* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Biology DNA: The Genetic Material
Survey
Document related concepts
Zinc finger nuclease wikipedia , lookup
DNA sequencing wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA replication wikipedia , lookup
Transcript
Name ____________________________________________________________ Period ______ Biology DNA: The Genetic Material Date Assignment Chapter 9 Vocabulary Chapter 9 Notes Chapter 9 Questions Directed Reading 9-2 DNA Structure Skills Worksheet Biology Homework: DNA/Concept Map Directed Reading 9-3 Active Reading 9-3 Points Earned Possible Points 13 Chapter 9 DNA: The Genetic Material Vocabulary Use the glossary and don’t shorten the definition. If a page number is listed, use that page to define the term. Section 1: Identifying the Genetic Material 1. vaccine 2. virulent – 3. transformation – 4. bacteriophage – Section 2: The Structure of DNA 5. double helix – 6. nucleotide – 7. deoxyribose – 8. base-pairing rules – 9. complementary base pair – Section 3: The Replication of DNA 10. DNA replication – 11. DNA helicase – 12. replication fork – 13. DNA polymerase – PowerPoint Notes on Chapter 9 - DNA: The Genetic Material Section 1 Identifying the Genetic Material Objectives Relate Griffith’s conclusions to the observations he made during the transformation experiments. Summarize the steps involved in Avery’s transformation experiments, and state the results. Evaluate the results of the Hershey and Chase experiment. Transformation : Griffith’s Experiments In 1928, ______________________________, a bacteriologist, was trying to prepare a ____________________ against pneumonia. A vaccine is a substance that is prepared from _______________ or _______________ disease causing agents, including certain bacteria. The vaccine is introduced into the body to _________________ the _______________ against future infections by the disease-causing agent. Griffith discovered that ___________________ bacteria could turn virulent when mixed with bacteria that cause disease. A bacteria that is virulent is _____________________________________. Griffith had discovered what is now called _______________________, a change in genotype caused when cells take up foreign genetic material. Griffith’s Discovery of Transformation Transformation: Avery’s Experiments In 1944, a series of experiments showed: o The activity of the material responsible for transformation is not affected by _______________-destroying enzymes. o HOWEVER, the activity IS stopped by a ________ -destroying enzyme. Thus, almost 100 years after Mendel’s experiments, Oswald Avery and his co-workers demonstrated that __________ is the material responsible for transformation. Viral Genes and DNA: DNA’s Role Revealed In 1952, Alfred Hershey and Martha Chase used the bacteriophage T2 to prove that ___________ carried genetic material. A ___________________, also referred to as a phage, is a _______________ that infects bacteria. When phages infect bacterial cells, the phages are able to ______________________________, which are released when the bacterial cells rupture. Hershey and Chase carried out the following experiment: o Step 1 T2 phages were labeled with _______________________. o Step 2 The phages infect E. coli bacterial cells. o Step 3 Bacterial cells were spun to remove the virus's ____________ coats. Hershey and Chase concluded that the _________ of viruses is injected into the bacterial cells, while most of the _______ __________________ remain outside. The injected DNA molecules cause the bacterial cells to produce more ________ _________ and proteins. This meant that the DNA, rather than proteins, __________________________ _________________, at least in viruses. Section 2 The Structure of DNA Objectives Describe the three components of a nucleotide. Develop a model of the structure of a DNA molecule. Evaluate the contributions of Chargaff, Franklin, and Wilkins in helping Watson and Crick determine the double-helical structure of DNA. Relate the role of the base-pairing rules to the structure of DNA. A Winding Staircase Watson and Crick determined that a DNA molecule is a ____________________ — two strands twisted around each other, like a winding staircase. _______________________ are the subunits that make up DNA. Each nucleotide is made of three parts: a phosphate group, a five-carbon sugar molecule, and a nitrogencontaining base. The five-carbon sugar in DNA nucleotides is called ____________________________. The nitrogen base in a nucleotide can be either a bulky, _________________________, or a smaller, _______________________________. Structure of a Nucleotide Discovering DNA’s Structure: Chargaff’s Observations In 1949, Erwin Chargaff observed that for each organism he studied, the amount of _______________ always equaled the amount of ________________ (A=T). Likewise, the amount of ______________ always equaled the amount of ____________ (G=C). However, the amount of adenine and thymine and of guanine and cytosine __________ between different organisms. Wilkins and Franklin’s Photographs By analyzing the complex patterns on _______________________________ photo, scientists can determine the structure of the molecule. In 1952, Maurice Wilkins and Rosalind Franklin developed high-quality _________ diffraction photographs of strands of _____. These photographs suggested that the DNA molecule resembled a tightly coiled ____________ and was composed of two or three chains of ______________________. Watson and Crick’s DNA Model In 1953, Watson and Crick built a model of DNA with the configuration of a __________ ________________, a “spiral staircase” of two strands of nucleotides twisting around a central axis. The double-helical model of DNA takes into account __________________ observations and the __________________ on Franklin’s X-ray diffraction photographs. Pairing Between Bases An _________________ on one strand always pairs with a ______________ on the opposite strand, and a _______________ on one strand always pairs with a _________ on the opposite strand. These _________-_____________________________ are supported by Chargaff’s observations. The strictness of base-pairing results in two strands that contain ___________________ ________________________________. The diagram of DNA below the helix makes it easier to visualize the base-pairing that occurs between DNA strands. *3 Things that determine how DNA base pairs bond: 1. ________________________ 2. ________________________ 3. ________________________ Section 3 The Replication of DNA Objectives Summarize the process of DNA replication. Describe how errors are corrected during DNA replication. Compare the number of replication forks in prokaryotic and eukaryotic DNA. Roles of Enzymes in DNA Replication The complementary structure of DNA is used as a basis to ______________________ _________________________________________________ The process of making a copy of DNA is called _________________________. DNA replication occurs during the ____________________ phase of the cell cycle, before a cell divides. DNA replication occurs in three steps: o Step 1 ________________________________opens the double helix by breaking the _____________ bonds that link the complementary nitrogen bases between the two strands. The areas where the double helix separates are called _______________________________. o Step 2 At the replication fork, enzymes known as ___________________________ move along each of the DNA strands. DNA polymerases add __________________ to the exposed nitrogen bases, according to the ________________________ rules. o Step 3 Two ________ molecules form that are _________________ to the original DNA molecule. Checking for Errors In the course of DNA replication, _________________________ sometimes occur and the wrong ___________________________ is added to the new strand. An important feature of DNA _______________________ is that DNA polymerases have a “____________________________” role. This proofreading reduces errors in DNA replication to about _______________ error per 1 billion nucleotides. The Rate of Replication Replication does NOT begin at one end of the DNA molecule and end at the other. The ____________________ DNA molecules found in ________________________ usually have two replication forks that begin at a single point. The replication forks move away from each other until they meet on the opposite side of the DNA circle. In ________________________ cells, each chromosome contains a single, long strand of DNA. Each _______________________ chromosome is replicated in about 100 sections that are 100,000 ___________________________ long, EACH section with its own starting point. With multiple replication forks working in concert, an entire human chromosome can be replicated in about ____________ hours. Replication Forks Increase the Speed of Replication Chapter 9 Section 1 Questions 1. What question did Mendel’s experiments answer? 2. What question did Mendel’s experiment create? 3. What was Frederick Griffith trying to find in his experiments? 4. How does a vaccine work? 5. How were the two types of bacteria different in Griffith’s experiments? Strain #1(S bacteria)Strain #2 (R bacteria)-6. What happened when Griffith injected the mice with S bacteria? 7. What happened when Griffith injected the mice with R bacteria? 8. What happened when Griffith injected the mice with “heated-killed” S bacteria? 9. What happened when Griffith injected the mice with “heated-killed” S bacteria and live R bacteria? 10. How did Griffith explain what happened in his experiment? 11. What did Oswald Avery discover? 12. What did Hershey and Chase conclude from their experiments? Chapter 9 Section 2 Questions 1. What was the importance of discovering DNA’s structure? 2. What is meant by double helix? 3. Who discovered the structure of the DNA molecule? 4. What are the three parts of the nucleotide? a. b. c. 5. What is the five carbon sugar in DNA called? 6. What parts of the DNA nucleotide remains the same? 7. What part changes in DNA nucleotide? 8. What are the four different nitrogen bases in DNA? a. b. c. d. 9. What type of bond holds the two strands of the double helix together? 10. How did Erwin Chargaff contribute to Watson and Crick’s discovery? 11. How did Maurice Wilkins and Rosalind contribute to Watson and Crick’s discovery? 12. What does adenine always pair with? 13. What does guanine always pair with? 14. What does cytosine always pair with? 15. What does thymine always pair with? Chapter 9 Section 3 Questions 1. When does DNA replication occur during the cell cycle? 2. What enzyme opens the DNA’s double helix by breaking the hydrogen bonds? 3. What is the area where the double helix is held apart called? 4. What enzyme adds the new nucleotides to the original DNA strand? 5. What enzyme is responsible for “proof-reading” the new DNA strands? 6. How many replication forks does prokaryotic DNA have? 7. How many replication forks does eukaryotic DNA have? Name Class Date Skills Worksheet Directed Reading Chapter 9 Section 2 Pages 194-197 Section: The Structure of DNA In the space provided, write the letter of the description that best matches the term or phrase. ______ 1. double helix a. a five-carbon sugar ______ 2. nucleotides b. type of bond that holds the double helix together ______ 3. deoxyribose ______ 4. DNA c. one of three parts of a nucleotide made of one or two rings of carbon and nitrogen atoms ______ 5. hydrogen bond d. subunits that make up DNA ______ 6. nitrogen base e. one of two pyrimidines used as a nitrogen base in nucleotides ______ 7. adenine f. one of two purines used as a nitrogen base in nucleotides ______ 8. cytosine g. abbreviation for deoxyribonucleic acid h. two strands of nucleotides twisted around each other In the space provided, explain how the terms in each pair are related to each other. 9. base-pairing rules, complementary 10. adenine, thymine 11. cytosine, guanine Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 3 DNA: The Genetic Material Name Class Date Directed Reading continued Read each question, and write your answer in the space provided. 12. What was Chargaff’s observation about the nitrogen bases in DNA? 13. What role did the photographs of Wilkins and Franklin play in the discovery of the structure of DNA? 14. What did Watson and Crick deduce about the structure of DNA? Complete the Section Review questions on page 197, #1-6. Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 4 DNA: The Genetic Material Name Class Date Skills Worksheet DNA Structure INTERPRETING DIAGRAMS Use the figure below to answer questions 1–3. A B C D E Read each question, and write your answer in the space provided. 1. In the space provided, identify the structures labeled A–E. A. _________________________________________________________________ B. ____________________________________________________________________ C. ____________________________________________________________________ D. ____________________________________________________________________ E. ____________________________________________________________________ 2. What do the lines connecting the two strands represent? Why are there three lines connecting the strands in some instances and only two lines in others? 3. Suppose that a strand of DNA has the base sequence ATT-CCG. What is the base sequence of the complementary strand? Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Science: Biology 17 Science Skills Worksheets Name ________________________________________________ Score ______ Period ______ Biology Homework: DNA 1. Draw a nucleotide and label its three basic parts. 2. Which parts make up the sides of the ladders? Which parts make up the rungs of the ladder? To which part do the rungs of the ladder attach on the sides? 3. What 2 parts do all nucleotides have in common? 4. What part of a nucleotide makes them different? 5. What is the base pair rule? Who discovered this idea? 6. What did Franklin and Wilkins’ x-ray diffraction photograph of strands of DNA suggest about the structure of the DNA molecule? 7. Using Chargaff’s data and the x-ray diffraction photograph of DNA, who built the first model of DNA and describe its structure? 8. What 3 things determine which nitrogen bases pair with which? 9. Which of the 4 nitrogen bases are purines? Which of the 4 nitrogen bases are pyrimidines? 10. Use the base pair rule to complete the missing side of DNA. Pretend the list of nitrogen bases is an entire nucleotide. Match up the correct missing side of this DNA molecule. GGCTCCCTTTGCGCAAAATGCTATCGCCGGAAATTGTCA Name Class Date Skills Worksheet Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs DNA polymerases double helix five-carbon sugar Franklin and Wilkins nitrogen base phosphate group purine pyrimidine replication Watson and Crick Discovery of DNA structure includes research by Chargaff 1. who showed who showed who showed 3. 2. X-ray photos of DNA 4. which can be a which undergoes which is composed of 7. nucleotides 5. 6. which involves made of a such as 8. 9. 10. 11. Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 17 DNA: The Genetic Material Name Class Date Skills Worksheet Directed Reading Chapter 9 Section 3 Pages 198-200 Section: The Replication of DNA In the space provided, write the letter of the description that best matches the term or phrase. ______ 1. DNA replication ______ 2. DNA helicases ______ 3. replication forks ______ 4. DNA polymerases ______ 5. synthesis a. add nucleotides to the exposed nitrogen bases according to the base-pairing rules b. process of making a copy of DNA c. the two areas that result when the double helix separates during DNA replication d. open up the double helix by breaking the hydrogen bonds between nitrogen bases e. phase during the life cycle of a cell during which DNA replication occurs Read each question, and write your answer in the space provided. 6. How did the complementary relationship between the sequences of nucleotides lead to the discovery of DNA replication? 7. What prevents the separated DNA strands from reattaching to one another during DNA replication? 8. What prevents the wrong nucleotide from being added to the new strand during DNA replication? Complete each statement by writing the correct term or phrase in the space provided. 9. Prokaryotic DNA is reproduced with forks. replication Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 5 DNA: The Genetic Material Name Class Date Directed Reading continued 10. Each human chromosome is replicated in about sections. 11. The number of nucleotides between each replication fork in human DNA is approximately . Complete Section Review questions on page 200, # 1-5 below. Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 6 DNA: The Genetic Material Name Class Date Skills Worksheet Active Reading Chapter 9 Section 3 Pages 198-200 Section: The Replication of DNA Read the passage below. Then answer the questions that follow. The process of making a copy of DNA is called DNA replication. It occurs during the synthesis (S) phase of the cell cycle, before a cell divides. The process can be broken down into three steps. Step 1: Before replication can begin, the double helix must unwind. This is accomplished by enzymes called DNA helicases, which open up the double helix by breaking the hydrogen bonds that link the complimentary nitrogen bases. Once the two strands of DNA are separated, additional enzymes and other proteins attach to each strand, holding them apart and preventing them from twisting back into their double-helical shape. The two areas on either end of the DNA where the double helix separates are called replication forks because of their Y shape. Step 2: At the replication fork, enzymes known as DNA polymerases move along each of the DNA strands, adding nucleotides to the exposed nitrogen bases according to the base-pairing rules. As the DNA polymerases move along, two new double helixes are formed. Step 3: Once a DNA polymerase has begun adding nucleotides to a growing double helix, the enzyme remains attached until all of the DNA has been copied and it is signaled to detach. This process produces two DNA molecules, each composed of a new and an original strand. The nucleotide sequences in both of these DNA molecules are identical to each other and to the original DNA molecule. SKILL: READING EFFECTIVELY Read each question, and write your answer in the space provided. 1. What is replication? 2. When does replication occur? Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 11 DNA: The Genetic Material Name Class Date Active Reading continued 3. What must occur before replication can begin? SKILL: INTERPRETING GRAPHICS 4. The figure below shows DNA replicating. In the space provided, describe what is occurring at each lettered section of the figure. Part a. Part b. Part c. Part a. _________________________________________________________________ Part b. _________________________________________________________________ Part c. _________________________________________________________________ In the space provided, write the letter of the term or phrase that best completes the statement. ______ 5. DNA helicases and DNA polymerases are alike in that both are types of a. nucleotides. b. nitrogen bases. c. enzymes. d. Both (a) and (b) Copyright © by Holt, Rinehart and Winston. All rights reserved. Holt Biology 12 DNA: The Genetic Material