmosphere of 5% CO2 in air. Extraction of poly (A)* mRNA mRNA was extracted from single preimplantation mouse embryos according to the method of Sheardown (1992). To avoid the amplification of any contaminating DNA all solutions were subjected to 5000X100 UJ/cm of UV-irradiation (Spectrolinker XL-1000; Scotlab, Strathclyde, UK). Embryos were removed from culture and placed onto 2 mm squares of messenger affinity paper (MAP; Amersham International, Amersham, UK) in a minimal volume of T6 medium. The RNA was extracted from the embryos by the addition of 10 (J.1 Tris-buffered 4 M guanidinium isothiocyanate (pH 7.5) containing 1% (J-mercaptoethanol, dispensed in 1 u.1 droplets. The samples were 794 1 51l 4 - N-tennlnal half -X- Sequences poly A tail C-tamliul half • Position 1 - CACACAACATCGTGCACG 344-361 2 - CATTACGAATTCGATCACGTCCCTG 382-394 3 - CATTACCAATTCCATGTAGCAAGC 706-716 4 - GTCGATGTGTCGCACTTC 721-738 Figure 1. Primers used for DNA amplification designed to mouse hepatoma hexokinase I cDNA (Arora et al., 1990). Arrowheads mark the position of primers (sequences below) and direction of cDNA synthesis. Nested primers were designed with EcoRl restriction sites underlined, for cloning of products. A hydrophobic domain ( • ) , ATP binding domains (•) and glucose binding domains (0) are also indicated. washed by vortexing three times in 400 ul NaCl followed by two washes in 80% ethanol before being stored under ethanol at -70°C for a maximum of 2 weeks. Reverse transcription The production of a first strand cDNA template and product amplification were conducted according to the method of Collins and Fleming (1995). First strand cDNA synthesis was performed in a total volume of 20 ul. The reaction mixture contained 50 mM Tris-HCl pH 8.3, 75 mM KC1, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 1 mM of each dNTP, 1 uM outer antisense hexokinase primer 4 (Figure 1), 35 IU RNAguard ribonuclease inhibitor (Pharmacia, St Albans, UK) and 200 IU Moloney-murine leukaemia virus (M-MLV) reverse transcriptase (Gibco-BRL, Paisley, UK). The samples were incubated for 10 min at 27°C followed by 45 min at 37°C and 5 min at 95°C. First stage cDNA amplification Amplification of the first strand cDNA product was performed using outer hexokinase primers 1 and 4 (Figure 1) in a total volume of 45 ul. The reagents were added above solidified Dynawax (Flourgen Instruments Ltd, Lichfield, UK) and contained 4.5 u.1 10X Vent buffer (100 mM KC1, 100 mM (NH^SC^, 200 mM Tris-HCl pH 8.8, 20 mM MgSO4, 1% Triton X-100) as supplied with Vent DNA polymerase (New England Biolabs, Hitchin, UK), 0.6 uM of the outer antisense and 1 uM of the sense outer primer. The first strand template (20 u.1) was added and the samples heated to 65°C for 5 min (hot start). After cooling the samples on ice, false priming was eliminated by adding 1 IU of Vent polymerase in 5 (il IX Vent buffer above solidified wax. The reaction was cycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s. Second stage cDNA amplification Further amplification of the first stage product was performed using nested hexokinase primers 2 and 3 (Figure 1). For each sample, a 43 uJ reaction mixture was prepared containing 4.5 ul 10X Vent buffer, 10 mM dNTPs, 1 uM of each primer and 2 ul of the first stage template. 1 IU of Vent polymerase was again added above solidified wax using hot start as described above. The reaction was cycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s. Two control samples were performed concurrently with each experiment; a MAP control conducted in the absence of an embryo and a reagent control performed in the absence of MAP. These eliminate any potential involvement of environmentally introduced DNA contamination of samples. The technique has also been shown Hexokinase in the mouse embryo to eliminate genomic DNA contamination from the embryos (Collins and Fleming, 1995). Amplified cDNA products were analysed on 1% agarose gels in Tris borate EDTA (pH 8.0) buffer, stained with 1 (ig/ml ethidium bromide and photographed using a Polaroid DS34 instant camera on 667 Polaroid film. Cloning and sequencing reaction The cDNA amplification product from blastocysts was digested with EcoRl, purified on a Wizard polymerase chain reaction (PCR) column (Promega, Southampton, UK) and ligated into a pGEX:lXT vector (Pharmacia). The ligation reaction was dialysed over 10% glycerol before being electroporated into DH5ct competent cells (Cambridge Bioscience, Cambridge, UK). The transformed cells were grown and plasmid DNA purified using an alkaline lysis method (Sambrook et al., 1989). The orientation of the insert was determined by digestion with BamHl and Bsaml. A total of five clones with the insert in both the correct and incorrect orientation were further purified using a Wizard miniprep purification system (Promega) and sequenced using the sequenase version 2.0 kit (Amersham, Little Chalfont, UK) with a 5' pGEX primer (CTGGCAAGCCACGTTTGGTG). Sequences were read in both directions and analysed using a DNAStar computer programme (DNAStar Ltd, London, UK). Procedure to extract enzymes from early mouse embryos Individual day 4 freshly flushed blastocysts were transferred to a microcapillary tube containing between 1-2 |il of enzyme extraction buffer [25% glycerol, 1 mM EDTA, 100 mM K2HPO4) 5 mM 2-mercaptoethanol, 2 mg/ml bovine serum albumin (BSA), 0.5% Triton X-100 pH 7.5]. These volumes were sufficient to perform both sample and control experiments. The ends of the microcapillary tubes were sealed with parafilm and immediately stored at -70°C. Single postimplantation embryos on day 6.5 and 7.5 post-fertilization were transferred to microcentrifuge tubes containing 15-30 u.1 of enzyme extraction buffer and homogenized before being stored at -70°C. The extraction buffer was based on that from Chi et al. (1988) and Martin et al. (1993) and acted to release and solubilize the enzymes as well as protect against degradation. Measurement of maximal hexokinase (EC 2.7.1.1) activity After thawing on ice, the embryo extract was expelled under oil on a siliconized microscope slide. A 0.2-1.0 |il sample of the embryo extract was placed on a clean siliconized microscope slide and 0.20.5 ul of reaction media (5 mM MgCl2, 5 mM ATP, 1.5 mM NADP + , I mM glucose, 100 mM triethanolamine, 5 IU/ml glucose-6-phosphate dehydrogenase, pH 7.6) added. This was immediately taken up in a 5 |il microcapillary tube and the ends sealed with parafilm. The rate of reaction was assessed with time by measuring the appearance of NADPH. The samples were excited at 340 nm and the emitted light collected at 459 nm and above using a Fluovert fluorescence microscope with photomultiplier and photometer attachments (Leica, Milton Keynes, UK). Reactions were conducted at 20°C over a period of ~60 min. There was a linear rate of reaction and an increase in fluorescence as the reaction proceeded due to the reduction of NADP + to NADPH. For each measurement of maximal enzyme activity a control sample was also run, using a reaction mixture containing all the reagents with the exception of the enzyme substrate. This allowed any endogenous oxidation or reduction of co-factors to be determined. The increase in fluorescence was measured against an NADH standard curve over the range of 0-0.2 mM. Kinetic experiments were performed to calculate the KM and V ^ of hexokinase at the blastocyst, day 6.5 and 7.5 stage, using reaction mixtures containing glucose in the range O-l.O mM. Data were expressed as LineweaverBurk plots; l/s versus l/v. oocytt 2-c*ll 8-ctU moral* bUatocyit day 6J dxy 7.5 Figure 2. Relationship between maximal hexokinase activity ( • ) and glucose consumption (O) by the early mouse embryo. Values of hexokinase activity for the oocyte to morula stage embryos are taken from Hooper and Leese (1989), the figures for glucose consumption from Houghton et al. (1996). Values are the mean of between six and nine observations ± SEM. Statistical analysis Maximal enzyme activities were expressed as pmol/embryo/h or pmol/ng protein/h. Values of protein content for blastocysts were those of Sellens et al. (1981) and for postimplantation embryos, from Houghton et al. (1996). Hexokinase activity between stages was compared by one-way analysis of variance; differences between individual means were compared by Fisher's test. Results Maximal hexokinase activity has been determined in extracts of single blastocysts, day 6.5 and 7.5 embryos. Hexokinase activity increased from 0.025 ± 0.005 nmol/embryo/h on day 4 to 1.33 ± 0.22 on day 6.5 before increasing significantly (P < 0.01) to 7.92 ± 0.87 nmol/embryo/h on day 7.5. To compare the activity between the peri-implantation stages, it was necessary to take into account the protein content of these embryos. Figures for protein content at the blastocyst stage were obtained from Sellens et al. (1981); those at day 6.5 and 7.5 from Houghton et al. (1996), who found an increase in protein of 170-fold and 4.5-fold between the blastocyst and day 6.5 embryo, and the day 6.5 and day 7.5 embryos respectively. When this was performed, hexokinase activity decreased significantly {P <0.01) from 0.97 ± 0 . 1 9 nmol/|ig protein/h at the blastocyst stage to 0.31 ± 0.05 nmol/(ig protein/h on day 6.5 (Figure 2). On day 7.5, hexokinase activity was 0.42 ± 0.05 nmol/flg protein/h, significantly lower (P <0.01) than that at the blastocyst stage but not from that on day 6.5. The KM for hexokinase was determined over the periimplantation stages by measuring the maximal activity at varying substrate concentrations (Figure 3). The KM was 0.39, 0.23 and 0.23 mM glucose for the blastocyst, day 6.5 and day 7.5 stages respectively. The presence of mRNA for hexokinase I in the preimplantation mouse embryo was characterized by reverse transcription (RT)-cDNA amplification using primers designed against mouse tumour hexokinase I cDNA (Arora et al., 1990). Using these primers, the /V-terminal glucose binding domain of hexokinase I was amplified from single-staged embryos. Transcripts were detected at all stages of development with the production of a single 334 bp cDNA fragment (Figure 4) from 795 F.D.Houghton et al. 0.30- E o 0.20- §•!• I 1 . 4 - 2 0 2 4 6 8 10 12 14 1 1/substrate concentration (mM' ) 1 m Figure 4. Detection of hexokinase transcripts by reverse transcription-cDNA amplification of single mouse embryos throughout preimplantation development. Lanes (a, m) 100 bp markers, arrowheads at 600 bp; (b) oocyte; (c) zygote; (d) 2-cell; (e) 4-cell; (f) pre-compact 8-cell; (g) compact 8-cell; (h) 16-cell; (i) morula; (j) blastocyst; (k) no template control; (1) reagent control. -6-4-2 0 2 4 6 8 10 12 14 16 18 20 22 1/substrate concentration (mM''l S 10 12 14 16 IS 20 22 1 l-ll 1/substrate concentration (mM' ) Figure 3. Lineweaver-Burk plot of hexokinase by the blastocyst (•), day 6.5 (A) and day 7.5 (O) embryo. Values are the mean of four to six determinations ± SEM. the oocyte and zygote to the blastocyst stage (n = 2 5 determinations for each developmental stage). When the blastocyst PCR product from five separate clones, with the cDNA insert cloned in both orientations, was sequenced and analysed by the Wilbur and Lipman method (1983) using a DNAStar computer programme, it was found to be 98% homologous with mouse tumour hexokinase I (Arora et al., 1990). Discussion Hexokinase activity has previously been measured in preimplantation embryos from the mouse (Brinster, 1968; Chi et al., 1988; Hooper and Leese, 1989; Ayabe et al, 1994) and human (Chi et al., 1988; Martin et al., 1993). All these reports found that activity increases at the blastocyst stage when 796 glucose consumption rises, suggesting a possible role for this enzyme in regulating glucose metabolism. Our values for the maximal hexokinase activity for mouse blastocysts were comparable to those obtained by Hooper and Leese (1989) who used a similar technique, but ~30% higher than those of Ayabe et al. (1994) who used a freeze drying method and performed enzyme recycling techniques to amplify the fluorescence signal. The hexokinase activity of early mouse postimplantation embryos has not previously been reported. Activity over the peri-implantation period was found broadly to parallel that of glucose consumption suggesting a regulatory role for hexokinase during this time. At each stage, blastocyst, day 6.5 and day 7.5, hexokinase activity exceeded that of glucose consumption by factors of 3.4, 1.4 and 2.5 respectively. During the preimplantation period, prior to the blastocyst stage, hexokinase activity is initially very low but then increases (Hooper and Leese, 1989) coincident with a rise in glucose consumption (Leese and Barton, 1984). It is likely, however, that hexokinase activity in vivo is below the maximal in-vitro rates measured, due to feedback inhibition from glucosesphosphate and other factors. The true ratio of hexokinase to glucose consumption in vivo, is therefore likely to be closer to unity. Our limited kinetic characterization of mouse hexokinase indicates that hexokinase IV, which has a high KM for glucose, ~10 mM, is unlikely to be present. The KM obtained for all peri-implantation stages was low (0.23—0.39 mM) indicating a high binding capacity and therefore the possible presence of hexokinase I, II or III. Hexokinase II predominates in insulin sensitive tissues and although insulin increases protein synthesis and cell number in the early mouse embryo (Gardner and Kaye, 1991), it has no effect on glucose consumption in the peri-implantation mouse embryo (F.D.Houghton et al., unpublished observation). This is not surprising, since the insulin sensitive glucose transporter GLUT 4 is not expressed at this stage of development (Hogan, 1991). The presence of hexokinase HI is also unlikely, since with the exception of pig erythrocytes, this isoenzyme has only been found in very small Hexokinase in the mouse embryo Table I. Sequence homology between mouse blastocyst cDNA hexokinase product and other isoenzymes Species/hexokinase isoenzyme Homology with Reference PCR product (%) Mouse tumour I Rat brain I Rat skeletal muscle II Rat liver HI Rat pancreatic f}-cell IV 98 93 72 64 71 Arora et al. (1990) Schwab and Wilson (1989) Thelen and Wilson (1991) Schwab and Wilson (1991) Magnuson and Shelton (1989) PCR = polymerase chain reaction. amounts in mammalian cells. We therefore investigated the gene expression of hexokinase I in the preimplantation mouse embryo. The RT-PCR data indicated the presence of hexokinase I mRNA throughout all stages of preimplantation development. When cloned and sequenced, the PCR product was 98% homologous with mouse tumour hexokinase I and displayed a high degree of homology with rat hexokinase I (Table I). At the present time, there are no sequence data available for mouse hexokinase II-TV, although when compared with rat isoenzymes II, m and IV the results obtained were consistent, with -70% homology, suggesting that it is a member of the same family (Deeb et al, 1993). Since the hexokinase I gene is switched on and transcription occurs throughout preimplantation development, the increase in hexokinase activity seen at the blastocyst stage cannot be attributed to de novo synthesis of hexokinase I mRNA. The RT-PCR technique used in this report simply indicates the presence or absence of transcripts and does not quantitate or measure stability of the mRNA. Hence, it is feasible that an increase in the stability of hexokinase I mRNA at the morula stage, could result in increased translation of the hexokinase I protein. This in turn could account for the significant increase in enzyme activity observed at the blastocyst stage. Temporal regulation of hexokinase activity in the late morula is therefore distinct from that of other genes upregulated at this stage, such as desmocollin (DSC2) and ZO-1 oc+ isoform. These proteins are involved in intercellular adhesion and mRNA transcripts from their genes are first expressed at the morula stage (Collins et al, 1995; Sheth et al, 1995). These transcripts are then rapidly translated and the proteins assembled at the junctions, indicating that they are controlled at the transcriptional level. Further studies to investigate the gene regulation of hexokinase I would require a complete DNA sequence; experiments to measure the influence of regulatory proteins on the stability of the mRNA could then be conducted. When represented on a pmol/|ig protein/h basis, hexokinase activity at the postimplantation stages is comparable to that of the morula—a stage of development where there is a transition from a metabolism based on pyruvate to one dependent on glucose. These considerations and the decrease in hexokinase on days 6.5 and 7.5 suggest that glucose is not a major energy substrate in day 6.5 and 7.5 mouse embryos. Hexokinase and the role of inorganic phosphate in early mouse embryo development Barnett and Bavister (1996) reported that glucose and inorganic phosphate (Pj) were inhibitory to hamster 2-cell embryo development. Since P, is known to stimulate glycolysis, a pathway potentially deleterious to the embryo (Gardner and Leese, 1990; Leese, 1991), the most likely explanation for this phenomenon is that conversion of glucose to lactate is enhanced. Hexokinase, the first enzyme of glycolysis, is inhibited by its product, glucose 6-phosphate, an inhibition relieved by P, (Uyeda and Racker, 1965). We postulate that omitting P, from embryo culture media allows glucose 6phosphate to inhibit hexokinase and in this way limit the extent of glycolysis. This proposition is obviously testable. In conclusion, the maximal activity and KM of hexokinase has been measured in single peri-implantation mouse embryos. The profile of activity had a similar pattern to glucose consumption over this period. In addition using RT-PCR, hexokinase I mRNA was detected at all stages of preimplantation development. Acknowledgements The authors wish to thank Mark Hay for his technical assistance during this study. F.D.H. is a recipient of a BBSRC Studentship. Further financial support was obtained from grants by the Wellcome Trust and MRC to T.P.F. References Arora, K.K., Fanciulli, M. and Pedersen, P.L. (1990) Glucose phosphorylation in tumor cells. J. Biol. Chem., 265, 6481-6488. Ayabe, T, Tsutsumi, O and Taketani, Y. (1994) Hexokinase activity in mouse embryos developed in vivo and in vitro. Hum. Reprod., 9, 347—351. Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1974) The explanation for the blockage of glycolysis in early mouse embryos. Proc. Nail. Acad. Sci. USA, 71, 1056-1060. Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1978) Measurement of metabolites in single preimplantation embryos: a means to study metabolic control in early embryos. J. Emb. Expt. Morph., 43, 29—46. Barnett, D.K. and Bavister, B.D. (1996) Inhibitory effect of glucose and phosphate on the second cleavage division of hamster embryos: is it linked to metabolism? Hum. Reprod., 11, 177-183. Biggers, J.D., Whittingham, D.G. and Donahue, R.P. (1967) The pattern of energy metabolism in the mouse oocyte and zygote. Proc. Nail. Acad. Sci. USA, 58, 560-567 Bnnster, R.L. (1965a) Studies on the development of mouse embryos in vitro. II The effect of energy source. J. Exp. Zool., 158, 59-68. Brinster, R.L. (1965b) Studies on the development of mouse embryos in vitro. IV Interaction of energy source. /. Reprod. Fertil., 10, 227-240. Brinster, R.L. (1968) Hexokinase activity in the preimplantation mouse embryo. Enzymologia, 34, 304-308. Brinster, R.L. and Thomson, J.L. (1966) Development of eight-cell mouse embryos in vitro. Exp. Cell. Res., 42, 308-315. Chi, M.M.-Y., Manchester, J.K., Yang, V.C. et al. (1988) Contrast in levels of metabolic enzymes in human and mouse ova. Biol. Reprod., 39,295—307. Clough, J.R. and Whittingham, D.G. (1983) Metabolism of [MC] glucose by postimplantation mouse embryos in vitro. J. Embryol. Exp. Morphol., 74, 133-142. Collins, J.E. and Fleming, T.P. (1995) Specific mRNA detection in single lineage-marked blastomercs from preimplantation embryos. Trends Genet., • 11, 5-7. Collins, J.E., Lorimer, J.E., Garrod, D.R. et al. (1995) Regulation of desmocollin transcription in mouse preimplantation embryos. Development, 121, 743-753. Deeb, S.S., Malkki, M. and Laakso, M. (1993) Human hexokinase II: sequence and homology to other hexokinases. Biochem. Biophys. Res. Commun., 197, 68-74. Ellington, S.K.L. (1987) In vitro analysis of glucose metabolism and embryonic growth in postimplantation rat embryos. Development, 100, 431-439. 797 F.D.Houghton et al. Gardner, D.K. and Leese, HJ. (1986) Non-invasive measurement of nutrient uptake by single cultured preimplantation mouse embryos. Hum. Reprod., 1, 25-27. Gardner, D.K. and Leese, HJ. (1990) Concentrations of nutrients in mouse oviductal fluid and their effects on embryo development and metabolism. J. Reprod. Fertil., 88, 361-368. Gardner, H.G. and Kaye, P.L. (1991) Insulin increases cell numbers and morphological development in mouse preimplantation embryos m vitro. Reprod. Fertil. Dev., 3, 79-91. Hogan, A. et al (1991) Glucose transporter gene expression in early mouse embryos. Development, 113, 363-372. Hooper, M.A.K. and Leese, HJ. (1989) Activity of hexokinase in mouse oocytes and preimplantation mouse embryos. Biochem. Soc. Trans., 629, 546-547. Houghton, F.D., Thompson, J.E., Kennedy, CJ. and Leese, HJ. (19%) Oxygen consumption and energy metabolism of the early mouse embryo. Mol. Reprod. Dev., 44, 476-485. Katzen, H.M. and Schimke, R.T. (1965) Multiple forms of hexokinase in the rat: tissue distribution, age dependency and properties. Proc. Natl. Acad. Sci. USA, 54, 1218-1225. Leese, HJ. (1991) Metabolism of the preimplantation mammalian embryo. In Milligan, S.R. (ed.), Oxford Reviews of Reproduction, Oxford University Press, New York, pp. 35-72. Leese, HJ. and Barton, A.M. (1984) Pynivate and glucose uptake by mouse ova and preimplantation embryos. J. Reprod. Fertil., 72, 9—13. Magnani, M. et al. (1983) Pig red blood cells hexokinase: regulatory characteristics and possible physiological role. Arch. Biochem. Biophys., 266, 377-387. Magnuson, M.A. and Shelton, fCD. (1989) An alternate promoter in the glucokinase gene is active in the pancreatic beta cell. /. Biol. Chem., 264, 15936-15942. Martin, K.L. and Leese, HJ. (1995) Role of glucose in mouse preimplantation embryo development. Mol. Reprod. Dev., 40, 436-443. Martin, K.L., Hardy, K., Winston, R.H.L. and Leese, HJ. (1993) Activity of enzymes of energy metabolism in single human preimplantation embryos. /. Reprod. Fertil, 99, 259-266. Newsholme, E.A. and Leech, A.R. (1989) Biochemistry for the Medical Sciences. John Wiley and Sons Ltd, London. Newsholme, E.A. and Start, C. (eds) (1973) Regulation in Metabolism. John Wiley and Sons Ltd, London. Preller, A. and Wilson, J.E. (1992) Localisation of the type III isozyme of hexokinase at the nuclear periphery. Arch. Biochem. Biophys., 294,482—492. Sambrook, J., Fritsch, E.F. and Maniatis, T. (eds) (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Schirch, D.M. and Wilson, J.E. (1987) Rat brain hexokinase: localisation of the substrate hexose binding site in a structural domain at the C-terminus of the enzyme. Arch. Biochem. Biophys., 254, 385-396. Schwab, D.A. and Wilson, J.E. (1989) Complete amino acid sequence of rat brain hexokinase, deduced from the cloned cDNA, and proposed structure of a mammalian hexokinase. Proc. Natl. Acad. Sci. USA, 86, 2563-2567. Schwab, D.A. and Wilson, J.E. (1991) Complete amino acid sequence of the type III isozyme of rat hexokinase deduced from the cloned cDNA. Arch. Biochem. Biophys., 285, 365-370. Sellens, M.H., Stein, S. and Sherman, M.I. (1981) Protein and free amino acid content in preimplantation mouse embryos and in blastocysls under various culture conditions. J. Reprod. Fertil., 61, 307-315. Sheardown, S.A. (1992) A simple method for affinity purification and PCR amplification of poly(A)+ mRNA. Trends Genet., 8, 121. Sheth, B., Collins, J.E. and Fleming, T.P. (1995) Expression of tight junction protein, ZO-1, in mouse embryos. Mol Biol Cell, 6, 193. Stocchi, V, Magnani, M., Novelli, G. et al. (1983) Pig red blood cell hexokinase: evidence for the presence of hexokinases type II and III, and their purification and characterisation. Arch. Biochem. Biophys., 266, 365-376. Thelen, A.P. and Wilson, J.E. (1991) Complete amino acid sequence of the type II isozyme of rat hexokinase, deduced from the cloned cDNA: Comparison with a hexokinase from Novikoff ascites tumor. Arch. Biochem. Biophys., 286,645-651. Ureta, T. (1982) The comparative isozymology of vertebrate hexokinases. Comp. Biochem. Physiol, 71B, 549-555. Uyeda, K. and Racker, E. (1965) Coordinated stimulation of hexokinase and phosphofructokinase by phosphate in a reconstituted system of glycolysis. In Chance, B., Estabrook, R.W. and Williamson, J.R. (eds), Control of Energy Metabolism. Academic Press, New York, pp. 127-137. 798 White, T.K. and Wilson, J.E. (1989) Isolation and characterisation of the discrete N- and C-terminal halves of rat brain hexokinase: retention of full catalytic activity in the isolated C-terminal half. Arch. Biochem. Biophys., 274, 375-393. White, T.K. and Wilson, J.E. (1990) Binding of nucleoside triphosphates, inorganic phosphates and other polyanionic ligands to the W-terminal region of rat brain hexokinase: relationship to regulation of hexokinase activity by antagonistic interactions between glucose-6-phosphate and inorganic phosphate. Arch. Biochem. Biophys., 277, 26-34. Whitten, W.K. and Biggers, J.D. (1968) Complete development in vitro of the preimplantation stages of the mouse in a simple chemically defined medium. J. Reprod. Fertil, 17, 399-401. Whittingham, D.G. (1971) Culture of mouse ova. J. Reprod. Fert., 14, Suppl., 7-21. Wilbur, WJ. and Lipman, DJ. (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80, 726-730. Received on May 20, 1996; accepted on August 20, 1996