Download Cryptochrome 1 controls tomato development

The Plant Journal (1999) 18(5), 551–556
SHORT COMMUNICATION
Cryptochrome 1 controls tomato development in response
to blue light
Luciano Ninu1, Margaret Ahmad2,3, Carolina Miarelli1,
Anthony R. Cashmore2 and Giovanni Giuliano1,*
1Ente per le Nuove tecnologie, l’Energia e l’Ambiente
(ENEA), Innovation Department, Casaccia Research
Center, PO Box 2400, Rome 00100AD, Italy,
2Plant Science Institute, University of Pennsylvania,
Philadelphia, PA 19104, USA, and
3Université Pierre et Marie Curie, Laboratoire de
Physiologie du Développement des Plantes, 4, Place
Jussieu, 75252 Paris, France
Summary
Cryptochrome genes (CRY) are a novel class of plant
genes encoding proteins that bear a strong resemblance
to photolyases, a rare class of flavoproteins that absorb
light in the blue (B) and UV-A regions of the spectrum
and utilise it for photorepair of UV-damaged DNA. In
Arabidopsis, both CRY1 and CRY2 are implicated in
numerous blue light-dependent responses, including
inhibition of hypocotyl elongation, leaf and cotyledon
expansion, pigment biosynthesis, stem growth and internode elongation, control of flowering time and phototropism. No information about the in vivo function of CRY
genes is available in other plant species. The tomato CRY1
gene (TCRY1) encodes a protein of 679 amino acids, which
shows 78% identity and 88% similarity to Arabidopsis
CRY1. In order to verify the in vivo function of TCRY1, we
constructed antisense tomato plants using the C-terminal
portion of the gene. Partial repression of both mRNA and
protein levels was observed in one of the transformants.
The progeny from this transformant showed an elongated
hypocotyl under blue but not under red light. This
character co-segregated with the transgene and was
dependent on transgene dosage. An additional, partially
elongated phenotype was observed in adult plants grown
in the greenhouse under dim light and short days with no
artificial illumination. This phenotype was suppressed by
artificial illumination of both short and long photoperiods.
The synthesis of anthocyanins under blue light was
reduced in antisense seedlings. In contrast, carotenoid
Received 15 March 1999; revised 7 April 1999; accepted 8 April 1999.
*For correspondence (fax 139 6 30483215;
e-mail [email protected]).
© 1999 Blackwell Science Ltd
and chlorophyll levels and second positive phototropic
curvature were essentially unaltered.
Introduction
Light is perceived by plants via a diverse array of photoreceptors: phytochromes (responding chiefly to the red (R)
and far-red (FR) regions of the spectrum), cryptochromes,
responding to blue (B), UV-A and UV-B photoreceptors.
Although responses to B have been known in plants for
over 150 years, the molecular nature of cryptochromes has
been elusive until recently. In Arabidopsis, the hy4 mutant
shows exaggerated hypocotyl elongation when grown
under B (Ahmad and Cashmore, 1993; Koornneef et al.,
1980). Additional phenotypes controlled by the HY4
gene are anthocyanin biosynthesis and expression of the
chalcone synthase gene (Ahmad et al., 1995; Fuglevand
et al., 1996). The protein product of HY4, CRY1, bears a
strong homology to microbial type I photolyases, a rare
class of flavoproteins able to absorb B/UV-A light and
utilise it for the photoreactivation of UV-damaged DNA
(Ahmad and Cashmore, 1993). CRY1 also carries a Cterminal extension with some similarity to tropomyosin
which has been shown, by mutational analysis, to be
essential for cryptochrome function (Ahmad et al., 1995).
Like photolyases, the CRY1 protein expressed in vitro is
able to bind the chromophores FAD and pterin but, unlike
photolyases, is devoid of DNA photoreactivating activity
(Lin et al., 1995; Malhotra et al., 1995).
One additional cryptochrome gene, CRY2, has been
isolated from Arabidopsis (Hoffman et al., 1996; Lin et al.,
1996). CRY2 corresponds to the previously described FHA
gene, involved in the control of flowering time (Guo et al.,
1998). Another member of the plant CRY gene family,
the mustard gene SA-PHR1, lacks a C-terminal extension
and, like Arabidopsis HY4/CRY1, its protein product is
devoid of DNA photoreactivating activity both in vitro and
in E. coli (Batschauer, 1993; Malhotra et al., 1995). Recently,
an Arabidopsis bona fide photolyase has been cloned and
shown to belong to the type II class of photolyases first
described in goldfish (Ahmad et al., 1997; Landry et al.,
1997; Yasui et al., 1994). CRY genes have been isolated
from organisms other than higher plants, including
Chlamydomonas (Small et al., 1995).
No evidence is yet available on the function or
organisation of the CRY gene family in a plant different
from Arabidopsis. With these questions in mind we decided
551
552 Luciano Ninu et al.
to start the characterisation of the tomato CRY gene family.
Tomato offers several advantages for the study of photomorphogenesis: several photomorphogenic mutants are
available, including phytochrome mutants (Kendrick et al.,
1997) as well as B-insensitive mutants (R.E. Kendrick and
M. Koornneef, personal communication). In the tomato
aurea mutant, which shows a strong reduction in both
light-stable and light-labile phytochromes, B is absolutely
required for the survival of the plant and for plastidic
gene expression (Oelmuller and Kendrick, 1991). Unlike
Arabidopsis, which has a rosette type of development,
tomato is a cauline plant, facilitating the measurement of
photomorphogenic characters (such as internode length)
in the adult plant.
Results
Mutants in the Arabidopsis CRY1/HY4 gene have an
elongated hypocotyl when grown under B. We have cloned
two tomato CRY genes, one of which (TCRY1) encodes a
protein of 679 amino acids, showing 78% identity and 88%
similarity to Arabidopsis CRY1, while the second (TCRY2)
is more similar to Arabidopsis CRY2/FHA (G. Perrotta and
G. Giuliano, manuscript in preparation).
In order to study the in vivo function of tomato CRY1,
we decided to construct transgenic plants with lowered
TCRY1 mRNA and protein levels using an antisense
mRNA approach. The C-terminal region of the TCRY1
cDNA was therefore cloned between the 35S promoter
and the Nos polyadenylation signal in the pBI121 vector
(Figure 1a) and introduced into Solanum lycopersicum L.
(cv. Moneymaker) via Agrobacterium-mediated transformation. After repeated selection on kanamycin and
PCR-screening for the presence of the transgene, four
primary transformants (T1) were recovered. All the transformants contained one copy of the transgene per diploid
genome (Figure 1b). The transformants showed variable
levels of antisense and sense TCRY1 mRNA, with transformant as14 showing the most pronounced repression of
sense mRNA (Figure 1c).
The T1 plants were grown to maturity and selfed to
obtain seeds. T2 seedlings from all transformants were
grown under B and their hypocotyl lengths were
measured. Line as14 showed an enrichment in the
longest hypocotyl classes (Figure 2a). This suggests that
the presence of the antisense TCRY1 transgene enhances
hypocotyl elongation under B. To confirm this hypothesis,
DNA was extracted from seedlings belonging to the shortest and longest hypocotyl classes. All the short seedlings
contained no copies of the transgene, while all the long
ones contained two copies, as judged by quantitative PCR
(Figure 2b). This confirms that, in line as14, the presence of
the transgene is associated with enhancement of hypocotyl
elongation and, moreover, that the transgene has a dosage
Figure 1. Construction and characterisation of TCRY1 antisense plants.
(a) Schematic representation of the TCRY1 cDNA (top) and the antisense
construct (bottom). The sequence of the cDNA has been deposited in
GenBank under accession number AF130423.
(b) PCR quantitation of transgene copies. Top: calibration curve. Bottom:
Quantitation in T1 transgenic plants. E indicates the band corresponding
to the endogenous TCRY1 gene (containing an intron), T the band
corresponding to the transgene.
(c) RT-PCR quantitation of antisense (top) and sense (bottom) TCRY1 mRNA
in T1 transgenic plants.
effect (since no seedlings containing one copy were found
in the longest class).
Homogeneous T3 populations were obtained by selfing
T2 sibling plants with zero copies (1 / 1) and two copies
(t/t) of the transgene. The amount of CRY1 protein in
these T3 plants was quantified through Western blotting
© Blackwell Science Ltd, The Plant Journal, (1999), 18, 551–556
Cryptochrome control of tomato development 553
Figure 2. The antisense TCRY1 transgene affects hypocotyl length under
blue light (B).
(a) Distribution of hypocotyl lengths in T2 seedlings from wild-type and
line as14 grown under B (approximately 8 µmol m–2 sec–1).
(b) PCR quantitation of transgene copies in the shortest and longest
hypocotyl classes.
of protein extracts from dark-grown seedlings (Figure 3a).
All seedlings show a signal at approximately the same
apparent molecular mass as Arabidopsis CRY1. The less
intense signal observed in tomato could be due to the
lower absolute levels of cryptochrome, or to the fact that
we used an antibody made to the Arabidopsis protein
which does not cross-react as well with the tomato protein.
The t/t seedlings show an approximately 70% reduction of
the levels of CRY1 protein. The seedlings were then grown
under B and R of different irradiances. At all irradiances
used, no significant differences in hypocotyl length were
observed under R, while varying degrees of difference were
observed under B. The highest difference was observed at
an irradiance of 8 µmol m–2 sec–1 (Figure 3b and data not
shown). These results indicate that transgenic impairment
of TCRY1 function does not affect R perception. The phenotype of the elongated-hypocotyl seedlings is shown in
Figure 4a.
In Arabidopsis, cryptochromes have been implicated in
first positive phototropism, a B-mediated response. First
positive phototropism is a low amplitude, very low fluence
response (Janoudi and Poff, 1990), and is affected in double
CRY1/CRY2 mutants (Ahmad et al., 1998). This response is
difficult to measure in tomato, which germinates more
unevenly than Arabidopsis and therefore shows uneven
© Blackwell Science Ltd, The Plant Journal, (1999), 18, 551–556
Figure 3. Physiological characterisation of T3 seedlings from line as14.
(a) (Left) Western blot quantitation of the CRY1 protein in Arabidopsis
thaliana (lane At) and T3 seedlings from line 14 carrying zero (1 / 1) and
two copies (t/t) of the transgene. (Right) Coomassie staining, showing equal
loading of proteins on the gel.
(b) Hypocotyl lengths of T3 seedlings from line as14 grown under B and R
(approximately 8 µmol m–2 sec–1).
(c) Second positive phototropic curvature of seedlings exposed to unilateral
B (approximately 0.1 µmol m–2 sec–1) for 16 h.
(d) Anthocyanin content of hypocotyls of T3 seedlings from line as14 grown
under B and R.
(e) Chlorophyll and carotenoid content of cotyledons of T3 seedlings from
line as14 grown under B and R.
phototropic responses. Therefore, we were able to accurately measure only second positive phototropism, which
has a much higher amplitude than first positive phototropism (Janoudi and Poff, 1990). The t/t seedlings show a
normal second positive phototropism (Figure 3c), indicat-
554 Luciano Ninu et al.
Figure 4. Phenotypes of TCRY1 antisense plants.
(a) Representative seedlings from the 1 / 1 (wild-type) and t/t (2 copies of the transgene) populations, grown under B.
(b) Representative adult plants from the same two populations, grown in the greenhouse during the winter with no artificial illumination.
ing that TCRY1 is only marginally implicated in this
response.
B and R are known to affect anthocyanin synthesis
and chloroplast differentiation in tomato. Therefore, the
amount of anthocyanin pigments in the hypocotyl, and
carotenoid and chlorophyll pigments in the cotyledons,
were measured in seedlings grown under B and R.
Anthocyanin levels were significantly higher under B than
under R. t/t seedlings show a significant decrease of anthocyanins under B, but not under R (Figure 3d). In contrast,
chlorophyll and carotenoid levels were essentially
unaltered in the t/t seedlings (Figure 3e,f).
During growth in the greenhouse of t/t plants, we
observed a conditional adult phenotype. Plants grown
during the summer or supplemented with artificial
illumination did not show substantial phenotypic alterations. However, when plants were grown during the winter
(November–January) under a short photoperiod with no
artificial illumination, at an irradiance below 50 µmol
m–2 sec–1 a striking phenotypic difference was observed:
the plants containing two copies of the transgene presented
a substantial increase in internode length and in overall
plant height and an increase in apical dominance
(Figure 4b). This phenotype was completely suppressed
by the supplementation with artificial light (approximately
200 µmol m–2 sec–1), at either short (8 h light/16 h dark) or
long (16 h light/8 h dark) photoperiods.
Discussion
The data presented here constitute the first functional
characterisation of a cryptochrome gene from a plant
other than Arabidopsis. Partial etiolation and reduction in
anthocyanin content was observed in plants derived from
antisense line as14, the only line showing reduced, albeit
still detectable, CRY1 protein levels (Figure 3a).
Often, null mutants in plant photoreceptor genes are codominant, showing a gene dosage effect similar to the one
we observe in our antisense plants. This phenomenon is
probably due to the fact that the number of photoreceptor
molecules is rate-limiting in signal transduction, and is
probably also the case for tomato CRY1. The fact that
the most severe phenotypes were observed in plants
containing two copies of the partially suppressive TCRY1
antisense transgene corroborates this hypothesis. An
‘allelic series’ of tomato transgenic lines expressing high,
medium and low CRY1 levels is being produced to further
substantiate this observation.
In Arabidopsis, CRY1 has been implicated in developmental responses as different as inhibition of hypocotyl
© Blackwell Science Ltd, The Plant Journal, (1999), 18, 551–556
Cryptochrome control of tomato development 555
elongation, stem growth and internode elongation, leaf
and cotyledon expansion, B-dependent gene expression,
and anthocyanin accumulation (Ahmad and Cashmore,
1993; Ahmad and Cashmore, 1996; Fuglevand et al., 1996;
Koornneef et al., 1980) and, in combination with CRY2, in
first positive phototropism (Ahmad et al., 1998). In our
antisense plants, we observed alterations in hypocotyl
elongation under B, stem growth and internode elongation
in limiting light conditions, and anthocyanin levels under
B. Carotenoid and chlorophyll levels were substantially
unaltered, as was second positive phototropism, the only
phototropic response we were able to measure reliably.
This is in agreement with the concept, proposed by Briggs
and collaborators, that Nph1 is the main photoreceptor in
phototropic responses (Huala et al., 1997). Due to the great
variability in the phototropic response of individual tomato
seedlings, first positive phototropism, which has a lower
amplitude, has proven more difficult to measure reliably.
In view of the ongoing debate on the role of cryptochromes
in phototropism (Ahmad et al., 1998; Christie et al., 1998),
a careful examination of this issue has been started using
tomato as a model system and antisense impairment of
both TCRY1 and TCRY2.
Our data also show that complete de-etiolation of adult
tomato plants under limiting light conditions, such as the
ones found during winter, requires high levels of CRY1
protein. We addressed the question of whether the partially
etiolated phenotype observed in antisense plants during
the winter was due to the short photoperiod or to the
lower total amount of light perceived by the plant. The
etiolated phenotype was suppressed by artificial illumination, irrespective of the photoperiod, suggesting that the
perception of daylength is not important for the deetiolation of adult tomato plants containing reduced CRY1
levels. This observation is in agreement with the fact that
cultivated tomato does not show prominent photoperiodic
responses. The absence of photoperiodic responses in
tomato raises the question on the function of TCRY2
(G. Perrotta and G. Giuliano, manuscript in preparation),
since its Arabidopsis homologue, CRY2/FHA, has been
implicated in the photoperiodic control of flowering time
(Guo et al., 1998). Approaches similar to the one described
here are under way to address this question.
Experimental procedures
Basic molecular biological experiments were performed as
described by Sambrook et al. (1989). For construction of the
antisense vector, the CRY1 cDNA was subjected to 10 cycles
of PCR amplification using the primers CRY/Bam (CGGATCCACATGTACATCCGTCA) and CRY/Sac (TGAGCTCACAAATGTGGCAGAATG), which add BamHI and SacI sites at the ends of
the amplified fragment. After cloning in pBSK 1 (Stratagene) and
re-sequencing, the antisense fragment was cloned in the pBI121
plant expression vector (Jefferson et al., 1987) using the BamHI
© Blackwell Science Ltd, The Plant Journal, (1999), 18, 551–556
and SacI restriction sites and introduced in tomato plants (cv.
Moneymaker) via Agrobacterium -mediated transformation (van
Roekel et al., 1993).
For quantitation of the transgene copies, a calibration curve
was constructed by mixing appropriate amounts of linearised
plasmid DNA with genomic tomato DNA and amplifying for 30
cycles with the primers CRY-up (GAA CTC CGT GGA CAT TAG)
and CRY-dw (CTC TGT ATT AGC CAC TTG). The bands resulting
from the amplification of the endogenous gene and the plasmid
were separated on a 1% (w/v) agarose gel and quantified using a
Kodak Digital Science camera and software. The calibration curve
was then used to estimate the transgene copy number in the
transgenic plants. RT-PCR quantitation of sense and antisense
mRNA was conducted as described previously (Giuliano et al.,
1993) using the CRY-up primer for reverse transcription of the
antisense and CRY-dw for reverse transcription of sense RNA.
For physiological characterisation, seeds were germinated
aseptically on sterile medium (half-strength Murashige and
Skoog salts, 0.5% (w/v) sucrose and 0.8% (w/v) agar) for 2 days
under white fluorescent light (approximately 100 µmol m–2 sec–1)
and then transferred under R or B sources (approximately 8 µmol
m–2 sec–1) for an additional 6 days. Anthocyanins, carotenoids and
chlorophyll were extracted and quantified according to published
procedures (Kerckhoffs et al., 1997; Lichtenthaler, 1987). For
measuring second positive phototropic curvature, seedlings were
germinated as described above, transferred to complete
darkness for 6 days and then exposed for 16 h to unilateral B
(0.1 µmol m–2 sec–1). R and B light sources were made with Osram
fluorescent lamps: L36/60 (Red), additionally filtered through a Lee
Primary Red plastic filter (Ref. 106) and L36/67 (Blue), additionally
filtered through a Lee Dark Blue plastic filter (Ref. 88202–119).
Partial etiolation in adult transgenic plants was observed when
these were grown in the greenhouse during the period November–
January, under natural light not exceeding 50 µmol m–2 sec–1.
Additional illumination of greenhouse-grown plants was provided
by Osram Powerstar HQI halide vapour lamps, which show an
emission spectrum very similar to solar light. Western quantitation
of TCRY1 protein was performed by loading 25 micrograms
of total protein/lane and utilising an antibody raised against
Arabidopsis CRY1 according to published procedures (Ahmad
et al., 1995).
Acknowledgements
This work was supported by the EC Biotechnology program,
contract CT96–2124 (to G.G.) and by a CNRS fellowship to M.A.
We thank Patrizia Pallara, Elena Nebuloso, Olga Smirnova and
Tracy Byford for excellent technical assistance and Silvia Papalia
for help with sequencing.
References
Ahmad, M. and Cashmore, A.R. (1993) HY4 gene of Arabidopsis
thaliana encodes a protein with characteristics of a blue-light
photoreceptor. Nature, 366, 162–166.
Ahmad, M. and Cashmore, A.R. (1996) Seeing blue: The discovery
of cryptochrome. Plant Mol. Biol. 30, 851–861.
Ahmad, M., Jarillo, J.A., Klimczak, L.J., Landry, L.G., Peng, T.,
Last, R.L. and Cashmore, A.R. (1997) An enzyme similar to
animal type II photolyases mediates photoreactivation in
Arabidopsis. Plant Cell, 9, 199–207.
Ahmad, M., Jarillo, J.A., Smirnova, O. and Cashmore, A.R. (1998)
Cryptochrome blue-light photoreceptors of Arabidopsis
implicated in phototropism. Nature, 392, 720–723.
556 Luciano Ninu et al.
Ahmad, M., Lin, C.T. and Cashmore, A.R. (1995) Mutations
throughout an Arabidopsis blue-light photoreceptor impair bluelight-responsive anthocyanin accumulation and inhibition of
hypocotyl elongation. Plant J. 8, 653–658.
Batschauer, A. (1993) A plant gene for photolyase: an enzyme
catalyzing the repair of UV-light-induced DNA damage. Plant J.
4, 705–709.
Christie, J.M., Reymond, P., Powell, G.K., Bernasconi, P., Raibekas,
A.A., Liscum, E. and Briggs, W.R. (1998) Arabidopsis NPH1: a
flavoprotein with the properties of a photoreceptor for
phototropism. Science, 282, 1698–1701.
Fuglevand, G., Jackson, J.A. and Jenkins, G.I. (1996) UV-B, UV-A,
and blue light signal transduction pathways interact
synergistically to regulate chalcone synthase gene expression
in Arabidopsis. Plant Cell, 8, 2347–2357.
Giuliano, G., Bartley, G.E. and Scolnik, P.A. (1993) Regulation of
carotenoid biosynthesis during tomato development. Plant Cell,
5, 379–387.
Guo, H.W., Yang, W.Y., Mockler, T.C. and Lin, C.T. (1998)
Regulations of flowering time by Arabidopsis photoreceptors.
Science, 279, 1360–1363.
Hoffman, P.D., Batschauer, A. and Hays, J.B. (1996) PHH1, a novel
gene from Arabidopsis thaliana that encodes a protein similar
to plant blue-light photoreceptors and microbial photolyases.
Mol. Gen. Genet. 253, 259–265.
Huala, E., Oeller, P.W., Liscum, E., Han, I.S., Larsen, E. and Briggs,
W.R. (1997) Arabidopsis NPH1: a protein kinase with a putative
redox-sensing domain. Science, 278, 2120–2123.
Janoudi, A. and Poff, K.L. (1990) A common fluence threshold for
first and second positive phototropism in Arabidopsis thaliana.
Plant Physiol. 94, 1605–1608.
Jefferson, A.R., Kavanagh, T.A. and Bevan, M.W. (1987) GUS
fusion: beta-glucuronidase as a sensitive and versatile gene
fusion marker in higher plants. EMBO J. 6, 3901–3907.
Kendrick, R.E., Kerckhoffs, L.H.J., VanTuinen, A. and Koornneef,
M. (1997) Photomorphogenic mutants of tomato. Plant Cell
Environ. 20, 746–751.
Kerckhoffs, L.H.J., Schreuder, M.E.L., VanTuinen, A., Koornneef, M.
and Kendrick, R.E. (1997) Phytochrome control of anthocyanin
biosynthesis in tomato seedlings: analysis using photomorphogenic mutants. Photochem. Photobiol. 65, 374–381.
Koornneef, M., Rolff, E. and Spruit, C.J.P. (1980) Genetic control
of light-inhibited hypocotyl elongation in Arabidopsis thaliana
(L.) Heynh. Z. Pflanzenphysiol. 100, 147–160.
Landry, L.G., Stapleton, A.E., Lim, J., Hoffman, P., Hays, J.B.,
Walbot, V. and Last, R.L. (1997) An Arabidopsis photolyase
mutant is hypersensitive to ultraviolet-B radiation. Proc. Natl
Acad. Sci. USA, 94, 328–332.
Lichtenthaler, H. (1987) Chlorophylls and carotenoids: pigments
of photosynthetic membranes. Meth Enzymol. 148, 350–382.
Lin, C., Ahmad, M., Chan, J. and Cashmore, A.R. (1996) CRY2: a
second member of the Arabidopsis cryptochrome gene family.
Plant Physiol. 110, 1047.
Lin, C.T., Robertson, D.E., Ahmad, M., Raibekas, A.A., Jorns, M.S.,
Dutton, P.L. and Cashmore, A.R. (1995) Association of flavin
adenine dinucleotide with the Arabidopsis blue light receptor
CRY1. Science, 269, 968–970.
Malhotra, K., Sang-Tae, K., Batschauer, A., Dawut, L. and
Sancar, A. (1995) Putative blue-light photoreceptors from
Arabidopsis thaliana and Sinapis alba with a high degree
of sequence homology to DNA photolyase contain the two
photolyase cofactors but lack DNA repair activity. Biochemistry,
34, 6892–6899.
Oelmuller, R. and Kendrick, R.E. (1991) Blue light is required for
survival of the tomato phytochrome-deficient aurea mutant
and the expression of four nuclear genes coding for plastidic
proteins. Plant Mol. Biol. 16, 293–299.
van Roekel, J.S.C., Damm, B., Melchers, L.S. and Hoekema, A.
(1993) Factors influencing transformation frequency of tomato
(Lycopersicon esculentum). Plant Cell Report, 12, 644–647.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular
Cloning – a Laboratory Manual. Cold Spring Harbor: Cold Spring
Harbor Laboratory Press.
Small, G.D., Min, B.Y. and Lefebvre, P.A. (1995) Characterization
of a Chlamydomonas reinhardtii gene encoding a protein of the
DNA photolyase/blue light photoreceptor family. Plant Mol. Biol.
28, 443–454.
Yasui, A., Eker, A.P.M., Yasuhira, S., Yajima, H., Kobayashi, T.,
Takao, M. and Oikawa, A. (1994) A new class of DNA photolyases
present in various organisms including aplacental mammals.
EMBO J. 13, 6143–6151.
© Blackwell Science Ltd, The Plant Journal, (1999), 18, 551–556