Download Biology DNA: The Genetic Material

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Telomere wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

DNA sequencing wikipedia , lookup

DNA repair protein XRCC4 wikipedia , lookup

Helicase wikipedia , lookup

Homologous recombination wikipedia , lookup

Eukaryotic DNA replication wikipedia , lookup

DNA repair wikipedia , lookup

DNA profiling wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Microsatellite wikipedia , lookup

DNA polymerase wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA replication wikipedia , lookup

Helitron (biology) wikipedia , lookup

Replisome wikipedia , lookup

Transcript
Name ____________________________________________________________ Period ______
Biology
DNA: The Genetic Material
Date Assignment
Chapter 9 Vocabulary
Chapter 9 Notes
Chapter 9 Questions
Directed Reading 9-2
DNA Structure Skills
Worksheet
Biology Homework:
DNA/Concept Map
Directed Reading 9-3
Active Reading 9-3
Points Earned Possible Points
13
Chapter 9 DNA: The Genetic Material
Vocabulary
Use the glossary and don’t shorten the definition. If a page number is listed, use that page to
define the term.
Section 1: Identifying the Genetic Material
1. vaccine 2. virulent –
3. transformation –
4. bacteriophage –
Section 2: The Structure of DNA
5. double helix –
6. nucleotide –
7. deoxyribose –
8. base-pairing rules –
9. complementary base pair –
Section 3: The Replication of DNA
10. DNA replication –
11. DNA helicase –
12. replication fork –
13. DNA polymerase –
PowerPoint Notes on Chapter 9 - DNA: The Genetic Material
Section 1 Identifying the Genetic Material
Objectives
Relate Griffith’s conclusions to the observations he made during the transformation
experiments.
Summarize the steps involved in Avery’s transformation experiments, and state the
results.
Evaluate the results of the Hershey and Chase experiment.
Transformation : Griffith’s Experiments
In 1928, ______________________________, a bacteriologist, was trying to prepare a
____________________ against pneumonia.
A vaccine is a substance that is prepared from _______________ or _______________
disease causing agents, including certain bacteria.
The vaccine is introduced into the body to _________________ the _______________
against future infections by the disease-causing agent.
Griffith discovered that ___________________ bacteria could turn virulent when mixed
with bacteria that cause disease.
A bacteria that is virulent is _____________________________________.
Griffith had discovered what is now called _______________________, a change in
genotype caused when cells take up foreign genetic material.
Griffith’s Discovery of
Transformation
Transformation: Avery’s Experiments
In 1944, a series of experiments showed:
o
The activity of the material responsible for transformation is not affected by
_______________-destroying enzymes.
o
HOWEVER, the activity IS stopped by a ________ -destroying enzyme.
Thus, almost 100 years after Mendel’s experiments, Oswald Avery and his co-workers
demonstrated that __________ is the material responsible for transformation.
Viral Genes and DNA: DNA’s Role Revealed
In 1952, Alfred Hershey and Martha Chase used the
bacteriophage T2 to prove that ___________ carried
genetic material.
A ___________________, also referred to as a phage, is
a _______________ that infects bacteria.
When phages infect bacterial cells, the phages are able
to ______________________________, which are
released when the bacterial cells rupture.
Hershey and Chase carried out the following
experiment:
o
Step 1 T2 phages were labeled
with _______________________.
o
Step 2 The phages infect E. coli
bacterial cells.
o
Step 3 Bacterial cells were spun to
remove the virus's ____________
coats.
Hershey and Chase concluded that the
_________ of viruses is injected into the
bacterial cells, while most of the _______
__________________ remain outside.
The injected DNA molecules cause the
bacterial cells to produce more ________
_________ and proteins.
This meant that the DNA, rather than
proteins, __________________________
_________________, at least in viruses.
Section 2 The Structure of DNA
Objectives
Describe the three components of a nucleotide.
Develop a model of the structure of a DNA molecule.
Evaluate the contributions of Chargaff, Franklin, and Wilkins in helping Watson and Crick
determine the double-helical structure of DNA.
Relate the role of the base-pairing rules to the structure of DNA.
A Winding Staircase
Watson and Crick determined that a DNA molecule is a ____________________ — two
strands twisted around each other, like a winding staircase.
_______________________ are the subunits that make up DNA. Each nucleotide is
made of three parts: a phosphate group, a five-carbon sugar molecule, and a nitrogencontaining base.
The five-carbon sugar in DNA nucleotides is called ____________________________.
The nitrogen base in a nucleotide can be either a bulky, _________________________,
or a smaller, _______________________________.
Structure of a Nucleotide
Discovering DNA’s Structure:
Chargaff’s Observations
In 1949, Erwin Chargaff observed that for each organism he studied, the amount of
_______________ always equaled the amount of ________________ (A=T).
Likewise, the amount of ______________ always equaled the amount of ____________
(G=C).
However, the amount of adenine and thymine and of guanine and cytosine __________
between different organisms.
Wilkins and Franklin’s Photographs
By analyzing the complex patterns on
_______________________________
photo, scientists can determine the
structure of the molecule.
In 1952, Maurice Wilkins and Rosalind
Franklin developed high-quality _________
diffraction photographs of strands of _____.
These photographs suggested that the DNA
molecule resembled a tightly coiled ____________ and was composed of two or three
chains of ______________________.
Watson and Crick’s DNA Model
In 1953, Watson and Crick built a model of DNA with the configuration of a __________
________________, a “spiral staircase” of two strands of nucleotides twisting around a
central axis.
The double-helical model of DNA takes into account __________________ observations
and the __________________ on Franklin’s X-ray diffraction photographs.
Pairing Between Bases
An _________________ on one strand always pairs with a ______________ on the
opposite strand, and a _______________ on one strand always pairs with a _________
on the opposite strand.
These _________-_____________________________ are supported by Chargaff’s
observations.
The strictness of base-pairing results in two strands that contain ___________________
________________________________.
The diagram of DNA below the helix makes it easier to visualize the base-pairing that
occurs between DNA strands.
*3 Things that determine how DNA base pairs
bond:
1. ________________________
2. ________________________
3. ________________________
Section 3 The Replication of DNA
Objectives
Summarize the process of DNA replication.
Describe how errors are corrected during DNA replication.
Compare the number of replication forks in prokaryotic and eukaryotic DNA.
Roles of Enzymes in DNA Replication
The complementary structure of DNA is used as a basis to ______________________
_________________________________________________
The process of making a copy of DNA is called _________________________.
DNA replication occurs during the ____________________ phase of the cell cycle,
before a cell divides.
DNA replication occurs in three steps:
o
Step 1 ________________________________opens the double helix by breaking
the _____________ bonds that link the complementary nitrogen bases between the
two strands. The areas where the double helix separates are called
_______________________________.
o
Step 2 At the replication fork, enzymes known as ___________________________
move along each of the DNA strands. DNA polymerases add __________________
to the exposed nitrogen bases, according to the ________________________ rules.
o
Step 3 Two ________ molecules form that are _________________ to the original
DNA molecule.
Checking for Errors
In the course of DNA replication, _________________________ sometimes occur and
the wrong ___________________________ is added to the new strand.
An important feature of DNA _______________________ is that DNA polymerases
have a “____________________________” role.
This proofreading reduces errors in DNA replication to about _______________ error
per 1 billion nucleotides.
The Rate of Replication
Replication does NOT begin at one end of the DNA molecule and end at the other.
The ____________________ DNA molecules found in ________________________
usually have two replication forks that begin at a single point.
The replication forks move away from each other until they meet on the opposite side of
the DNA circle.
In ________________________ cells, each chromosome contains a single, long strand
of DNA.
Each _______________________ chromosome is replicated in about 100 sections that
are 100,000 ___________________________ long, EACH section with its own starting
point.
With multiple replication forks working in concert, an entire human chromosome can be
replicated in about ____________ hours.
Replication Forks Increase the Speed of Replication
Chapter 9 Section 1 Questions
1. What question did Mendel’s experiments answer?
2. What question did Mendel’s experiment create?
3. What was Frederick Griffith trying to find in his experiments?
4. How does a vaccine work?
5. How were the two types of bacteria different in Griffith’s experiments?
Strain #1(S bacteria)Strain #2 (R bacteria)-6. What happened when Griffith injected the mice with S bacteria?
7. What happened when Griffith injected the mice with R bacteria?
8. What happened when Griffith injected the mice with “heated-killed” S bacteria?
9. What happened when Griffith injected the mice with “heated-killed” S bacteria
and live R bacteria?
10. How did Griffith explain what happened in his experiment?
11. What did Oswald Avery discover?
12. What did Hershey and Chase conclude from their experiments?
Chapter 9 Section 2 Questions
1. What was the importance of discovering DNA’s structure?
2. What is meant by double helix?
3. Who discovered the structure of the DNA molecule?
4. What are the three parts of the nucleotide?
a.
b.
c.
5. What is the five carbon sugar in DNA called?
6. What parts of the DNA nucleotide remains the same?
7. What part changes in DNA nucleotide?
8. What are the four different nitrogen bases in DNA?
a.
b.
c.
d.
9. What type of bond holds the two strands of the double helix together?
10. How did Erwin Chargaff contribute to Watson and Crick’s discovery?
11. How did Maurice Wilkins and Rosalind contribute to Watson and Crick’s
discovery?
12. What does adenine always pair with?
13. What does guanine always pair with?
14. What does cytosine always pair with?
15. What does thymine always pair with?
Chapter 9 Section 3 Questions
1. When does DNA replication occur during the cell cycle?
2. What enzyme opens the DNA’s double helix by breaking the hydrogen bonds?
3. What is the area where the double helix is held apart called?
4. What enzyme adds the new nucleotides to the original DNA strand?
5. What enzyme is responsible for “proof-reading” the new DNA strands?
6. How many replication forks does prokaryotic DNA have?
7. How many replication forks does eukaryotic DNA have?
Name
Class
Date
Skills Worksheet
Directed Reading
Chapter 9 Section 2 Pages 194-197
Section: The Structure of DNA
In the space provided, write the letter of the description that best matches the
term or phrase.
______ 1. double helix
a. a five-carbon sugar
______ 2. nucleotides
b. type of bond that holds the double
helix together
______ 3. deoxyribose
______ 4. DNA
c. one of three parts of a nucleotide
made of one or two rings of carbon
and nitrogen atoms
______ 5. hydrogen bond
d. subunits that make up DNA
______ 6. nitrogen base
e. one of two pyrimidines used as a
nitrogen base in nucleotides
______ 7. adenine
f. one of two purines used as a
nitrogen base in nucleotides
______ 8. cytosine
g. abbreviation for deoxyribonucleic
acid
h. two strands of nucleotides twisted
around each other
In the space provided, explain how the terms in each pair are related to
each other.
9. base-pairing rules, complementary
10. adenine, thymine
11. cytosine, guanine
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
3
DNA: The Genetic Material
Name
Class
Date
Directed Reading continued
Read each question, and write your answer in the space provided.
12. What was Chargaff’s observation about the nitrogen bases in DNA?
13. What role did the photographs of Wilkins and Franklin play in the discovery
of the structure of DNA?
14. What did Watson and Crick deduce about the structure of DNA?
Complete the Section Review questions on page 197, #1-6.
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
4
DNA: The Genetic Material
Name
Class
Date
Skills Worksheet
DNA Structure
INTERPRETING DIAGRAMS
Use the figure below to answer questions 1–3.
A
B
C
D
E
Read each question, and write your answer in the space provided.
1. In the space provided, identify the structures labeled A–E.
A. _________________________________________________________________
B. ____________________________________________________________________
C. ____________________________________________________________________
D. ____________________________________________________________________
E.
____________________________________________________________________
2. What do the lines connecting the two strands represent? Why are there three
lines connecting the strands in some instances and only two lines in others?
3. Suppose that a strand of DNA has the base sequence ATT-CCG. What is the
base sequence of the complementary strand?
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Science: Biology
17
Science Skills Worksheets
Name ________________________________________________ Score ______ Period ______
Biology Homework: DNA
1. Draw a nucleotide and label its three basic parts.
2. Which parts make up the sides of the ladders?
Which parts make up the rungs of the ladder?
To which part do the rungs of the ladder attach on the sides?
3. What 2 parts do all nucleotides have in common?
4. What part of a nucleotide makes them different?
5. What is the base pair rule? Who discovered this idea?
6. What did Franklin and Wilkins’ x-ray diffraction photograph of strands of DNA suggest about
the structure of the DNA molecule?
7. Using Chargaff’s data and the x-ray diffraction photograph of DNA, who built the first model
of DNA and describe its structure?
8. What 3 things determine which nitrogen bases pair with which?
9. Which of the 4 nitrogen bases are purines?
Which of the 4 nitrogen bases are pyrimidines?
10. Use the base pair rule to complete the missing side of DNA. Pretend the list of nitrogen bases
is an entire nucleotide. Match up the correct missing side of this DNA molecule.
GGCTCCCTTTGCGCAAAATGCTATCGCCGGAAATTGTCA
Name
Class
Date
Skills Worksheet
Concept Mapping
Using the terms and phrases provided below, complete the concept map showing
the discovery of DNA structure.
amount of base pairs
DNA polymerases
double helix
five-carbon sugar
Franklin and Wilkins
nitrogen base
phosphate group
purine
pyrimidine
replication
Watson and Crick
Discovery of
DNA structure
includes research by
Chargaff
1.
who showed
who showed
who showed
3.
2.
X-ray photos
of DNA
4.
which
can be a
which undergoes
which is composed of
7.
nucleotides
5.
6.
which involves
made of a
such as
8.
9.
10.
11.
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
17
DNA: The Genetic Material
Name
Class
Date
Skills Worksheet
Directed Reading
Chapter 9 Section 3 Pages 198-200
Section: The Replication of DNA
In the space provided, write the letter of the description that best matches the
term or phrase.
______ 1. DNA replication
______ 2. DNA helicases
______ 3. replication forks
______ 4. DNA polymerases
______ 5. synthesis
a. add nucleotides to the exposed nitrogen
bases according to the base-pairing rules
b. process of making a copy of DNA
c. the two areas that result when the double
helix separates during DNA replication
d. open up the double helix by breaking the
hydrogen bonds between nitrogen bases
e. phase during the life cycle of a cell during
which DNA replication occurs
Read each question, and write your answer in the space provided.
6. How did the complementary relationship between the sequences of
nucleotides lead to the discovery of DNA replication?
7. What prevents the separated DNA strands from reattaching to one another
during DNA replication?
8. What prevents the wrong nucleotide from being added to the new strand
during DNA replication?
Complete each statement by writing the correct term or phrase in the space
provided.
9. Prokaryotic DNA is reproduced with
forks.
replication
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
5
DNA: The Genetic Material
Name
Class
Date
Directed Reading continued
10. Each human chromosome is replicated in about
sections.
11. The number of nucleotides between each replication fork in human DNA is
approximately
.
Complete Section Review questions on page 200, # 1-5 below.
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
6
DNA: The Genetic Material
Name
Class
Date
Skills Worksheet
Active Reading
Chapter 9 Section 3 Pages 198-200
Section: The Replication of DNA
Read the passage below. Then answer the questions that follow.
The process of making a copy of DNA is called DNA replication.
It occurs during the synthesis (S) phase of the cell cycle, before a
cell divides. The process can be broken down into three steps.
Step 1: Before replication can begin, the double helix must
unwind. This is accomplished by enzymes called DNA helicases,
which open up the double helix by breaking the hydrogen bonds
that link the complimentary nitrogen bases. Once the two strands
of DNA are separated, additional enzymes and other proteins
attach to each strand, holding them apart and preventing them
from twisting back into their double-helical shape. The two areas
on either end of the DNA where the double helix separates are
called replication forks because of their Y shape.
Step 2: At the replication fork, enzymes known as DNA
polymerases move along each of the DNA strands, adding
nucleotides to the exposed nitrogen bases according to the
base-pairing rules. As the DNA polymerases move along, two
new double helixes are formed.
Step 3: Once a DNA polymerase has begun adding nucleotides
to a growing double helix, the enzyme remains attached until
all of the DNA has been copied and it is signaled to detach. This
process produces two DNA molecules, each composed of a new
and an original strand. The nucleotide sequences in both of these
DNA molecules are identical to each other and to the original
DNA molecule.
SKILL: READING EFFECTIVELY
Read each question, and write your answer in the space provided.
1. What is replication?
2. When does replication occur?
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
11
DNA: The Genetic Material
Name
Class
Date
Active Reading continued
3. What must occur before replication can begin?
SKILL: INTERPRETING GRAPHICS
4. The figure below shows DNA replicating. In the space provided, describe
what is occurring at each lettered section of the figure.
Part a.
Part b.
Part c.
Part a. _________________________________________________________________
Part b. _________________________________________________________________
Part c. _________________________________________________________________
In the space provided, write the letter of the term or phrase that best completes
the statement.
______ 5. DNA helicases and DNA polymerases are alike in that both are
types of
a. nucleotides.
b. nitrogen bases.
c. enzymes.
d. Both (a) and (b)
Copyright © by Holt, Rinehart and Winston. All rights reserved.
Holt Biology
12
DNA: The Genetic Material