Download Amelioration of Experimental Autoimmune Encephalomyelitis by β

J Mol Neurosci (2011) 44:31–40
DOI 10.1007/s12031-010-9483-1
Amelioration of Experimental Autoimmune
Encephalomyelitis by β-elemene Treatment is Associated
with Th17 and Treg Cell Balance
Rongwei Zhang & Ayong Tian & Huimin Zhang &
Zhike Zhou & Hongmei Yu & Lei Chen
Received: 3 August 2010 / Accepted: 8 December 2010 / Published online: 19 January 2011
# Springer Science+Business Media, LLC 2011
Abstract Experimental autoimmune encephalomyelitis
(EAE), an animal mode of multiple sclerosis (MS), was
previously considered that is mediated by Th1 cells.
However, a number of recent studies provided strong
evidence that T helper cells that produce interleukin (IL)17 (Th17) and anti-inflammatory CD4+ Foxp3+ regulatory
T cells (Tregs) play a dominant role in the pathogenesis of
EAE. β-elemene is a natural antitumor plant drug with the
role of multiple target, and it has been found to pass
through the blood–brain barrier easily. It also has been
strongly implicated as an immune modulatory agent, but
R. Zhang : H. Zhang : Z. Zhou
Department of Geriatrics, The First Affiliated Hospital
of China Medical University,
No.155 Nanjing Bei Street, Heping,
110001 Shenyang, Liaoning, People’s Republic of China
A. Tian
Department of Anesthesiology, The First Affiliated Hospital
of China Medical University,
No.155 Nanjing Bei Street, Heping,
110001 Shenyang, Liaoning, People’s Republic of China
H. Yu
Department of Neurology, The First Affiliated Hospital
of China Medical University,
No.155 Nanjing Bei Street, Heping,
110001 Shenyang, Liaoning, People’s Republic of China
L. Chen (*)
Department of Ophthalmology, The First Affiliated Hospital
of China Medical University,
No.155 Nanjing Bei Street, Heping,
110001 Shenyang, Liaoning, People’s Republic of China
e-mail: [email protected]
L. Chen
e-mail: [email protected]
the precise mechanisms of its action are largely unknown.
In the present study, we mainly investigated the efficacy
and mechanism of β-elemene against EAE in vivo and
vitro. The treatment of C57 mice with β-elemene significantly delayed the onset of EAE, markedly suppressed
MOG-specific T cell proliferation in a dose-dependent
manner, dramatically reduced the IL-17, IL-6, IL-23, and
RORγt production and induced the Foxp3 expression in
both the periphery and the inflamed spinal cord. These
findings indicated that β-elemene amelioration EAE was, to a
large extent, due to inhibit differentiation and development of
Th17 cells depends on down-regulating expression of IL-6,
IL-23, RORγt signaling, and promoting expansion in Treg
cells. Suggesting it is useful in the control of MS and other
Th17 cell-mediated inflammatory diseases.
Keywords β-elemene . Th17 . Treg . Cytokine
Introduction
Although multiple sclerosis (MS) is the most common
inflammatory demyelization disease of the central nervous
system (CNS), afflicting hundreds of thousands of people
worldwide. Its pathogenesis is still only incompletely clear.
There seems to be substantial heterogeneity in disease
mechanisms. Some studies have shown that an autoimmune
origin or at least a decisive autoimmune component is
postulated. In the past, the role of the Th1 cells and Th2
cells for adaptive immune responses in MS had been
addressed (Coffman 2006; Mosmann and Coffman 1989).
But recent studies provided strong evidence that interleukin
(IL)-17-producing T cells play a dominant role in the
pathogenesis of MS and EAE. (Tzartos et al. 2007;
Hofstetter et al. 2005; Hofstetter et al. 2007; Komiyama
32
et al. 2006). Another distinct T cell population called Tregs
has also attracted attention recently because it plays an
important role in maintenance of immune tolerance and in
controlling the destructive self-reactive T cells found in
autoimmune animal models of arthritis, multiple sclerosis,
diabetes, and inflammatory bowel disease (Fontenot et al.
2003; Reddy et al. 2005; Kohm et al. 2002). Modulating
the Treg population and other associated factors may prove
to be an effective new therapy for autoimmune disease.
Many clinical and pathologic features of EAE show close
similarity to MS, therefore it has been used widely as an
animal model to explore the mechanism of MS pathogenesis
and to test the efficacy of potential therapeutic approaches for
the treatment of MS.
Naïve cluster of differentiatio (CD4)+ help T cells result
in the development of Th1, Th2, Th17, or Treg depending
on the cytokine milieu. It is well known that IL-12
(signaling through T-bet and STAT-4) regulates Th1 (Gately
et al. 1998), while IL-4 (signaling through STAT-6 and
GATA-3) regulates Th2 differentiation (Nelms et al. 1999),
transforming growth factor beta (TGF-β) has usually been
associated with the development of Treg cells (Chen et al.
2003), but it is interesting to note that in the presence of an
inflammatory cytokine, such as IL-6, the inhibition of Treg
cell development and differentiation of naïve CD4+ T cells
into Th17 could be observed (Bettelli et al. 2006). It was
shown in parallel by several groups that a combination of
IL-6 and TGF-β is required for Th17 differentiation and
that differentiated Th17 cells are maintained and expanded
by IL-23, which is unable to drive Th17 differentiation of
naïve T cells by itself (Bettelli et al. 2006; Stockinger and
Veldhoen 2007). Another key transcription factor associated
with the Th17 lineage, the orphan retinoid receptor—RORγt
(Ivanov et al. 2006), inducing transcription of IL-17 in naïve
CD4+ T cells, often activated by cytokine IL-6, RORγtdeficient CD4+ T cells produce no IL-17 in response to TGFβ and IL-6. Activation and proliferation of proinflammatory
Th17 cells is reciprocally related to the immunosuppressive
effects of Treg cells, both of which are contingent upon the
cytokine environment, in particular IL-6, TGF-β, and IL-23
(Mangan et al. 2006; McGeachy et al. 2005).
Elemene (1-methyl-1-vinyl-2, 4-diisopropenyl-cyclohexane)
is a novel non-cytotoxic antitumor drug, which is isolated
from the traditional Chinese medicinal herb Rhizoma
zedoariae. The extract of elemene is a mixture of α-, β-,and
δ-elemene, with β-elemene as the main component, accounting for 60∼72% of the three isoforms. When used as a single
agent, elemene was shown to exhibit anticancer effects in
human and murine tumor cells in vitro and in vivo and has
substantial clinical activity against various tumors without
severe side effects (Fu 1984; Tan et al. 2000; Wang et al.
1996) Another study had shown patient immunity was
improved during the therapy with β-elemene (Wu et al.
J Mol Neurosci (2011) 44:31–40
1999). We speculated that β-elemene can affect multiple target
involved in the pathogenesis of immune disorder diseases
including tumors and demyelinating diseases. In the present
study, we examined the effects and mechanism of action of
β-elemene on the pathogenesis of EAE. Our data indicated
β-elemene can ameliorate the course of EAE mice immunized
with myelin oligodendrocyte glycoprotein (MOG35–55) peptide by reducing IL-6 production, suppressing IL-6-activated
RORγt and signal transducer and activator of transcription 3
(STAT3) pathway mediating the differentiation of Th17 cells
and inducing Treg cells expansion in EAE. Our data suggest
that β-elemene maybe is a good candidate in the treatment of
MS and other Th17-mediated inflammatory diseases.
Materials and Methods
Animals
C57BL/6 (8–10 weeks old) female mice were purchased
from Shanghai SLAC Laboratories animal Co., Ltd. and
were housed under a 12-h light/dark cycle in microisolater
cages contained within a laminar flow system to maintain a
pathogen-free environment. The studies were conducted in
accordance with the Animal Component of Research
Protocol guidelines at the China Medical University.
Induction of Chronic EAE
C57BL/6 mice were immunized subcutaneously at the two
sites on the back with 100 ml (200 mg) of MOG35–55
peptide dissolved in distilled water and emulsified with an
equal volume of complete Freund's adjuvant supplemented
with 4 mg/ml mycobacterium tuberculosis H37Ra. All
animals were also injected intraperitoneally on days 0 and 2
with 400 ng of Pertussis toxin. Control animals followed
an identical immunization protocol (adjuvant+pertussis)
without added MOG peptide. Animals were weighed daily
and assessed for clinical signs of EAE by two independent
observers. We used the same clinical EAE scoring system
to assess neurological deficit in our mouse EAE model
according to the following scale: score 0, no disease; score
1, loss of weight and tail weakness; score 2, weakness in
hind limb; score 3, complete hind limb paralysis; score 4,
hind limb paralysis with fore limb weakness or paralysis;
and score 5, moribund or deceased.
Treatment Protocol
β-elemene (0603091; 20 ml, 100 mg) was stored at 4°C.
β-elemene treatment (20 mg/kg) by intraperitoneal injection
started at day 1 after injection of MOG35–55 peptide.
Injection of β-elemene q.o.d. continued until the end of the
J Mol Neurosci (2011) 44:31–40
33
experiment (day 11, 15). Sham treated with an equal volume
of saline.
Histological Analysis
To assess the degree of CNS inflammation, three mice from
each group were sacrificed under anesthesia on day 15
(after the onset of EAE).The spinal cord was removed
quickly. A portion of spinal cord sample was fixed in 10%
neutral buffered formalin and then cut into 4-μm-thick
sections. Tissues were stained with hematoxylin and eosin
to assess tissue damage and inflammation, Bielschowsky
silver impregnation for axonal damage.
for 34 s and 72°C for 15 s. The data were analyzed using the
standard curve method and the mRNA level of target gene for
each sample was normalized against refercence gene GAPDH
mRNA.
Statistics
The data are expressed as the mean±SD. Student's two-tailed
t test was used to analyze the results. P values<0.05 or less
was considered significant. All in vitro experimental data
were representative of three independent experiments and
represented the mean ratio of triplicate results in each
experiment.
T Cell Proliferation Assay
Results
Effects of β-elemene on proliferation T cells were analyzed by
MTT (3-[4,5-dimethylthiazole-2-yl]-2,5-diphenyltetrazo-lium
bromide) assay. Draining lymph node (DLN) cells on days 11,
15 after immunization with MOG35–55 peptide were
prepared, a total of 2×106 cells/well were stimulated for
72 h with or without specific Ag-MOG35–55 peptide and
treated for 72 h with various concentrations of β-elemene
(final concentration, 10 μg/mL MOG35–55; 2, 4, 6, 8,
10 μM β-elemene) or an equivalent amount of medium
containing DMSO at 37°C in 95% humidity and 5% CO2
(three wells for each sample). The optical density was
measured at 550 nm with a microplate reader (Bio-Rad 2550,
Richmond, CA, USA).
RNA Isolation and Quantitative Real-time RT-PCR
Total RNA was extracted from treated DLN cells and
spinal cord using an RNA isolation kit (Takara, Japan).
Complementary DNA was prepared as recommended and
used as the template for quantitative PCR. Levels of
tissue and cellular mRNA for IL-17, IL-6, TGF-β, IL23p19, RORγt, Foxp3 from all groups were analyzed by
real-time PCR. Real-time PCR was performed according
to the manufacturer's instructions. Specific primers are
shown in Table 1. The amplification conditions were
8 min at 95°C, followed by 45 cycles of 95°C for 5 s, 60°C
Table 1 Premiers used in this
study
The Effect of β-elemene on C57BL/6 EAE Mice
To test the use of β-elemene in the treatment of MS, we
examined the protective effect of β-elemene on the
pathogenesis of EAE mice. C57BL/6 mice were treated with
β-elemene by intraperitoneal injection started at day 1 after
injection of MOG35–55 peptide. Injection of β-elemene
q.o.d. continued until the end of the experiment (day 15). The
sham-treated mice were observed clinical manifestations on
days 12–14, mean day of onset (12.03±0.83), and developed
clinical paralysis for a mean maximum clinical score (MMCS)
of 2.54 on day 15. In contrast, the mice treated with
β-elemene mean day of onset (15.12±0.92), decreased the
MMCS to 0 on day 15 (Fig. 1). The difference in the MMCS
between β-elemene-treated and sham-treated groups was
significant, with p<0.001 using the Student's t test. These
results suggested that β-elemene delayed the onset of clinical
neurologic signs in animals and decreased the clinical
severity in EAE mice.
β-elemene Decreases CNS Inflammatory Cells Infiltration
and Axonal Damage in EAE
To further study the effect of β-elemene on the pathogenesis
of CNS inflammation, we examined the effect of β-elemene
Cytokine
Forward
Reverse
IL-17
Il-6
TGF-β
IL-23p19
RORγt
Foxp3
GAPDH
GTTCTGCTGCCTGTCACATCATC
CCACTTCACAAGTCGGAGGCTTA
GTGTGGAGCAACATGTGGAACTCTA
ACATGCACCAGCGGGACATA
CAGTATGTGGTGGAGTTTGCCAAG
CAGCTCTGCTGGCGAAAGTG
TGTGTCCGTCGTGGATCTGA
CGGGCAATTACTATCAGTTCCTGTC
GCAAGTGCATCATCGTTGTTCATAC
TTGGTTCAGCCACTGCCGTA
CCTTGTGGGTCACAACCATCTTC
TGTAGGCCCTGCACATTCTGAC
TCGTCTGAAGGCAGAGTCAGGA
CCTGCTTCACCACCTTCTTGA
34
J Mol Neurosci (2011) 44:31–40
treatment with β-elemene decreased obviously inflammatory
cells and axonal loss in spinal cord.
β-elemene Inhibits Ag-specific Lymphocytes Responses
and IL-17 mRNA Expression
Fig. 1 Effect of β-elemene on progression of EAE in C57BL/6 mice.
Clinical assessment of EAE was performed daily and mice were scored
for disease according to the same criteria. The results are expressed as the
mean daily clinical score of each experimental group. β-elemene therapy
(20 mg/kg) delayed onset of clinical neurologic signs in animals and
reduced the magnitude of clinical deficit in β-elemene-treated mice
compared to sham-treated mice
on EAE in vivo. Mice from sham-treated and 20 mg/kg
β-elemene-treated groups were sacrificed on days 15
(after the onset of EAE). Spinal cord sections from mice
were stained with hematoxylin and eosin and Bielschowsky
silver impregnation to assess tissue inflammation and axonal
injury. As shown in Fig. 2, the sham-treated mice showed
profound inflammatory cells infiltration and reduced density
of apparently normal axons in spinal cord. Conversely,
Fig. 2 β-elemene inhibited the
inflammatory cells infiltration
and improved axonal loss in the
spinal cord of the EAE mice.
H & E and Bielshowsky staining
demonstrated areas of inflammation and loss of axon in
the sham-treated mice (a, c).
In contrast, β-elemene-treated
mice show very mild inflammation with axon integrity
(b, d). a, b c, d: original
magnification ×400
To define the mechanisms Ag-specific lymphocytes or
Ag-nonspecific lymphocytes responsible for EAE, DLN cells,
isolated from EAE mice on days 11, 15 after immunization
with MOG35–55 peptide were cultured for 72 h with or
without specific Ag-MOG35–55 peptide. Local DLN cells
activated with specific Ag-peptide resulted in a robust
proliferation response, whereas DLN cells activated without
specific Ag-peptide were relatively weakly in proliferation
(Fig. 3a). To define the mechanisms involved in the
inhibition of CNS inflammation by β-elemene, we have
chosen to further examine the effect of β-elemene on
Ag-specific DLN cells responses in vitro. As shown in
Fig. 3b, MOG35–55-immunized DLN cells displayed a
strong proliferative response to specific Ag in vitro and
addition with β-elemene resulted in a dose-dependent
decrease in proliferation. To address the proliferating DLN
cells, we have further assayed the mRNA expression of IL-17
from specific Ag-induced DLN cells by real-time RT-PCR at
different time points after MOG35–55 immunization
(Fig. 4a). Data showed that higher level mRNA of the
J Mol Neurosci (2011) 44:31–40
35
Fig. 3 β-elemene inhibited specific lymphocytes proliferation in vitro. a
MOG35–55 peptide-immunized-DLN cells, isolated on days 11,15 after
immunization, were re-stimulated with 10 μg/ml specific Ag-MOG35–
55 peptide or without for 72 h. Ag-specific lymphocytes proliferation
was confirmed by MTT assay. b MOG35–55 peptide-immunized-DLN
cells were restimulated in vitro with same Ag peptide in the presence of
different concentration of β-elemene. Ag-specific lymphocytes proliferation was dose-dependently inhibited by β-elemene. Data are
representative of three independent experiments and indicate the mean
ratio of triplicate results in each experiment
IL-17 was expressed in the DLN cells cultured with 10 μg/ml
MOG35–55 peptide only for 72 h when compared with
treatment of cells with same peptide in the presence of
10 μM β-elemenen during the early stage of EAE. Further-
more, we also checked the IL-17 mRNA expression levels in
the spinal cord tissue both 20 mg/kg β-elemene-treated and
sham-treated mice by real-time RT-PCR at different time points
(Fig. 5a). Results indicated that the mRNA expression of
Fig. 4 β-elemene suppressed
IL-17 and its differentiation
related genes mRNA expression
in vitro. MOG35–55 peptideimmunized DLN cells obtained
at two different time points
(day 11, 15) were re-stimulated
in the presence of 10 μg/ml
same peptide with 0 or 10 μM
β-elemene for 72 h. The
mRNA levels of cytokines
were quantified by real time
PCR. The expression levels of
IL-17, IL-6, IL-23, RORγt
except TGF-β were suppressed
in specific Ag-induced DLN
cells with 10 μM β-elemene
(a–e). Data are representative
of three independent experiments and indicate the mean
ratio of triplicate results in
each experiment. Data represents
mean±SD for six individual
mice. Single asterisk, p<0.05;
double asterisk, p<0.01
36
J Mol Neurosci (2011) 44:31–40
Fig. 5 β-elemene suppressed
IL-17 and its differentiation
related genes mRNA expression
in vivo. Mice from β-elemenetreated (20 mg/kg) and shamtreated control groups were
sacrificed on days 11, 15 after
immunized with MOG35–55
peptide. The mRNA levels of
cytokines in the spinal cord
were quantified by real time
PCR. The expression levels of
IL-17, IL-6, IL-23, RORγt
except TGF-β was significantly
reduced in β-elemene-treated
mice compared with the shamtreated mice (a–e). Data
represents mean±SD for six
individual mice. Single
asterisk, p<0.05; double
asterisk, p<0.01
IL-17 was reduced in spinal cord in β-elemene-treated
mice, whereas higher expression of IL-17 was seen in
spinal cord in sham-treated mice similar during the early
stage of EAE. These results suggested that β-elemene
inhibits EAE by inhibiting Th17 cell proliferation in
spinal cord of the EAE mice.
β-elemene Suppresses Gene Expressions Associated
with the Differentiation of Th17 Cells
The development of clinical EAE has been associated with
the production of various inflammatory cytokines and
signal transducers associated with the Th17 phenotype,
including TGF-β, IL-6, IL-23, RORγt. To determine the
mechanisms involved in β-elemene regulation of Agspecific Th17 responses in EAE, the mRNA levels of the
products have been identified and quantified by real time
PCR in vivo and in vitro. As data have shown that
expression of IL-6, IL-23, RORγt were significantly
reduced in the spinal cord in 20 mg/kg β-elemene-treated
mice compare with the sham-treated mice at different time
points after MOG35–55-immunization (Fig. 5b–e). Similar
results have been presented between specific Ag MOG35–
55 peptide only induced local DLN cells and treatment of
cells with 10 μM β-elemene (Fig. 4b–e). The higher levels
of IL-6, IL-23, RORγt were expressed in specific Ag only
induced local DLN cells compare with the treatment of
cells with 10 μM β-elemene. The expression of TGF-β
neither in vitro nor in vivo has significance between shamtreated and β-elemene-treated group. These results suggested that β-elemene can suppress the expression of
inflammatory cytokines and signal transducers associated
with differentiation and production of Ag-specificTh17
cells.
β-elemene Induces Treg Cell Expansion
The effect of β-elemene on expression of mRNA for Foxp3
in both the periphery and the inflamed spinal cord from
EAE-induced C57BL/6 mice was determined by real time
J Mol Neurosci (2011) 44:31–40
37
EAE is a commonly studied animal model of central
nervous system inflammatory demyelinating disease, and
it is believed that autoreactive T cells and proinflammatory
cytokines play key roles in the early inductive phase and
later paralytic stages of EAE pathogenesis (Steinman. 2001;
Goverman et al. 2005; Huseby et al. 2001). β-elemene, an
extract from the ginger plant R. zedoariae, is a promising
novel anticancer drug (Zhou et al. 2001; Zhou et al. 2003;
Yang et al. 1999). Although β-elemene has been dramatic
effective for the treatment of human tumors, the mechanisms underlying its action are not understood. Especially it
has been found to have the capacity to pass through the
blood–brain barrier easily. Some studies have previously
demonstrated that β-elemene therapy is of substantial
clinical benefit in central nervous system diseases (Wei
and Chuanzhen. 2008). In view of the pathological
mechanisms of MS/EAE, which may be involved with the
immune disorder similar to tumors in this study, we utilized
in vitro and in vivo methods to examine the effects and
mechanism of action of β-elemene on the pathogenesis of
EAE. We found in vitro that exposure of enriched MOG35–
55-immunized DLN cells cultures to β-elemene significantly
downregulated proliferative response to specific Ag. Most
importantly, β-elemene treatment also resulted in a marked
expansion in the Treg cell population and a corresponding
reduction in Th17 cells and MOG-specific T cells within both
peripheral lymphoid tissue and diseased EAE spinal cords. By
modulating multiple functional immune cell types and their
corresponding cytokines, β-elemene therapy transformed
a significantly destabilized autoimmune process in EAE
animals into one of relatively normal immune status. As a
consequence, less severe neurologic deficits and less neuropathologic abnormalities were found in β-elemene-treated
EAE animals compared to sham-treated controls.
The pathogenesis of MS/EAE is a complex process.
β-elemene appears to act at multiple steps to play a role in the
inflammation of MS. In the present study, we used the EAE
model of MS to test the potential therapeutic effects of
β-elemene in the treatment of MS. Our data showed the
treatment of EAE mice with β-elemene delayed the onset
and reduced obviously clinical severity of EAE in vivo. The
inhibition of clinical paralysis by β-elemene was associated
with a decrease in inflammation and axonal loss in the CNS.
More than two decades after coining of the Th1/Th2
paradigm (Coffman 2006; Mosmann and Coffman 1989),
Th17, a new player has entered the field of autoimmunity.
Recent researches showed defective Th17 differentiation do
not develop EAE or EAU (Liu et al. 2008). Th17 cells, like
the Ag-specific T cells, reside mainly in the peripheral
lymphatics during the EAE induction phase after immunization. Later, when increased numbers of infiltrating
inflammatory cells invade the CNS, Th17 cells, together
with MOG-specific T effector cells, were easily detected in
diseased spinal cords. β-elemene treatment abrogates the
proliferation of peripheral Th17 cells during the early
induction phase as well as at onset stages of EAE, and
Fig. 6 β-elemene treatment induced Treg cell marker Foxp3 mRNA
expression in vitro and vivo. Mice from β-elemene-treated (20 mg/kg) and
sham-treated mice were sacrificed on days 11, 15 after immunized with
MOG35–55 peptide. Meantime, MOG35–55 peptide-immunized DLN
cells obtained at the same time points (day 11, 15) were re-stimulated in the
presence of 10 μg/ml same peptide with 0 or 10 μM β-elemene for 72 h.
The mRNA levels of Foxp3 in the spinal cord and DLN cells were
quantified by real time PCR. β-elemene therapy induced a substantial
increase in Foxp3 mRNA expression in EAE spinal cords (a) and DLN
(b). The β-elemene induced Foxp3 mRNA expression in the CNS and
peripheral lymphatic system became even more evident in onset stages of
the disease and correlated with less severe neurologic deficit. Data
represents mean±SD for six individual mice. Single asterisk, p<0.05;
double asterisk, p<0.01
PCR similarly at different time points after MOG35–55immunization. We observed that sustained reductions in
Foxp3 mRNA expression during the early EAE induction
period in sham-treated EAE animals compared to controls (p<
0.01). β-elemene treatment induced a significant expansion
of Foxp3 mRNA expression within the spinal cord that could
be detected at a very early stage (Fig. 6a). The increased
Foxp3 mRNA expression was even more prominent 15 days
after MOG35–55-immunization, (p<0.001). Similar results
had been presented between specific Ag MOG35–55 peptide
only induced local DLN cells and treatment of cells with
10 μM β-elemene (Fig. 6b).
Discussion
38
β-elemene treatment inhibits Th17 cell formation within
the spinal cord during the acute phases of EAE. These data
indicated that β-elemene ameliorate EAE by inhibiting the
Ag-specific Th17 cell proliferation.
However, it is still unknown by what mechanism βelemene suppresses expansion of the Th17 cell subset in
EAE animals, since pro-inflammatory cytokines determine
T cell differentiation and the final outcome of MS/EAE. To
further address the mechanisms involved in the inhibition
of Th17 cell by β-elemene, we examined the crucial
cytokines involved in differentiation and production of
Th17 cells. studies have shown Th17 cells differentiation is
independent of IL-23 and is induced by TGF-β plus IL-6
(Yang et al. 2008; Nurieva et al. 2007), but maintenances of
pro-inflammatory Th17 cells requires the presence of IL-23
(Mangan et al. 2006; Langrish et al. 2005; Rachitskaya
et al. 2008). Both in vitro and in vivo differentiation of
Th17 cell lineage is required in the activation of STAT3,
which is activated by IL-6, and then up-regulation of
RORγt (Zhou et al. 2007; Yang et al. 2008a) that is served
as the master switch of differentiation of Th17 cell (Wei
et al. 2007; Ichiyama et al. 2008; Manel et al. 2008; Zhou
et al. 2008). Our data discovered that β-elemene obviously
inhibits RORγt, IL-6, IL-23 production in vivo and in vitro,
suggesting that the inhibition of RORγt, IL-6, and IL-23 is
a mechanism of regulation of EAE by β-elemene. Since
IL-6 has been reported to promote differentiation of naïve
CD4+ T cells into Th17 cells in vitro, the level of IL-6
secretion by inflammatory cells could be playing a
crucial role for in vivo development and expansion of Th17
cells (Hirota et al. 2007). Our in vitro and vivo studies
demonstrated significantly reduced IL-6 levels in β-elemenetreated mice, suggesting that down-regulation of Th17 by
β-elemene could be a consequence of reduced IL-6 secretion,
a crucial acute protein, and an initiator of Th17 cell
differentiation, but not a result of the up- or downregulation
of TGF-β. A less severe inflammatory environment in
peripheral lymphoid tissue as well as in the CNS after
β-elemene therapy may prevent significant Th17 migration
into the CNS, thereby delaying disease onset and inducing
less severe CNS pathology.
In addition, the β-elemene mediated non-specific and
specific immune modulating effects, on peripheral lymphoid
tissues and CNS in β-elemene-treated EAE animals, likely
contributes to their less severe clinical course. Antiinflammatory regulatory T cells have been found to be an
important CD4 cell subpopulation for controlling the
development of autoimmune disease (Fernandez-Martin
et al. 2006; Sakaguchi 2005; Reddy et al. 2004; Viglietta
et al. 2004). Adoptive transfer of Treg cells has been
shown to be of therapeutic efficacy in several animal
autoimmune disease models. Since Foxp3 is a marker for
Treg cells (Kasper et al. 2007), our study, by examining
J Mol Neurosci (2011) 44:31–40
Foxp3 mRNA expression, shows that β-elemene therapy
in MOG-immunized mice is associated with rapid expansion
of the Treg cell population in peripheral lymphoid tissue and
in CNS, this β-elemene-induced expansion of Treg cells was
sustained over 2 weeks. In fact, β-elemene-treated EAE
animals that manifested delayed onset of clinical disease and
less neurologic damage were found to have higher numbers of
Treg cells within both DLNs and spinal cord. The β-elemeneinduced, higher Treg population may play an important
role in reducing the peripheral immune response to MOG
autoantigen, and may be the major source of Tregs migrating
into CNS to minimize inflammation within CNS white matter.
A recent study showed that anti-inflammatory vasoactive
intestinal peptide also prevents neurologic progression in
MOG-EAE by inducing Treg cell expansion in peripheral
lymphoid tissue and the CNS (Yang et al. 2008). As reported,
TGF-β directed the differentiation of Treg and proinflamatory Th17 cells, by facilitating IL-17 production early after
exposure to IL-6 and in retarding further Th17 differentiation, but only higher TGF-β directed the differentiation of
Treg (Yang et al. 2008b). RT-PCR analysis on TGF-β from
DLN cells and spinal cord demonstrated that there was a
rapid marked increase on EAE mice; meantime, a trend
toward diminished RNA expression of TGF-β cytokines by
β-elemene treatment had been seen, but it did not reach
a statistical significance. So as reported, the differentiation
of a CD4+ effector cell to either a Th17 inflammatory
cell or a Foxp3 regulatory cell is dependent upon the
cytokine environment as well as other intrinsically
expressed molecules (Bettelli. 2007). β-elemene may
have a direct effect on disease progression by either
mediating inhibition of the Th17 pathway, which would
reduce proinflammatory mediators and ameliorate disease
activity, or a direct enhancement only at higher level of
TGF-β and resulting a corresponding increase in Treg
function that may indirectly reduce IL-17expression and
polarization.
In conclusion, we investigated the mechanism behind the
neuroprotective effects of β-elemene in classic autoimmune
EAE animals and found that β-elemene has striking
pleiotropic immunomodulatory effects on the peripheral
lymphatic tissues as well as on the CNS target organ.
β-elemene appears to restrain the overwhelming autoimmune
response in MOG-immunized EAE animals and restores it to a
more balanced immune status. Our studies suggest that
multiple alterations including a reduction in total autoreactive
T cells, as well as an alteration in the balance between Th17
cells and expanded Treg cell populations within peripheral
lymphoid tissue and CNS all contribute to β-elemenemediated neuroprotection.
Acknowledgments This study was supported by research grants from
the China Liaoning Province Education Department (No.2009A733)
J Mol Neurosci (2011) 44:31–40
References
Bettelli E, Carrier Y, W G et al (2006) Reciprocal developmental
pathways for the generation of pathogenic effector TH17 and
regulatory T cells. Nature 441:235–238
Bettelli E (2007) Building different mouse models for human MS.
Ann NY Acad Sci 1103:11–18
Chen W, Jin W, Hardegen N et al (2003) Conversion of peripheral
CD4+ CD25− naive T cells to CD4+ CD25+ regulatory T cells
by TGF-beta induction of transcription factor Foxp3. J Exp Med
198:1875–1886
Coffman RL (2006) Origins of the T(H)1–T(H)2 model: a personal
perspective. Nat Immunol 7:539–541
Fernandez-Martin A, Gonzalez-Rey E, Chorny A et al (2006)
Vasoactive intestinal peptide induces regulatory T cells during
experimental autoimmune encephalomyelitis. Eur J Immunol
36:318–326
Fontenot JD, Gavin MA, Rudensky AY (2003) Foxp3 programs the
development and function of CD4+ CD25+ regulatory T cells.
Nat Immunol 4:330–336
Fu N (1984) Antitumor effect and pharmacological actions of βelemene isolated from the rhizome of Curcuma aromatica.
Zhong Yao Tong Bao 9:83–87
Gately MK, Renzetti LM, Magram J et al (1998) The interleukin-12/
interleukin-12-receptor system: role in normal and pathologic
immune responses. Annu Rev Immunol 16:495–521
Goverman J, Perchellet A, Huseby ES (2005) The role of CD8(+) T
cells in multiple sclerosis and its animal models. Curr Drug
Targets Inflamm Allergy 4:239–245
Hirota K, Hashimoto M, Yoshitomi H et al (2007) T cell self-reactivity
forms a cytokine milieu for spontaneous development ofIL-17+
Th cells that cause autoimmune arthritis. J Exp Med 204:41–47
Huseby ES, Liggitt D, Brabb et al (2001) A pathogenic role for
myelin-specific CD8(+) T cells in a model for multiple sclerosis.
J Exp Med 194:669–676
Hofstetter HH, Ibrahim SM, Koczan D (2005) Therapeutic efficacy of
IL-17 neutralization in murine experimental autoimmune encephalomyelitis. Cell Immunol 237:123–130
Hofstetter HH, Toyka KV, Tary-Lehmann, Paul VL (2007) Kinetics and
organ distribution of IL-17-producing CD4 cells in proteolipid
protein 139–151 peptide-induced experimental autoimmune
encephalomyelitis of SJL mice. J Immunol 178:1372–1378
Ichiyama K, Yoshida H, Wakabayashi Y et al (2008) Foxp3 inhibits
RORgammat-mediated IL-17A mRNA transcription through
direct interaction with RORgammat. J Biol Chem 283:17003–17008
Ivanov II, McKenzie BS, Zhou L (2006) The orphan nuclear receptor
RORgammat directs the differentiation program of proinflammatory
IL-17+T helper cells. Cell 126:1121–1133
Kasper LH, Haque A, Haque S (2007) Regulatory mechanisms of the
immune system in multiple sclerosis. T regulatory cells: turned
on to turn off. J Neurol 254S:10–14
Kohm AP, Carpentier PA, Anger HA, Miller SD (2002) Cutting edge:
CD4+ CD25+ regulatory T cells suppress antigen-specific
autoreactive immune responses and central nervous system
inflammation during active experimental autoimmune encephalomyelitis. J Immunol 169:4712–4716
Komiyama Y, Nakae S, Matsuki T (2006) IL-17 playsan important
role in the development of experimental autoimmune encephalomyelitis. J Immunol 177:566–573
Langrish CL, Chen Y, Blumenschein WM et al (2005) IL-23 drives a
pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201:233–240
Liu X, Lee YS, Yu CR, Egwuagu CE (2008) Loss of STAT3 in CD4+
T cells prevents development of experimental autoimmune
diseases. J Immunol 180:6070–6076
39
Manel N, Unutmaz D, Littman DR (2008) The differentiation of
human T(H)-17 cellsrequires transforming growth factor-beta and
induction of the nuclear receptor RORgammat. Nat Immunol
9:641–649
Mangan PR, Harrington LE, O'Quinn DB et al (2006) Transforming
growth factor-beta induces development of the T(H)17 lineage.
Nature 441:231–234
McGeachy MJ, Stephens LA, Anderton SM (2005) Natural recovery
and protection from autoimmune encephalomyelitis: contribution
of CD4+ CD25+ regulatory cells within the central nervous
system. J Immunol 175:3025–3032
Mosmann TR, Coffman RL (1989) TH1 and TH2 cells: different
patterns of lymphokine secretion lead to different functional
properties. Annu Rev Immunol 7:145–173
Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE (1999) The IL4 receptor: signaling mechanisms and biologic functions. Annu
Rev Immunol 17:701–738
Nurieva R, Yang XO, Martinez G et al (2007) Essential autocrine
regulation by IL-21 in the generation of inflammatory T cells.
Nature 448:480–483
Rachitskaya AV, Hansen AM, Horai R et al (2008) Cutting edge:NKT
cells constitutively express IL-23 receptor and RORgammat and
rapidly produce IL-17 upon receptor ligation in an IL-6independent fashion. J Immunol 180:5167–5171
Reddy J, Illes Z, Zhang X (2004) Myelin proteolipid protein-specific
CD4+ CD25+ regulatory cells mediate genetic resistance to
experimental autoimmune encephalomyelitis. Proc Natl Acad Sci
USA 101:15434–15439
Reddy J, Waldner H, Zhang X, Illes Z, Wucherpfennig KW (2005)
Cutting edge: CD4+ CD25+ regulatory T cells contribute to
gender differences in susceptibility to experimental autoimmune
encephalomyelitis. J Immunol 175:5591–5595
Sakaguchi S (2005) Naturally arising Foxp3-expressing CD25+ CD4+
regulatory T cells in immunological tolerance to self and nonself. Nat Immunol 6:345–352
Steinman L (2001) Myelin-specific CD8 T cells in the pathogenesis of
experimental allergic encephalitis and multiple sclerosis. J Exp
Med 194:F27–F30
Stockinger B, Veldhoen M (2007) Differentiation and function of
Th17 T cells. Curr Opin Immunol 19:281–286
Tan P, Zhong W, Cai W (2000) Clinical study on treatment of 40 cases
of malignant brain tumor by elemene emulsion injection.
Zhongguo Zhong Xi Yi Jie He Za Zhi 20:645–648
Tzartos JS, Friese MA, Craner M et al (2007) Interleukin-17
production in CNS-infiltrating T-cells and glial cells is associated
with active disease in multiple sclerosis. Am J Pathol 172:146–155
Viglietta V, Baecher-Allan C, Weiner HL, Hafler DA (2004) Loss of
functional suppression by CD4+ CD25+ regulatory T cells in
patients with multiple sclerosis. J Exp Med 199:971–979
Wang J, Zhang H, Sun Y (1996) Phase III clinical trial of elemene
emulsion in the management of malignant pleural and peritoneal
effusions. Zhonghua Zhong Liu Za Zhi 18:464–467
Wei L, Laurence A, Elias KM, O'Shea JJ (2007) IL-21 is produced by
Th17 cells and drives IL-17 production in a STAT3-dependent
manner. J Biol Chem 282:34605–346010
Wei L, Chuanzhen L (2008) Elemene emulsion attenuate the
expression of TNFα, IL-1β, and NO in the striatum of rat focal
cerebral ischemia model. Chin J Gerontol 28(7):556–558
Wu W, Liu K, Tang X (1999) Preliminary study on the antitumor
immuno-protective mechanism of β-elemene. Zhong-hua Zhong
Liu Za Zhi 21:405–408
Yang H, Wang X, Yu L, Zheng S (1999) Study on the anticancer
mechanism of elemene (in Chinese). Chin Clin Cancer 26:4–7
Yang L, Anderson DE, Baecher-Allan C et al (2008a) IL-21 and TGFbeta are required for differentiation of human T(H)17 cells.
Nature 454:350–352
40
Yang XO, Nurieva R, Martinez GJ et al (2008b) Molecular
antagonism and plasticity of regulatory and inflammatory T cell
programs. Immunity 29:44–56
Yang XO, Pappu BP, Nurieva R et al (2008c) T helper 17 lineage
differentiation is programmed by orphan nuclear receptors ROR
alpha and ROR gamma. Immunity 28:29–39
Zhou L, Liu W, Yu L (2001) Beta-elemene induces apoptosis of K562
leukemia cells (in Chinese). Zhonghua Zhong Liu Za Zhi
23:196–198
J Mol Neurosci (2011) 44:31–40
Zhou H, Shen J, Hou J et al (2003) Experimental study on apoptosis
induced by elemene in glioma cells (in Chinese). Ai Zheng
22:959–963
Zhou L, Ivanov II, Spolski R et al (2007) IL-6 programs T(H)-17 cell
differentiation by promoting sequential engagement of the IL-21
and IL-23pathways. Nat Immunol 8:967–974
Zhou L, Lopes JE, Chong MM et al (2008) TGF-beta-induced Foxp3
inhibits T(H)17 cell differentiation by antagonizing RORgammat
function. Nature 453:236–240