Download The Gene Encoding Disabled-1 (DAB1), the Intracellular Adaptor of

THE JOURNAL OF BIOLOGICAL CHEMISTRY
© 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 278, No. 8, Issue of February 21, pp. 5802–5812, 2003
Printed in U.S.A.
The Gene Encoding Disabled-1 (DAB1), the Intracellular Adaptor
of the Reelin Pathway, Reveals Unusual Complexity in
Human and Mouse*
Received for publication, July 17, 2002, and in revised form, November 4, 2002
Published, JBC Papers in Press, November 21, 2002, DOI 10.1074/jbc.M207178200
Isabelle Bar‡§, Fadel Tissir ¶储, Catherine Lambert de Rouvroit‡, Olivier De Backer‡,
and André M. Goffinet¶
From the ‡Neurobiology Unit, University of Namur Medical School, 61, rue de Bruxelles, B5000 Namur, Belgium and
the ¶Developmental Genetics Unit, University of Louvain Medical School, Avenue E. Mounier, B1200 Brussels, Belgium
The Disabled-1 (Dab1) gene encodes a key regulator of
Reelin signaling. Reelin is a large glycoprotein secreted
by neurons of the developing brain, particularly CajalRetzius cells. The DAB1 protein docks to the intracellular part of the Reelin very low density lipoprotein receptor and apoE receptor type 2 and becomes tyrosinephosphorylated following binding of Reelin to cortical
neurons. In mice, mutations of Dab1 and Reelin generate identical phenotypes. In humans, Reelin mutations
are associated with brain malformations and mental retardation; mutations in DAB1 have not been identified.
Here, we define the organization of Dab1, which is similar in human and mouse. The Dab1 gene spreads over
1100 kb of genomic DNA and is composed of 14 exons
encoding the major protein form, some alternative internal exons, and multiple 5ⴕ-exons. Alternative polyadenylation and splicing events generate DAB1 isoforms. Several 5ⴕ-untranslated regions (UTRs)
correspond to different promoters. Two 5ⴕ-UTRs (1A and
1B) are predominantly used in the developing brain.
5ⴕ-UTR 1B is composed of 10 small exons spread over 800
kb. With a genomic length of 1.1 Mbp for a coding region
of 5.5 kb, Dab1 provides a rare example of genomic complexity, which will impede the identification of human
mutations.
Neuronal migration is a complex process that is affected in a
variety of human disorders such as periventricular heterotopias and different types of lissencephalies (1–3). The Disabled-1 (Dab1) gene belongs to the Reelin signaling pathway
that plays a key role during brain development in mouse and
human (4 – 6). Inactivation of Dab1, either by homologous recombination (7) or by spontaneous mutations in scrambler or
yotari mutant mice (8, 9), generates a phenotype similar to that
of Reelin-deficient mice. This phenotype is characterized by a
poor organization of architectonic patterns at the end of radial
* This work was supported in part by Grant 3.4533.95 from the Fonds
de la Recherche Scientifique et Médicale, Grants 186 and 248 from the
Actions de Recherches Concertées, and by the Fondation Médicale
Reine Elisabeth (Belgium). The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore be hereby marked “advertisement” in accordance with 18
U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBankTM/EBI Data Bank with accession number(s) AF525763,
AY131331, AY172736, and AY174214 –AY174232.
§ Chargée de Recherche of the Fonds National de la Recherche Scientifique. To whom correspondence should be addressed. Tel.: 32-81724-274; Fax: 32-81-724-280; E-mail: [email protected].
储 Postdoctoral Fellow supported by European Union Program CONCORDE Grant QLG3-CT-2000-00158.
neuronal migration (reviewed in Ref. 10). The neurons that are
the most affected include those of the cortical plate in the cortex
and hippocampus, Purkinje cells, and inferior olivary neurons. In
human, mutations in Reelin result in a specific lissencephaly
with mental retardation and severe abnormalities of the cerebellum, hippocampus, and brain stem (Norman-Roberts type,
OMIM257320) (11), a phenotype that shows similarity to its
mouse counterpart. Cognitive development is delayed, with little
or no language acquisition and no ability to sit or stand unsupported. Thus far, no human disease associated with mutations in
DAB1 or other genes in the Reelin pathway has been identified.
Reelin is an extracellular protein secreted by some neurons
such as Cajal-Retzius cells in the marginal zone of the embryonic cerebral cortex and hippocampus, external granule cells in
the cerebellum, olfactory mitral cells, and ganglion and amacrine cells in the mouse retina (10, 12) and in the spinal cord
(13, 14). The response of target neurons to Reelin requires the
expression of at least one of two surface receptors that belong to
the lipoprotein receptor family, viz. the very low density lipoprotein receptor and apoE receptor type 2, as well as the
presence of the intracellular adaptor DAB1. The DAB1 protein
contains a 180-amino acid N-terminal protein interaction/
phosphotyrosine-binding (PTB)1 domain that docks to the short
cytoplasmic tail of the very low density lipoprotein receptor or
apoE receptor type 2 at the level of NPXY motifs, with a preference for unphosphorylated motifs (15–19). Potential tyrosine
phosphorylation sites and a 310-amino acid C-terminal region of
unknown function follow the PTB domain. The binding of Reelin
to the extracellular part of both receptors induces phosphorylation of tyrosine residues of DAB1, particularly Tyr198 and Tyr220
(20, 21). Mice expressing a mutant form of DAB1 in which all the
potential tyrosine phosphorylation sites are mutated have a phenotype similar to reeler mice (4), and mice expressing a truncated
DAB1 protein missing the C-terminal part have an almost normal phenotype (22). This shows that the PTB domain and tyrosine phosphorylation are both necessary and sufficient to fulfill
most of the DAB1 functions. Cytoplasmic tyrosine kinases of the
Src family are able to phosphorylate DAB1 in vitro, but the
kinase(s) involved in DAB1 phosphorylation in vivo remain to be
identified (23). Similarly, the other downstream effectors of the
Reelin signal are not known.
1
The abbreviations used are: PTB, phosphotyrosine-binding; RACE,
rapid amplification of cDNA ends; P, postnatal day; E, embryonic day;
PAC, P1 artificial chromosome; YAC, yeast artificial chromosome; contig, group of overlapping clones; UTR, untranslated region; DMEM,
Dulbecco’s modified Eagle’s medium; RA, all-trans-retinoic acid; RT,
reverse transcription; IAP, intracisternal A particle; ORF, open reading
frame; uORF, upstream open reading frame; EST, expressed sequence
tag.
5802
This paper is available on line at http://www.jbc.org
The Dab1 Gene
5803
TABLE I
Primers used in this study
5⬘–3⬘ sequence
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
Orientation
Exon
Position on mouse contig
NW_000211.1
4683618–4683610 and
4557515–4557502
4557466–4557443
4557385–4557366
4820540–4820562
4820721–4820743
4683702–4683678
3690493–3690470
4557360–4557337
3690379–3690354
4445613–4445591
4445169–4445146
4806938–4806956
Not present
4683707–4683726
4691555–4691536
4557362–4557381
4447139–4447139
4446989–4447008
4444294–4444314
4444731–4444752
4445550–4445531
4445506–4445523
3689101–3689121
3690422–3690403
4445487–4445506
4445614–4445595
3690403–3690422
4357551–4357531
4445374–4445355
4445039–4445059
4767121–4767141
4797192–4797173
4757538–4757518
4823607–4823587
4821574–4821595
4806934–4806915
3690622–3690641
4445279–4445297
4026628–4026647
GATCCTGACCTTTCTTCCTGGAG
Antisense
2 and 3
TTCTGTCTCAGTTGACATCCTACT
TCTCCAAGAGAAAGGCTCCT
AATCAACAGACCTAAGAAATAGC
GGCAGATACCTATGGCAGCACA
CGGACACTTCATCAATCCCAATCAG
CCCATCAGCATTTCGCCACCTAAC
CAGAAAGGACACCCAACACCGTGC
ACTCCCTCCTAAATCACCACAGCATC
GAGCATCCTCCTTGGCTGCCGCA
AGACCGATCGGAGCGAAGAGCTTG
ACTTCAACAAAGTCGGGGTTG
TGAAGTCAGATGTGTGAGAGG
TCGGGGAGACAAGTTATGTC
GATTCCTCCAAAGGAGATGG
AGGGAGGAGCCTTTCTCTTG
TTTGGCACTGGGAGGCATTGT
GAAGGGAGGGAGGAGAGAAA
TAGCCCATTGACTCTAGAGGT
GGTTCTAATTTACAGGAGGGTC
CACTCAAACGCGCTCTCCAG
CGGCGCTCACCCGGGCTT
TCTACTTACTGACCTCTGTGG
GTGTGGGCTCTGCTCAGGAA
GGGGAGGATGGACCCAGCTC
GGAGCATCCTCCTTGGCTGC
TTCCTGAGCAGAGCCCACAC
CTCCACCATCACGAGTGACAT
CACTGAGCGTCCCAAGCCCTT
AATTAGCAGAGTCCTAGAGGG
AGAAGGAAGGTGTTTATGATG
CAGGAGGGGTGGACATGTCT
TGGCCACAAATCTGTGATTCC
AGGAACCGAACCCACGGAGTA
CTGGTACAATTCTGGTAATGTG
TGGAGAAGGCCTCTGAGGTA
ACTAGAGCTGCCGGGAGTGA
ACTCCGCTGAGCTGTCGCT
TGGCCCTGGCAATCTCAGAA
Antisense
Antisense
Sense
Sense
Antisense
Antisense
Antisense
Antisense
Antisense
Antisense
Sense
Antisense
Sense
Antisense
Sense
Antisense
Sense
Sense
Sense
Antisense
Sense
Sense
Antisense
Sense
Antisense
Sense
Antisense
Antisense
Sense
Sense
Antisense
Antisense
Antisense
Sense
Antisense
Sense
Sense
Sense
2
2
15
15
3
1B1
2
1B1
1A
1D
12
Various isoforms of the mouse DAB1 protein have been described. The main form contains an open reading frame of 555
amino acids encoding a 80-kDa protein, the predominant form
expressed in the brain. Another form, 555*, contains an additional exon inserted in-frame between codons 241 and 242.
Form 217 results from alternative polyadenylation, whereas
isoform 271 is similar to form 555, except that an additional
exon of 270 bp containing a stop codon is inserted between
codons 241 and 242. Upon Northern blotting, three transcripts
of 5.5, 4.0, and 1.8 kb have been detected with a probe covering
the PTB domain, and protein isoforms of 36, 45, 60, 80, and 120
kDa have been observed on Western blots (23).
In this work, we defined the genomic organization of the
human and mouse Dab1 genes. The structure is highly complex
and similar in both species. The gene extends over ⬎1 Mbp of
genomic DNA due to the presence of large introns and the wide
dispersion of several alternative transcription initiation sites.
The presence of several alternative promoters and alternatively spliced forms points to a fine regulation of Dab1 expression and further emphasizes the key position of this gene as a
switch in the Reelin signaling pathway. The complexity of the
gene may explain why no human disease associated with DAB1
mutations could be identified thus far.
EXPERIMENTAL PROCEDURES
Rapid Amplification of cDNA Ends (RACE)—Information on the
primers used is provided in Table I. First-strand cDNA synthesis was
performed at 60 °C on 1 ␮g of DNase I-treated RNA (embryonic human
brain and P0 mouse brain) using Dab1-specific primer in exon 2 (Table
3
4
2
1C
1C
1A
1A
1B1
1A
1A
1B1
1B8
1D
1D
9
10
5
15
15
12
1B1
1D
1B2
Position on
Y08379
339–317
281–258
200–181
1971–1992
2151–2172
423–399
Not present
175–152
Not present
115–93
Not present
1600–1618
Not present
428–447
545–526
177–196
Not present
Not present
Not present
Not present
52–33
8–25
Not present
Not present
Not present
116–97
Not present
Not present
Not present
Not present
943–963
1032–1013
684–664
Not present
Not present
1596–1577
Not present
Not present
Not present
I) and Thermoscript reverse transcriptase (Invitrogen). After RNase H
digestion, the cDNA was purified with a GlassMAX spin cartridge
(Invitrogen) and modified by adding a polydeoxycytidine sequence to
the 5⬘-end using terminal deoxynucleotidyltransferase (Invitrogen).
cDNAs were amplified by PCR with an abridged anchor primer (5⬘-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3⬘), which hybridized to the poly(dC) sequence, and antisense Dab1-specific primer 2
using Taq DNA polymerase (Biotools). Nested PCRs were performed
with the abridged universal amplification primer (5⬘-GGCCACGCGTCGACTAGTAC-3⬘) and antisense Dab1-specific primer 3. The PCR
products were cloned into the pCRII vector (Invitrogen) and sequenced
using the BigDye terminator cycle sequencing kit (PE Biosystems) and
an ABI Prism 377 sequencer.
3⬘-RACE was carried out on 2 ␮g of total RNA from E15 mouse brain.
First-strand cDNA synthesis was performed using an adaptor oligo(dT)
primer (5⬘-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3⬘)
with Superscript II reverse transcriptase (Invitrogen). cDNA was amplified using Dab1-specific primer 4 in exon 15 and the abridged universal amplification primer. An aliquot of the reaction was subjected to
nested PCR using downstream Dab1-specific primer 5 and the adaptor
primer. The 3⬘-RACE products were subcloned into the pCRII vector for
sequencing.
5⬘-RNA Ligase-mediated RACE—5⬘-RNA ligase-mediated RACE was
performed using the GeneRacer kit (Invitrogen). 250 ng of mRNA from
E17 mouse brain was dephosphorylated using calf intestinal phosphatase and decapped using tobacco acid pyrophosphatase to target fulllength mRNAs. An RNA oligonucleotide was ligated to the decapped
mRNA, and reverse transcription was performed at 60 °C using random
primers and Thermoscript reverse transcriptase. PCR was done to
amplify the resultant cDNAs using the GeneRacer 5⬘-primer and Dab1specific primer 6 in exon 3 or Dab1-specific primer 7 in exon 1B1.
Nested PCR was done using the GeneRacer 5⬘-nested primer and Dabspecific primer 8 in exon 2, primer 9 in exon 1B1, primer 10 in exon 1A,
5804
The Dab1 Gene
and primer 11 in exon 1D. Products were cloned into pCRII and
sequenced.
Genomics—PACs containing parts of the human and mouse Dab1
genes were obtained by PCR screening of the RZPD Deutsches Ressourcenzentrum fuer Genomforschung libraries 711 (RPCI21; constructed
by Dr. Pieter de Jong, Roswell Park Cancer Institute) and 709 (RPCI6).
Human PACs were isolated as follows: PACs RPCI6-239D12 and
RPCI6-225E22 with primers 12 and 13; PAC RPCI6-65F20 with primers 14 and 15; and PAC RPCI6-102O10 with primers 16 and 1. Mouse
PACs RPCI21-97L11 and RPCI21-31E11 were isolated with primers 17
and 18. Intron sizes were determined by PCR on genomic or PAC DNA.
Amplification of large fragments was carried out with the Elongase
amplification system (Invitrogen). The sequences of the exon-intron
junctions and of upstream genomic regions were determined by direct
sequencing of PAC DNA or of PCR products. Exon-intron boundaries
were determined by aligning cDNA and genomic sequences. Results
were confirmed by comparison with the human and mouse genome
sequences (human contig, NCBI accession number NT_029223.8 (build
30); and mouse contig, NCBI accession number NW_000211.1).
Reporter Plasmid Constructs—Fragments were cloned into the
pGL3-Basic promoterless vector (Promega). A 2.9-kb mouse fragment
named ACD (containing exons 1A–1D) was amplified from genomic
DNA by PCR using primers 19 and 17. The PCR product was cloned into
pCRII and cloned in the forward and reverse orientations into the SacI
site of pGL3-Basic. Fragment AD (821 bp) was amplified using primers
20 and 21, cloned into pCRII, and cloned (SpeI-XbaI) in the forward and
reverse orientations into the NheI site of pGL3-Basic. Construct A (248
bp) was derived from construct AD by MluI digestion and ligation. To
obtain construct D (574 bp), fragment AD in pCRII was digested with
KpnI and MluI and cloned into the corresponding sites of pGL3-Basic
for the forward construct and digested with HindIII and MluI and
cloned into the corresponding sites for the reverse construct. Fragment
C (1641 bp) was amplified from genomic DNA using primers 22 and 17,
cloned into pCRII, and cloned in the forward and reverse orientations
into the SacI site of pGL3-Basic. Fragment B (1.3 kb) was amplified
with primers 23 and 24, cloned into pCRII, and cloned into the KpnIXhoI site of pGL3-Basic. A PmlI-EcoRV digestion/ligation of this construct was carried out to remove three ATG codons present in the
5⬘-UTR.
Cell Culture and Transient Transfections—Undifferentiated P19,
HepG2, and HEK293 cells were grown in Dulbecco’s modified Eagle’s
medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine
serum and 100 units/ml penicillin and streptomycin. Confluent cells
(80 –90%) were plated into 24-well tissue culture plates 24 h prior to
transfection. Recombinant pGL3-Basic reporter constructs (950 ng/
well) containing the firefly luciferase gene and a pRL-TK vector containing the Renilla luciferase reporter (50 ng/well; to normalize for
transfection efficacy) were introduced into cells using LipofectAMINE
2000 (Invitrogen) at 1 ␮l/well according to the manufacturer’s recommendations. After 24 h, the cells were harvested, and luciferase activities were determined using the Dual-Luciferase Reporter assay system
(Promega). Data are expressed as means ⫾ S.E. of at least three
independent measurements.
Culture and Transfection of Primary Neuronal Cultures and P19
Cells—Primary neuronal cultures were prepared from embryonic brain
hemispheres of 15-day mouse fetuses of the BALB/c strain. The cortex
was dissected on ice in 2 ml of phosphate-buffered saline. Tissue fragments (1 mm3) were added to 5 ml of phosphate-buffered saline containing 0.25% trypsin and incubated for 15 min at 37 °C with occasional
shaking. Trypsin digestion was terminated by three washes in Neurobasal medium (Invitrogen) and suspension in Neurobasal medium supplemented with 0.4 mg/ml soybean trypsin inhibitor (Invitrogen) and
0.25 mg/ml DNase I. Cells were dissociated by gentle pipetting, filtered
through Falcon cell strainer sieves (70 ␮m), and counted. Following a
final centrifugation, cells were seeded in poly-L-lysine-coated 12-well
tissue culture plates at a density of 8 ⫻ 105 cells/well in Neurobasal
medium containing 2% B27 supplement (Invitrogen), 500 ␮M glutamine, and penicillin/streptomycin.
P19 embryonic carcinoma cells were cultivated at a density of 1 ⫻ 106
cells/10 ml of medium in non-adhesive 10-cm diameter dishes in DMEM
with 5% fetal bovine serum and all-trans-retinoic acid (RA) (Sigma R
2625) at a final concentration of 5 ⫻ 10⫺7 M. After 2 days, the medium
was replaced, and fresh RA was added. At day 4, aggregates were
harvested, washed once in DMEM without serum, and suspended in 2
ml of 0.25% trypsin/EDTA and DNase I (50 ␮g/ml). Cells were collected
by centrifugation and suspended in 5 ml of DMEM and 10% fetal bovine
serum. They were triturated to yield a single cell suspension and
counted. Dissociated cells were plated at a density of 6 ⫻ 105 cells in 1
ml of DMEM and 10% fetal bovine serum in 12-well poly-L-lysine-coated
plates. The day following plating, arabinosylcytosine (Sigma C 1768)
was added at a final concentration of 5 ␮g/ml. Both primary cortical
neurons and P19 cells were transfected on day 4 after plating. 1 day
prior to transfection, one-half of the medium was replaced. For transfection, 4 ␮g of LipofectAMINE 2000 (Invitrogen)/well in 50 ␮l of OptiMEM (Invitrogen) was mixed with 1 ␮g of DNA in 50 ␮l of Opti-MEM
and incubated for 20 min at room temperature prior to addition to cells
in 400 ␮l of culture medium. Following 5 h of incubation at 37 °C, the
supernatant was removed and replaced with 1 ml of medium. Assay for
luciferase activity was done 24 h after transfection.
In Situ Hybridization and Northern Blotting—The probe for exon 1A
(130 bp) was amplified with primers 25 and 26. The probe for exon 1B
was amplified by RT-PCR from E15 mouse brain using primers 27 and
28 and cloned into pBluescript. This 713-bp fragment contains four
exons of 5⬘-UTR 1B (see Fig. 1): 1B1, 1B2, 1B4, and 1B8. The probe for
exon 1D (343 bp) was amplified with primers 29 and 30. The probe for
alternative exon 555* was a 189-bp fragment amplified with primers 31
and 32 and cloned into pCRII. It contains both exons 555* plus 27 bp of
exon 9 and 47 bp of exon 10. A 480-bp probe covering most of the PTB
region was amplified with primers 16 and 33 and cloned into pCRII. In
situ hybridization was carried out as explained in the legend to Fig. 5.
The probe for the mouse Dab1 3⬘-UTR was a 2-kb fragment amplified
with primers 34 and 35.
RESULTS
The published physical map of the mouse Dab1 gene contains inconsistencies (8, 9). We therefore reconsidered the
physical map and genomic organizations of the human and
mouse Dab1 genes as summarized in Fig. 1 and Table II.
Physical Maps—The mouse Dab1 gene maps to chromosome
4 at 52.7 centimorgans, whereas human DAB1 maps to chromosome 1p32-p31 (24). In both species, the 5⬘-end is located on
the centromeric side. The gene is flanked by the mouse
AK008020 locus (identical to human XM_055482 or LOC115209)
on the centromeric side and by the complement factor 8B (C8B)
gene on the telomeric side. As shown in Fig. 1A, Dab1 is located
between microsatellites D4Mit118 and D4Mit75, but is at least 3
Mbp away from marker D4Mit176, confirming the data published
by Ware et al. (9). D4Mit331 is located between Dab1 exons 1B1
and 1B2 (described below), 565 kb upstream of the Dab1 ATG
codon and 700 kb centromeric to D4Mit29, in agreement with the
reported genetic distance of 0.6 centimorgans between D4Mit29
and D4Mit331 (9). D4Mit29 is located in intron 4, 1.5 kb from exon
4 of Dab1 (Fig. 1B). D4Mit75 maps 440 kb distal to the ATG codon
and 300 kb telomeric to D4Mit29.
In scrambler mutant mice, a portion of an intracisternal A
particle (IAP) sequence is inserted in the antisense orientation
in the Dab1 mRNA by aberrant splicing. The mutation results
in production of an enlarged transcript of ⬃7 kb, with the
introduction of multiple stop codons. The defect results from
the use of a cryptic splice acceptor site in intron 4 coupled with
a cryptic donor site in the IAP element. In the scrambler
mRNA, 28 bases unrelated to Dab1 or to the IAP are inserted
between Dab1 exon 4 and the IAP sequence. BLAST alignment
against the mouse genome localized these 28 bases in intron 4,
11 kb distal to exon 4. No IAP sequence is present in this region
in the C57BL/6 DNA. Although we cannot exclude that the IAP
element was present in the DC/le strain in which the scrambler
mutation arose, it appears more likely that an IAP insertion
caused the mutation. In yotari mutant mice, 357 nucleotides
corresponding to exons 5– 8 are missing from the Dab1 mRNA,
and the open reading frame is maintained. At the genomic
level, this deletion in the mRNA is due to the insertion of a
962-bp L1 element. This insertion starts at the junction of exon
5-intron 5 and ends in the middle of exon 8 (25).
Genomic Organization—The mouse genomic organization
was derived from direct sequencing on PACs and sequencing
of PCR products derived from YACs and genomic DNA. Data
from the NCBI mouse genome sequence (accession number
The Dab1 Gene
5805
FIG. 1. Organization of the human and mouse Dab1 genes. A, the human and mouse Dab1 genes map in a large block of cosynteny between
human chromosome 1 (HSA1) and mouse chromosome 4 (MMU4). The human DAB1 gene maps to 1p32-p31 at 57.39 Mbp from the centromere,
and the mouse Dab1 gene maps to chromosome 4 at 102.19 Mbp from the centromere (left, Ensembl program). In both species (right), Dab1 is
flanked by C8B and hypothetical XM_055482 gene (similar to mouse AK008020); the centromere is represented by a filled oval. D4MitNN
microsatellites previously used to clone the mouse Dab1 gene (9) are represented. LEPR, leptin receptor; JUN, jun oncogene; AK2, adenylate
kinase-2 pseudogene; TACST2, tumor-associated calcium signal transducer-2; C8A and C8B, complement factor 8A and 8B genes, respectively;
Ak3, adenylate kinase-3. B, shown is an overview of the mouse Dab1 gene (the human gene is similar). Dab1 is shaded in gray, and neighboring
genes in are black; Dab1 exons are represented by vertical lines. The 5⬘-UTR is not to scale. PAC and YAC clones used to define the exon-intron
organization are schematized by horizontal lines (solid lines for human clones and dashed lines for mouse clones). IAP is the locus of insertion of
an IAP retrotransposon in scrambler mutant mice. C, shown are the exons and introns of the human and mouse Dab1 genes. The organization and
sequence of coding exons 2–15 are highly conserved in human and mouse. The complex human and mouse 5⬘-UTRs are schematized separately.
Conserved 5⬘-UTR sequences in human and mouse are shown as gray boxes. Note the complexity of UTR 1B. Tyrosine residues important for DAB1
function are indicated.
NW_000211.1) confirmed the structure of the gene. The human
genomic organization was defined by direct sequencing on PAC
clones and confirmed by the NCBI human genome sequence
(accession number NT_029223.8). As explained below, several
alternative first exons named A–F were identified in both the
mouse and human genes and are dispersed over large genomic
regions. Genomic YAC clones covering the mouse Dab1 region
were described previously (9) and are shown in Fig. 1B. YAC
37G4 (500 – 800 kb) contains exons 2–15, and YAC 175A2
(1220 –1500 kb) extends from the complex 5⬘-UTR 1B to exon 9.
Mouse PACs RPCI21-97L11 and RPCI21-31E11 contain upstream exons 1A–1D and 1B8. The sequence-tagged site content of PACS and YACs was not analyzed in detail. However,
the fact that the mouse and human genomic organization is
similar suggests that the clones were not rearranged.
The entire human DAB1 ORF (Fig. 1B) is contained in four
PAC clones covering ⬃300 kb of genomic DNA. Clone RPCI6102O10 (132 kb; accession number AL390243) contains 120 kb of
intron 1, exon 2, and 15 kb of intron 2; clone RPCI6-65F20 (107
kb; accession number AL138779) contains exons 3– 6; clone
RPCI6-239D12 (175 kb; accession number AL161740) contains
exons 10 –15 and the C8B gene; and clone RPCI6-225E22 (not
sequenced) contains exon 5 up to at least exon 15. The human
PACs have been characterized by the Sanger Center using fluo-
rescent in situ hybridization and sequence determination and are
not chimeric.
The Dab1 coding regions (from exon 2 containing the ATG
codon to exon 14 containing the stop codon) are spread over 254
kb of genomic DNA for the mouse gene and over 294 kb for the
human gene. The size of the major DAB1 protein is 555 amino
acids, which corresponds to a coding capacity of 0.2% compared
with a mean genomic coding density of ⬃10%. The organization
of the mouse and human genes is conserved, and all exonintron splice junctions conform to the GT/AG rule (Fig. 1C and
Table II). With the exception of exons 12 and 15 (549 and
⬎3300 bp, respectively), exons are relatively small, ranging in
size from 39 to 140 bp. Introns in the ORF region range in size
from 89 bp to 146 kb. The PTB domain is encoded in exons 3– 6.
Important tyrosine residues are encoded in exons 6 (Tyr185), 7
(Tyr198), 8 (Tyr200 and Tyr220), and 9 (Tyr232) (4, 21).
The 3⬘-end of the mouse Dab1 mRNA was determined using
3⬘-RACE. Using a primer in exon 15, we found a Dab1 3⬘untranslated segment that extends 1252 bp downstream from
the stop codon. This sequence contains several putative polyadenylation signals and aligns with several ESTs. Another set
of ESTs align with genomic sequences 1 kb farther downstream
(Fig. 2A). RT-PCR with primer 34 defined in this downstream
EST set and other primers in exons 14 and 15 showed that the
5806
The Dab1 Gene
TABLE II
Nucleotide sequences of exon-intron boundaries of the human and mouse Dab1 genes
The upper part concerns the 5⬘-UTRs for the mouse (Mm) and human (Hs) genes. The methods of validation were RACE, RT-PCR, and/or
GenBank™/EBI Data Bank entries as indicated. The ATG column indicates the number of ATG codons present in each 5⬘-UTR exon. The lower part
indicates the exon-intron organization of the conserved part, with human and mouse in the top and bottom lines, respectively. RLM, RNA
ligase-mediated.
The Dab1 Gene
5807
FIG. 2. Mouse Dab1 3ⴕ-UTR. A, shown
is a schematic representation of the
mouse Dab1 3⬘-UTR region. Exon 14 contains the stop codon and part of the 3⬘UTR. Exon 15 is 3.3 kb in length and
contains the rest of the 3⬘-UTR. The end
of the published Dab1 cDNA and fragment obtained by RACE are represented.
Potential AATAAA polyadenylation signals are also indicated. A cluster of ESTs
was found 1 kb farther downstream. For
Northern blot analysis, a 2-kb probe was
amplified with primers 34 and 35. B, 2 ␮g
of P0 mouse brain poly(A) RNA was hybridized to randomly primed 32P-labeled
probe as illustrated in A. This probe revealed a single band of 5.5 kb, whereas
probes corresponding to the Dab1 PTB
coding region revealed a band of similar
size plus two additional bands of 4 and 1.3
kb (see Fig. 4).
3⬘-UTR extends at least until another polyadenylation signal
located 3325 bp from the stop codon. To verify that the Dab1
3⬘-UTR is ⬎3 kb long, we performed Northern blot analysis of
mouse brain mRNA using a 2-kb probe corresponding to this
3⬘-sequence (Fig. 2B). This probe revealed a single band of 5.5
kb, whereas probes corresponding to the Dab1 PTB coding
region revealed a band of similar size plus two additional bands
of lower size (see Fig. 4). In human, four EST clones (accession
numbers AA541650, AI799728, R52905, and R67274) contain a
polyadenylation signal (followed by a poly(A) tail) localized
3344 bp downstream from the DAB1 stop codon.
Alternative First Exons and Organization of the 5⬘-Region—
Comparison of the different Dab1 sequences revealed extensive
variation in the 5⬘-regions. In mouse, the Dab1 cDNA sequence
initially described (accession number Y08379) (23) contains
263 nucleotides of 5⬘-UTR encoded by exon 1A and 136 bp of
5⬘-UTR encoded by exon 2, which contains the ATG codon. The
macaque AB05528 and human AK095513 DAB1 cDNAs contain
another 5⬘-UTR (1B) of 497 and 532 bp, respectively. The human
AF263547 DAB1 cDNA contains a different 5⬘-UTR region of 629
bp, and the human XM_010707 cDNA sequence contains yet
another different first exon of 508 bp.
As these data suggest the presence of alternative first exons,
we performed 5⬘-RACE and RNA ligase-mediated RACE on
embryonic human and mouse brain RNAs. Using embryonic
mouse brain RNA, four different products named 1A–1D were
obtained (Fig. 1C and Table II). Mouse fragment 1A corresponds to Dab1 exon 1 in sequence Y083379 (23) and is found
in 10 mouse and two rat ESTs. RACE product 1B is similar to
human DAB1 cDNA sequences AF263547, AB05528, and
AK095513 and is present in three mouse ESTs and one human
EST. In mouse, RT-PCR and RACE experiments with primers
specific for this product 1B revealed that it does not correspond
to a single exon, but is composed of combinations of 10 different
exons, 1B1–1B10 (Fig. 1C). Exon 1C does not correspond to any
published sequence, but could be amplified by RT-PCR, whereas
exon 1D is novel and is present in one mouse and one rat EST
sequence; it is conserved in human and mouse and was amplified
from human brain RNA by RT-PCR. Attempts to map the transcription initiation sites by primer extension were unsuccessful,
possibly because of high GC content and secondary structures of
the alternative first exons. Using repeated RNA ligase-mediated
RACE reactions on poly(A) RNA from E17 mouse brain, we were
unable to extend the Dab1 UTR sequences farther and therefore
considered them close to full-length. All the sequences obtained
by RNA ligase-mediated RACE were also obtained using classical
RACE reactions, and all RACE products were shown to be connected to Dab1 by RT-PCR.
RACE reactions on human brain RNA yielded four different
products. One is similar to mouse exon 1A, with no match in
human EST data bases. A second RACE product is similar to
the highly complex mouse fragment 1B and is present in human cDNA clones AF263547, AB055282, and AK095513.
RACE and RT-PCR experiments revealed that 5⬘-UTR 1B is
composed of combinations of a least seven different exons. We
were not able to clone the 5⬘-end of the reconstituted RNA
sequence XM_010707 using RACE or to connect it to DAB1
exon 2 using RT-PCR on embryonic human brain RNA. Exon E
is not present in EST data bases, but can be connected to DAB1
exon 2 by RT-PCR. Exon F is similar to bases 608 –701 of
sequence XM_060465, the rest of which is unrelated to DAB1.
Among the novel 5⬘-UTRs, three are conserved between human and mouse (Fig. 1C), viz. exons 1A (90% identity), 1B
(mouse 1B1/human 1B1, 65% identity; mouse 1B2/human 1B4,
67% identity; and mouse 1B4/human 1B7, 79% identity), and
1D (55% identity). The sequences are present in EST data
bases and have been isolated as cDNA by others, thus confirming their expression.
Genomic Organization of the 5⬘-Region—The Dab1 5⬘-UTR
spreads over 850 kb in mouse and 961 kb in human (Fig. 1, B
and C). Whereas exons 1A, 1C, and 1D in mouse and exons 1A
and 1D–1F in human are clustered in a 1.5-kb fragment, the
complex 5⬘-UTR 1B has a highly unusual structure. It is composed of 10 exons (1B1–1B10) in mouse and seven exons (1B1–
1B7) in human, with sizes ranging from 63 to ⬎675 nucleotides,
separated by introns with sizes between a few hundred nucleotides and ⬎300 kb. The sequence of UTR 1B is dispersed over
⬎800 kb of genomic DNA, which is consistent with physical
mapping data. YAC 175A2, which is 1500 kb in length, contains
the region between exon 1B8 and coding exon 9, but does not
contain exons 1B1 and 1B2 (Fig. 1C). Exons 1B1–1B10 are
flanked with consensus splice sites and obey the GT/AG rule.
Both in mouse and man, the alternative exons that compose
UTR 1B contain numerous ATG codons and upstream ORFs
(uORFs) (Table II). For example, exon 1B1 contains one uORF
of 87 codons in human and of 101 codons in mouse, and the first
55 encoded amino acids are highly conserved. uORFs are common in certain genes that are involved in the control of cellular
growth and differentiation. This may have implications for the
control of DAB1 mRNA translation, as many examples have
been described in which ORFs present in the 5⬘-UTR influence
expression levels (26, 27).
5808
The Dab1 Gene
FIG. 3. Expression of alternative 5ⴕUTRs. A, schematic representation of 5⬘UTR exons (boxes) and primers used in
RT-PCR, with orientation indicated by arrows. All reactions were carried out using
30 cycles of PCR and 25 ng of cDNA. UTRs
1A, 1B, 1C, and 1D are shaded differently.
Exons 2–5 are coding exons. Note the complexity of UTR 1B, also shown in C–E. B,
RT-PCR analysis of UTR 1A, 1B, and 1D
expression during mouse brain development from E11 to adult. The following
primer combinations were used: for exon
1A, primers 33 and 22 (amplicon of 666 bp);
for UTR 1B, primers 33 and 37 (amplicons
of 974 and 1085 bp corresponding to exons
1B1, 1B2, and 1B4 and exons 1B1, 1B2,
1B4, and 1B8, respectively); and for exon
1D, primers 33 and 38 (amplicon of 663 bp).
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was used as a reference gene.
C, RT-PCR analysis of exons 1A, 1B, and
1D during P19 cell differentiation induced
by RA from days 0 to 9 and in control P0
brain. The following primer combinations
were used: for exon 1A, primers 2 and 22
(375-bp product); for exon 1D, primers 38
and 2 (351 bp); and for UTR 1B, primers
39 and 2 (450 and 560 bp, respectively,
and several larger products). Hypoxanthine-guanine phosphoribosyltransferase
(HPRT) was used as a reference gene. D,
illustration of the complexity of UTR 1B
using RT-PCR (primers 39 and 2). Shown
is a comparison of undifferentiated (⫺RA)
versus differentiated (⫹RA) P19 cells and
of developing (E11) versus mature (adult
(Ad)) mouse brain. Note the simplification
of the UTR 1B amplification pattern in
parallel to neural maturation. E, organization of UTR 1B. PCR products in C and
D were cloned and sequenced (exon terminology as described for Fig. 1C). RTPCR on non-neural tissues showed the
inclusion of numerous alternative exons
of UTR 1B.
FIG. 4. Expression of alternative 5ⴕ-UTR 1A. Poly(A)⫹ RNA (2 ␮g)
from P0 mouse brain was analyzed by Northern blotting using 32Plabeled probes. Transcripts of three different sizes (⬃5.5, 4, and 1.3 kb,
indicated by arrowheads) were detected with a probe for the PTB
domain (left). Three bands of similar sizes plus a band of 1.8 kb were
detected with a probe for exon 1A (right).
Expression of Alternative First Exons—To assess whether
the different 5⬘-exons have different expression patterns, PCRs
were carried out on mouse brain cDNA at different stages from
E11 to E18 and at postnatal stages from P0 to adult. We used
forward primers in the alternative first exons and reverse
primers in exons 2 and 5 (Fig. 3A). As shown in Fig. 3B, exons
1A and 1D were expressed in all stages tested. Amplification of
exon 1C was weak, indicating low level expression in the tissues examined (data not shown). The complex UTR 1B was
barely detectable at E11 and E12, whereas two main bands
were amplified in RNA isolated from brain at E15 and later,
including adult (Fig. 3B). We tested the expression of the alternative first exons in P19 cells, which differentiate into neurons in the presence of RA (Fig. 3C). Exons 1A and 1D were
detected in undifferentiated and differentiated P19 cells. In
contrast, the expression of UTR 1B was complex. Multiple
bands were amplified in undifferentiated cells and up to 4 days
after RA induction. When neural induction was complete, only
two bands were visible. This developmental regulation was
confirmed in vivo. As shown in Fig. 3 (C and D), a pattern of
multiple bands amplified from E11 mouse RNA becomes restricted to two main amplicons at P0 and adult. Sequencing of
the two main amplicons showed that they are formed of fragments 1B1, 1B2, and 1B4, with alternative inclusion of fragment 1B8. Interestingly, the sequences of fragments 1B1, 1B2,
and 1B4 are conserved in mouse, man, and macaque. Sequenc-
The Dab1 Gene
5809
FIG. 5. Expression of Dab1 isoforms: in situ hybridization. 33P-Labeled riboprobes were hybridized to cryostat sagittal sections of E14 (A, B, D, E,
and G, and H) and P0 (C, F, and I) mouse
brain, and the signal was revealed by dipping in LM1 emulsion (Amersham Biosciences) as described (40, 41). The three
following probes were used. The PTB
probe (A–C) covers most of the Dab1 PTB
coding region and is expected to reveal all
Dab1 isoforms. Probe 1B (D–F) corresponds to exons 1B1, 1B2, 1B4, and 1B8
(see Fig. 1) and revealed expression of
alternative 5⬘-exon 1B. Probe 555* (G–I)
covers alternative exons 555* plus some
flanking cDNA sequences. The PTB probe
(A–C) confirmed very strong expression in
the cortical plate at E14 and P0. At P0,
the signal was stronger in the outer than
in the inner tiers of the cortical plate (CP).
There was also moderate expression in
the ventricular zone (VZ), which was
more evident at E14 than at P0. The
probe covering exons 1B (D–F) revealed
an expression similar to that obtained
with the PTB probe, with maximal expression in the cortical plate and weak
expression in the ventricular zone. Probe
555* (G–I) revealed a pattern different
from that obtained with the PTB probe.
The signal was the strongest in the ventricular zone, particularly at early stages
(E14), and decreased at P0. This probe
also revealed a signal in the cortical plate,
but part of this signal may be related to
the parts of the probe that correspond to
Dab1 cDNA sequences adjacent to exons
555*. V, ventricle. Bars ⫽ 100 ␮m.
ing of the other amplicons confirmed that they correspond to
different combinations of exons 1B1–1B10, as shown in Fig. 3E.
These fragments contain variable numbers of ATG codons,
suggesting that some uORFs are excluded from segment 1B in
parallel to neuronal differentiation (Fig. 3E and Table II). The
ability of uORFs to down-regulate translation is documented in
mammals, as mentioned above (26, 27). Although the brain is
the major site of Dab1 expression, low mRNA levels are also
detected in the kidney, liver, and uterus (23). By RT-PCR,
exons 1A and 1D were amplified from the brain, testis, kidney,
and liver, but not from the spleen, heart, or thymus. By contrast, the mature forms of exon 1B were solely amplified from
brain cDNA, confirming its neuron-specific expression in the
adult.
Northern blot analysis was performed using probes corresponding to the different alternative first exons and a probe
covering the PTB domain-encoding region as a control. With
the PTB domain probe, three bands of ⬃5.5, 4, and 1.3 kb were
revealed in poly(A) RNAs from E17 and P0 brain and correspond to the pattern described previously (23, 9). Satisfactory
results were achieved with the exon 1A probe, which revealed
three bands with similar sizes and an additional band of ⬃1.8
kb (Fig. 4). No signal could be detected with a probe for exon
1D. A probe for UTR 1B revealed a major 5.5-kb band and
several smaller and fainter bands, all of which are absent in
RNA extracted from scrambler mouse brain (data not shown).
No clear correspondence between the bands revealed on Northern blots and the alternative forms of the Dab1 RNA could be
established.
We analyzed the expression of the different 5⬘-first exons by
in situ hybridization with 33P-labeled riboprobes. The short
sequence of the exons and their high GC content (⬃75% for
exons 1A and 1D) made it difficult to obtain a signal, and
satisfactory results could be obtained only with the complex
UTR 1B. As shown in Fig. 5 (D–F), the UTR 1B expression
pattern at E14 and in the newborn (P0) brain was very similar
to that observed with the PTB probe (A–C), with the exception
that the ventricular zone appeared to be very weakly labeled at
both stages. Both signals were also similar in other parts of the
brain. This suggests that 5⬘-UTR 1B and the form containing
exon 1A are the two major Dab1 forms in the brain. This was
confirmed using multiplex RT-PCR on adult brain RNA reactions, which yielded approximate proportions of messages containing exons 1A, 1B, and 1D in the brain of 47, 33, and 20%,
respectively.
Mouse Dab1 Promoter Activity in Neurons and Cell Lines—
The presence of multiple 5⬘-exons suggests that the transcription of Dab1 is regulated by different promoters. Promoter
activity was assessed by transient transfection of HEK293 and
HepG2 cells, which do not express Dab1, as well as undiffer-
5810
The Dab1 Gene
FIG. 6. Promoter activities of sequences upstream of exons 1A, 1C,
and 1D in mouse. A, shown is a schematic representation of the genomic region with the constructs used to test promoter activity in the luciferase reporter
system. B, reporter activity was tested in
P19 cells, primary neuronal cultures, and
HepG2 and HEK293 cells. The promoter
activity is expressed relative to that of the
promoterless control plasmid pGL3-Basic. ⫹ and ⫺ refer to constructs tested in
the forward and reverse orientations. Values correspond to the means ⫾ S.D. of at
least three experiments.
entiated P19 embryonic carcinoma cells and embryonic mouse
primary neuronal cultures, which express Dab1 (Fig. 6) (23). A
150-bp fragment upstream of exon 1A (construct A⫹ in Fig. 6A)
was active in all cells tested (25-fold in neurons, 8-fold in P19,
12-fold in HEK293, and 7-fold in HepG2). A comparable or
higher activity was observed when this sequence was cloned in
the reverse orientation (construct A in Fig. 6B), suggesting that
this region may function as a bidirectional promoter, at least in
vitro. This may be related to its high GC content (75% in mouse
with 32 CpG dinucleotides and 80% in human with 38 CpG
dinucleotides), with three SP1-binding sites conserved between
mouse and human coupled with the absence of TATA and
CAAT sequences. Construct C⫹, containing the region upstream of exon 1C, showed weak promoter activity in all cell
lines tested. This segment has a lower GC content of ⬃56%.
The promoter prediction programs Promoter Inspector,
TSSW, and TSSG detected a promoter, a degenerate TATA
box, and a transcription initiation site in this region. Construct D⫹, corresponding to the 500-bp region upstream of
exon 1D, was 6-fold more active than the promoterless vector
in HEK293 cells and neurons and 3-fold more active in
HepG2 and P19 cells. This region had no promoter activity
when cloned in the reverse orientation. The programs also
predicted a promoter and a degenerate TATA box in this
segment. Construct AD⫹, which contains both regions upstream of exons 1A and 1D, showed promoter activity comparable to that of fragment A⫹. Construct ACD⫹, which
contains exons 1A, 1C, and 1D, showed promoter activity
comparable to that of fragment C⫹. There was no activity of
this segment when cloned in the reverse orientation. Two
constructs were used to assay the promoter activity of regions
upstream of exon 1B1 (data not shown). A 1.3-kb construct
that includes 350 nucleotides of exon 1B1 and three ATG
codons was inactive in primary cortical neurons. To avoid
possible interference of the ATG codons with translation of
the luciferase reporter, another construct was derived by
deleting these ATG triplets. However, no promoter activity
was detected in primary cortical neurons, indicating that the
promoter of form 1B may be located farther upstream in the
260-kb genomic interval between exon 1B1 and the
AK008020 gene.
Internal Alternative Splicing Events—Using PCR on human
brain cDNA and alignment of genomic and EST sequences, we
were unable to identify exons corresponding to mouse Dab1
forms 217 and 271 in human. Using RT-PCR, the presence of
fragment 555* was confirmed in mouse and man. In both
species, this sequence corresponds to two exons of 51 and 48 bp
separated by an intron of 91 bp in mouse and of 89 bp in human
(Fig. 7A). Both exons were consistently co-amplified. Interestingly, an alternatively spliced product of 57 bp was detected in
the corresponding location in the Dab1 cDNA in lizard and
chick (Fig. 7B). As shown in Fig. 7C, the peptide sequences
encoded by the two small exons that form fragment 555* in
mouse and man and by the single 57-nucleotide exon in lizard
and chick are conserved, suggesting a duplication event during
evolution. Upon Northern blotting using a probe that includes
exons 555* and some adjacent sequences, a major RNA species
of ⬃5.5 kb, presumably corresponding to the longest form of the
Dab1 mRNA, was detected in poly(A) RNA from E17 mouse
brain (data not shown). In undifferentiated P19 cells, the Dab1
cDNA did include fragment 555*. However, when differentiation of P19 cells was induced with RA, a proportion of Dab1
cDNA without fragment 555* appeared at day 2 and increased
progressively to become the major form at day 9 (Fig. 7D). In
early embryonic mouse brain (E11 and E12), the Dab1 isoform
with fragment 555* was predominant, but RNAs from later
developmental stages (E12 and later) and from primary neuronal cultures did not contain this fragment (Fig. 7B). In nonneural tissues such as liver and kidney, the Dab1 mRNA contained fragments 555* (data not shown). A similar pattern was
The Dab1 Gene
5811
FIG. 7. Alternative exons 555* are excluded from neurons. A, shown is the genomic localization of alternative exons 555* in the mouse Dab1
gene. Form 555* is composed of two exons of 51 (555*1) and 48 (555*2) bp, located between alternative exon 271 and exon 10. Boxes indicate exons,
and horizontal lines indicate introns. Primers are represented by arrows. B, using primers 31 and 36, two products of 746 and 644 bp were obtained,
respectively, with and without exons 555*. Alternative exon 271 was never included in the amplified fragments. Exons 555* were expressed during
early mouse brain development, but not in P0 brain or primary cortical neuronal cultures. An alternative exon was also included in RT-PCR
products amplified from chick (early stage E6 and eye, but not E20) or lizard RNA using the same primers. C, in human (Homo sapiens (Hs)) and
mouse (Mus musculus (Mm)), form 555* is composed of two exons, 555*1 and 555*2. In chick and lizard, this alternative form is composed of one
small exon. The amino acid sequences coded by these exons are well conserved, and this suggests a possible duplication in mammals. D, shown is
the alternative splicing of exons 555* during P19 cell differentiation induced by RA from days 0 to 9. cDNAs prepared from undifferentiated and
differentiated P19 cells and control P0 mouse brain RNA were amplified using primers 31 and 36. During neuronal maturation, the larger product
of 746 bp containing exon 555* was progressively replaced with a product of 644 bp lacking exon 555*.
found in chick, with inclusion of the small 57-nucleotide exon in
RNA from E6 or adult eye, but exclusion of that exon from
brain RNA at E20 (Fig. 7B).
Using in situ hybridization with a cDNA probe covering
fragments 555* and adjacent segments (Figs. 5 (G–I) and 7A),
a strong signal was detected in ventricular zones of precursor
proliferation; the moderate labeling of post-migratory fields
could be related to the parts of the probe adjacent to exons 555*
(Fig. 5, G–I). The predominance of the exon 555*-related signal
in ventricular zones was also noted in other parts of the brain.
Altogether, these observations suggest that the exclusion of
exons 555* parallels neural differentiation.
DISCUSSION
Both in man and mouse, the Dab1 gene reveals an unusual
complexity that leaves ample room for subtle regulation of its
expression and function. Examples of such highly complex
genomic organization are few and include the metabotropic glutamate receptor GRM8 gene, which spans ⬎800 kb of genomic
DNA for a coding length of 2.3 kb (28), and the human neurotrophin receptor genes NTRK2 and NTRK3 (29), which extend over
⬎350 and 380 kb for coding lengths of 3.7 and 2.8 kb, respectively. Intriguingly, the Dab1 paralogous gene Dab2 (named
DAB2 or DOC2 in human) is much simpler than Dab1, with an
ORF extending over ⬍50 kb of genomic sequence compared with
300 kb for Dab1 (30, 31). Apparently, this situation is not unusual. For example, the NTRK1 gene, closely related to NTRK2
and NTRK3, spreads over only 20 kb (29). A similar feature is
found in the two mouse paralogous phospholipase D genes Pld1
and Pld2. Whereas Pld1 contains 28 exons and spans ⬃147 kb,
the whole Pld2 gene is contained in 17 kb of genomic DNA (32).
From an evolutionary standpoint, it would be interesting to know
whether such huge differences in the genomic complexity of
paralogous genes result from extension or contraction of the set of
introns in one of the genes after duplication. Like most Drosophila genes, the fly Disabled gene has small introns and extends
over 12 kb of genomic DNA (33), suggesting that the large size of
Dab1 might result from intron extension.
Our results also reveal a remarkable diversity in the 5⬘-UTR
of both the human and mouse Dab1 genes. We have identified
six alternative 5⬘-UTRs in human and four in mouse, three of
which are conserved. Fragments with promoter activity were
defined for two of them, but we were unable to clone the
promoter for 5⬘-UTR 1B. This 5⬘-UTR is unusually complex and
spreads over 1 Mbp of genomic DNA. It is composed of seven
exons in human and 10 exons in mouse, with three exons
conserved between both species and always included together
in the mRNA. This results in a 5⬘-UTR of 1 kb or more (with the
inclusion of alternative exons), which is much larger than the
average size of 210 bp (34, 35). In situ hybridization using a
probe specific for UTR 1B and RT-PCRs clearly showed that it
is part of the Dab1 mRNA. The long 5⬘-UTR of Dab1 contains
small uORFs and numerous upstream ATG codons that precede the major translation initiation site, some of which are
conserved between human and mouse. The ability of uORFs to
down-regulate translation of mRNA in mammals is well documented. For example, in mice, this phenomenon is implicated
in the 50-fold increase in the concentration of the cyclin-dependent kinase inhibitor p18INK4c during differentiation of
skeletal muscle cells. In proliferating myoblasts, this gene is
abundantly transcribed, but not detectably translated, because
the mRNA carries a 1115-nucleotide-long 5⬘-UTR with five
upstream ATG codons. During differentiation, a downstream
promoter produces a second form of mRNA with a much shorter
5⬘-UTR that efficiently supports translation (36). It would be
interesting to test whether mutations in the long 5⬘-UTR of
Dab1 affect the expression of the major ORF, resulting in
5812
The Dab1 Gene
altered regulation of gene expression in vivo.
Large gene size and complexity may be important for the
production and processing of the transcripts. Based on a transcription rate of ⬃1.4 kb/min (37) and data on the dystrophin
gene (38), transcription of Dab1 would require at least 13 h.
This is close to or larger than the estimated division time of
neuronal precursors (39), suggesting that the promoter associated with form 1B could not be utilized in proliferating cells. In
summary, our data show that Dab1 is far more complex than
expected and that further work is needed to understand better
the control of Dab1 expression and the molecular machinery by
which it exerts its powerful activity. The detailed genomic
structure reported here should facilitate the study of human
DAB1 mutations, which are predicted to yield abnormal brain
phenotypes similar to those related to Reelin deficiency.
REFERENCES
1. Gupta, A., Tsai, L. H., and Wynshaw-Boris, A. (2002) Nat. Rev. Genet. 3,
342–355
2. Monuki, E. S., and Walsh, C. A. (2001) Nat. Neurosci. 4, (suppl.) 1199 –1206
3. Lambert de Rouvroit, C., and Goffinet, A. M. (2001) Mech. Dev. 105, 47–56
4. Howell, B. W., Herrick, T. M., Hildebrand, J. D., Zhang, Y., and Cooper, J. A.
(2000) Curr. Biol. 10, 877– 885
5. Rice, D. S., and Curran, T. (2001) Annu. Rev. Neurosci. 24, 1005–1039
6. Feng, Y., and Walsh, C. A. (2001) Nat. Rev. Neurosci. 2, 408 – 416
7. Howell, B. W., Hawkes, R., Soriano, P., and Cooper, J. A. (1997) Nature 389,
733–737
8. Sheldon, M., Rice, D. S., D’Arcangelo, G., Yoneshima, H., Nakajima, K.,
Mikoshiba, K., Howell, B. W., Cooper, J. A., Goldowitz, D., and Curran, T.
(1997) Nature 389, 730 –733
9. Ware, M. L., Fox, J. W., Gonzalez, J. L., Davis, N. M., Lambert de Rouvroit, C.,
Russo, C. J., Chua, S. C., Jr., Goffinet, A. M., and Walsh, C. A. (1997)
Neuron 19, 239 –249
10. Lambert de Rouvroit, C., and Goffinet, A. M. (1998) Adv. Anat. Embryol. Cell
Biol. 150, 1–106
11. Hong, S. E., Shugart, Y. Y., Huang, D. T., Shahwan, S. A., Grant, P. E.,
Hourihane, J. O., Martin, N. D., and Walsh, C. A. (2000) Nat. Genet. 26,
93–96
12. Rice, D. S., and Curran, T. (2000) J. Comp. Neurol. 424, 327–338
13. Carroll, P., Gayet, O., Feuillet, C., Kallenbach, S., de Bovis, B., Dudley, K., and
Alonso, S. (2001) Mol. Cell. Neurosci. 17, 611– 623
14. Yip, J. W., Yip, Y. P., Nakajima, K., and Capriotti, C. (2000) Proc. Natl. Acad.
Sci. U. S. A. 97, 8612– 8616
15. D’Arcangelo, G., Homayouni, R., Keshvara, L., Rice, D. S., Sheldon, M., and
Curran, T. (1999) Neuron 24, 471– 479
16. Trommsdorff, M., Gotthardt, M., Hiesberger, T., Shelton, J., Stockinger, W.,
Nimpf, J., Hammer, R. E., Richardson, J. A., and Herz, J. (1999) Cell 97,
689 –701
17. Hiesberger, T., Trommsdorff, M., Howell, B. W., Goffinet, A., Mumby, M. C.,
Cooper, J. A., and Herz, J. (1999) Neuron 24, 481– 489
18. Gotthardt, M., Trommsdorff, M., Nevitt, M. F., Shelton, J., Richardson, J. A.,
Stockinger, W., Nimpf, J., and Herz, J. (2000) J. Biol. Chem. 275,
25616 –25624
19. Howell, B. W., Lanier, L. M., Frank, R., Gertler, F. B., and Cooper, J. A. (1999)
Mol. Cell. Biol. 19, 5179 –5188
20. Howell, B. W., Herrick, T. M., and Cooper, J. A. (1999) Genes Dev. 13, 643– 648
21. Keshvara, L., Benhayon, D., Magdaleno, S., and Curran, T. (2001) J. Biol.
Chem. 276, 16008 –16014
22. Herrick, T. M., and Cooper, J. A. (2002) Development 129, 787–796
23. Howell, B. W., Gertler, F. B., and Cooper, J. A. (1997) EMBO J. 16, 121–132
24. Lambert de Rouvroit, C., and Goffinet, A. M. (1998) Genomics 53, 246 –247
25. Kojima, T., Nakajima, K., and Mikoshiba, K. (2000) Brain Res. Mol. Brain Res.
75, 121–127
26. van der Velden, A. W., and Thomas, A. A. (1999) Int. J. Biochem. Cell Biol. 31,
87–106
27. Morris, D. R., and Geballe, A. P. (2000) Mol. Cell. Biol. 20, 8635– 8642
28. Scherer, S. W., Soder, S., Duvoisin, R. M., Huizenga, J. J., and Tsui, L. C.
(1997) Genomics 44, 232–236
29. Valent, A., Danglot, G., and Bernheim, A. (1997) Eur. J. Hum. Genet. 5,
102–104
30. Sheng, Z., He, J., Tuppen, J. A., Sun, W., Fazili, Z., Smith, E. R., Dong, F. B.,
and Xu, X. X. (2000) Genomics 70, 381–386
31. Sheng, Z., He, J., Tuppen, J. A., Martin, W. D., Dong, F. B., and Xu, X. X. (2001)
Gene 268, 31–39
32. Redina, O. E., and Frohman, M. A. (1998) Gene 222, 53– 60
33. Gertler, F. B., Hill, K. K., Clark, M. J., and Hoffmann, F. M. (1993) Genes Dev.
7, 441– 453
34. Pesole, G., Liuni, S., Grillo, G., Licciulli, F., Mignone, F., Gissi, C., and
Saccone, C. (2002) Nucleic Acids Res. 30, 335–340
35. Mignone, F., Gissi, C., Liuni, S., and Pesole, G. (2002) Genome Biol. 3, S0004
36. Phelps, D. E., Hsiao, K. M., Li, Y., Hu, N., Franklin, D. S., Westphal, E., Lee,
E. Y., and Xiong, Y. (1998) Mol. Cell. Biol. 18, 2334 –2343
37. Shermoen, A. W., and O’Farrell, P. H. (1991) Cell 67, 303–310
38. Tennyson, C. N., Klamut, H. J., and Worton, R. G. (1995) Nat. Genet. 9,
184 –190
39. Takahashi, T., Nowakowski, R. S., and Caviness, V. S., Jr. (1995) J. Neurosci.
15, 6046 – 6057
40. Bernier, B., Bar, I., Pieau, C., Lambert de Rouvroit, C., and Goffinet, A. M.
(1999) J. Comp. Neurol. 413, 463– 479
41. Simmons, D., Arriza, J. L., and Swanson, L. W. (1989) J. Histotechnol. 12,
169 –181