Download Regulation of Granulocyte-Macrophage Colony

From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Regulation of Granulocyte-Macrophage Colony-Stimulating Factor and
E-Selectin Expression in Endothelial Cells by Cyclosporin A and the
T-cell Transcription Factor NFAT
By Gillian W. Cockerill, Andrew G. Bert, Gregory R. Ryan, Jennifer R. Gamble, Mathew A. Vadas,
and Peter N. Cockerill
Nuclear factor ofactivated T cells (NFAT)was originally describedasaT-cell-specifictranscriptionfactor
that supported the activation of cytokine gene expression and mediated the immunoregulatory effects of cyclosporin A ICsA).
As we observed that activated endothelial cellsalsoexpressed NFAT, we tested the antiinflammatory properties
of CsAin endothelialcells. Significantly,CsA completely suppressedthe induction ofNFAT in endothelialcells and inhibited the activity of granulocyte-macrophage colony-stimulating factor (GM-CSF) gene regulatory elements that use
NFAT by 60%. CsA similarly mediated a reduction of up to
65% in GM-CSF mRNA and protein expression in activated
endothelial cells.CsAalsosuppressedE-selectin,
but not
vascularcelladhesion molecule-l (VCAM-1) expression in
endothelial cells, even thoughthe E-selectin promoter is activated by NF-KB rather than NFAT. Hence, induction of cell
surface expression of this leukocyte adhesion molecule by
tumor necrosis factor ITNF1-a was reduced by 40% in the
presence of CsA, and this was reflected by a 29% decrease
in neutrophil adhesion. The effects ofCsA on endothelial
cells were also detected at the chromatin structure level,as
DNase1 hypersensitivesites within both the GM-CSF enhancer andthe E-selectinpromoter were suppressedby CSA.
This represents the first repot? of NFAT in endothelial cells
and suggests mechanisms by which CsA could function as
an antiinflammatory agent.
0 1995 by The American Societyof Hematology.
T
hematopoietic compartment where immune effector cells
originate and tissues where primary immune responses occur, and endothelial cells play a direct role in governing the
traffic of leukocytes across the e n d o t h e l i ~ m . On
~ ~ .activa~~
tion, endothelial cells produce numerous cytokines, including GM-CSF, which activate immune response effector cells
such as neutrophils, monocytes, basophils, and eosinophils.2,222,25Furthermore, GM-CSF may be one of the mediators of acute and chronic inflammatory conditions such as
rheumatoid arthritis, asthma, and
GM-CSF is
typically induced in endothelial cells by proinflammatory
cytokines such as tumor necrosis factor-a (TNF-a)and IL1 and its expression is regulated at both transcriptional and
posttranscriptional le~els.2~
Agents that activate the protein
kinase C and Ca2+pathways in endothelial cells would also
be expected to induce GM-CSF expression.
In addition to producing cytokines, activated endothelial
cells also express the cell surface adhesion molecules Eselectin, P-selectin, vascular cell adhesion molecule-l
(VCAM- l), and intercellular adhesion molecule-l (ICAMl), which mediate recruitment and transmigration of leukocytes across the e n d ~ t h e l i u m . ’ ~ E-selectin
~ ~ ~ ” ~ (previously
termed ELAM-l) is a cell surface glycoprotein found exclu-
HE REGULATION of cytokine gene expression is cen-
tral to the regulation of the immune response.’,2The
T cell has been the most intensively studied model system
for investigating cytokine gene regulation, as a wide variety
of cytokines are induced on activation of the T-cell receptor.’
The transcription factor nuclear factor of activated T cells
(NFAT)’.3-7plays a key role in the activation of many of these
genes and is itself induced on T-cell receptor activation.
The induction of cytokines such as interleukin-2 (IL-2) and
granulocyte-macrophage colony-stimulating factor (GMCSF) in T cells can be suppressed by cyclosporin A (CsA),
and these effects are largely caused by the ability of CsA to
inhibit activation of NFAT.’,5*6,s,9
Furthermore, the immunosuppressive actions of CsA have been widely attributed to
its ability to suppress T-cell expression of cytokines such as
IL-2, and hence T-cell activation and proliferation.
NFAT, initially thought to be a T-cell specific factor, typically consists of a complex of AP-1 family proteins and
NFATp or NFATc, which are respectively induced via protein kinase C and Ca2+signals originating from T-cell receptor activation.*-” NFATp and NFATc are related proteins4.”
that are expressed in the cytoplasm of T cells and translocate
to the nucleus in response to the Ca2’ activation of the CsAinhibitible phosphatase calcine~rin.~.’~.’~’~
Hence, NFATp
and NFATc are major targets for the actions of CsA in T
cells. The genes for NFATp and NFATc have recently been
c l ~ n e d ~ . ’and
~ , ’ it~ is now believed that NFATc is largely
restricted to lymphoid tissues, while NFATp expression is
more widespread.
NFAT contributes to the activation of the GM-CSF locus
in T cells by interacting with four strong binding sites in an
upstream
and two weak binding sites in the GMCSF
However, GM-CSF is also expressed at
sites of inflammation in many cell types other than T cells.z~22
This raises the possibility that induction of GM-CSF expression in these cell types could also require NFAT. Consequently, the GM-CSF locus may also be a target for CsA in
cells such as activated endothelial cells that express GMCSF.
The endothelial cell represents the interface between the
Blood, Vol 86, No 7 (October l ) , 1995: pp 2689-2698
From the Division of Human Immunology, Hanson Centre For
Cancer Research, lastitute for Medical and Veterinary Science, Adelaide, Australia.
Submitted December 27, 1994; accepted June 2, 1995.
Supported by the National Health and Medical Research Council
of Australia and the Anti-Cancer Foundation of the Universities of
South Australia.
Address reprint requests to Peter N. Cockerill, Division of H m n
Immunology, HansonCentrefor Cancer Research, Institute for Medical and Veterinary Science, PO Box 14, Rundle Mall, Frome Rd,
Adelaide 5000, Australia.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 I995 by The American Society of Hematology.
0ooS-497I/95/8607-0018$3.00/0
2689
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2690
COCKERILL ET AL
sively on endothelial cells that interacts with receptors on a
subset of leukocytes that include neutrophils, eosinophils,
monocytes, and a subset of memory T cells.24E-selectin is
involved in the earliest stages of leukocyte recruitment as it
mediates the initial tethering and rolling of leukocytes across
the end~thelium.'~
Acute and chronic inflammatory conditions are typically
maintained by the activation of both cytokines and adhesion
molecules that function in concert to orchestrate the interactions between numerous participating cell types. Elevated
expression of E-selectin, for example, is associated with inflammatory conditions such as a ~ t h m a , rheumatoid
~'
arthritis,32 and psoriasis.33While CsA is more commonly used
as an immunosuppressive agent to prevent organ transplant
rejection, it has also been found to be effective in the treatment of a variety of chronic inflammatory and autoimmune
disorders such as psoriasis," asthma,27ulcerative ~olitis,'~
and rheumatoid arthriti~.~'While some of the benefits of
these treatments can be attributed to actions against T cells,
there may be additional direct effects on either the activation
or trafficking of cell types such as neutrophils, eosinophils,
and monocytes.
To gain a better understanding of the involvement of the
endothelium in inflammation, we have investigated the regulation of the GM-CSF and E-selectin genes in endothelial
cells. For this purpose we have used passagedhuman umbilical vein endothelial cells (HUVEs) and the recently derived
endothelial cell line C11STH.36We initially cloned Cl lSTH
cells from a spontaneous transformant that arose in a culture
of HUVEs and showed that they have a repertoire of adhesion molecules and TNF-a receptors similar to that found
in normal H U V E S . ~ ~
In this study we found that, as in T cells, the GM-CSF
enhancer was required for efficient activation of the GMCSF promoter in endothelial cells. Interestingly, these effects
appeared to be mediated in part by the transcription factor
NFAT. Furthermore, NFAT and GM-CSF induction in endothelial cells was suppressed by CsA. The induction of Eselectin in endothelial cells and acquired ability to support
neutrophil adhesion were also inhibited by CsA, suggesting
a wider role for this drug in combating inflammation. In the
course of these studies we established that the endothelial
cell line C1 lSTH36is a valuable model system for studying
inflammatory events in the endothelium.
MATERIALS AND METHODS
Reagents. The phorbol ester phorbol 12-myristate 13-acetate
(PMA) was purchased from Sigma (St Louis, MO), the calcium
ionophore A23 187 (I) was purchased from Boehringer (Mannheim,
Germany), forskolin was purchased from Calbiochem (San Diego,
CA), cyclosporin A (CsA) was a gift from Sandoz (Basel, Switzerland), DNase1 was purchased from Worthington (Freehold, NJ), and
TNF-a and interferon-? (IFN-y) were provided by Genetech (San
Francisco, CA). PMA was prepared as a I-mg/mL stock in dimethyl
sulfoxide (DMSO), A23187 as a 20-mmoUL stock in DMSO, forskolin as a IO-mmoVL stock in DMSO, and CsA as a l-mmoVL
stock in ethanol.
Oligonucleotides. Oligonucleotide duplexes used as probes
and competitors had the following sequences, with complementary
single stranded regions at each end shown in lower case for the
upper strand only: GM430, gatcTCACACATCTTTCTCATGGAAAGATGA; IL-2 NFAT, gatcCGAAAGGAGGAAAAACTGI7-l-
CATACAGAAG;X,TCGCCAATGAGCTCCCGGGTCGACTGCAGAAGCTTC; IgK NF-KB, AACAGAGGGGACTTTCCGAGGCCATCT; E-selectin NF-KB, aattCGTTTTTGGATGCCATGGGGATTTCCTCTTTACTGGATGTG. The GM430 sequence is a
highaffinity NFATp/c binding site located in the GM-CSF enhan~er.'.~
Plasmids. The luciferase reporter gene plasmid pGMluc3' had a
655-bp fragment of the human GM-CSF promoter (-627 to +28)
upstream of the luciferase gene. The plasmid pGMEluc has a 716bp BglII fragment of the human GM-CSF enhancer placed upstream
of the GM-CSF promoter in the BglII site of pGMluc.
Cell culture. C1 lSTH cells and HUVEs were cultured as previously described."
Antibodies. The antibody R59 was raised against recombinant
truncated NFATp prepared from pNFATpXS.'' The antibody 67.5
was raised against peptide 72 of purified mouse NFATp." These
antibodies were a gift from A. Rao" and cross-react between human
and mouse NFATp. The oct-l antibody was a gift from R. Stunn
(Centre for Molecular Biology and Biotechnology, Brisbane, Australia),
Gel electrophoretic mobility shift assays. Gel shift assays of
nuclear extracts were essentially as previously described* and used
0.2 ngof "P-labeled probe, 5 pg of nuclear protein, and 2 pg
of poly(d1-dC) in a 15-pL vol. Nuclear extracts were prepared as
previously described' from unstimulated cells and cells stimulated
for 2 to 3 hours with 20 ng/mL PMA and 2 pmol/L A23187 (I) in
the presence and absence of 0.1 pmoVL CsA. CsA was added 10
minutes before the addition of PMA and A23 187. Assays of recombinant proteins differed in that theyused 200 ng poly(d1-dC), 4
mmoVL dithiothreitol and 0.3 mg/rnL bovine serum albumin together
with 0.5 ng NFATp, 10 ng NF-KB p50, or 0.07 pL NF-KB p65.
The NFATp was a 293-amino acid truncated derivative of NFATp
containing the DNA-binding domain and was prepared from the
plasmidpQE-31#1 (a gift from A. Rao), which is derived from
pNFATpXS,'* by expression in Escherichia coli and chromatography on Quiagen Niz+ NTA agarose according to manufacturer's
instructions. NF-KB p50 was purchased from Promega (Madison,
WI), while the NF-KBp65 used here was a gift of purified recombinant truncated protein (amino acids 1-313) supplied by S. Gerondakis
(Walter and Eliza Hall Institute, Melbourne, Australia).zR
GM-CSF enzyme-linked immunosorbent assay. GM-CSF protein
concentrations in cell culture supernatants were determined according to manufacturer's instructions using a human GM-CSF enzyme-linked immunosorbent assay (ELISA) kit supplied by R &
D Systems (Minneapolis, MN). Supernatants were harvested from
cultures containing 2 X IO5 cells seeded in 24-well trays with 400
pL medium. Cultures were initially incubated for 24 hours and then
activated for 16 hours as indicated.
GM-CSF mRNA assays. GM-CSF mRNA levels were assayed
as previously described' after stimulation of cells for 8 hours with
20 ng/mL PMAand 2 pmol/L A23187 (I) in the presence and
absence of 0.1 pnol/L CsA. Briefly,RNAwas prepared by the
guanidine lysis method and assayed by RNase protection assay. Each
hybridization reaction contained probes for both the GM-CSF and
the constitutively expressed glyceraldehyde-3-phosphatedehydrogenase (GAPDH) genes, and the levels of GM-CSF expression were
expressed relative to GAPDH.
DNase I hypersensitive site analysis. DNase I hypersensitive
sites (DH) sites in C1 lSTH cells, HUVEs, Jurkat cells, and peripheral blood T lymphocytes were assayed as described*after stimulating the cells for 4 to 6 hours with 20 ng/mL PMA and 2 pmol/L
A23187 (I) or 100 U/mL TNF-a in the presence and absence of 0.1
pmoVL CsA. Filters were first hybridized with the GM-CSF probe?
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
GM-CSF AND E-SELECTINGENEEXPRESSION
then stripped by washing in 50% formamide at 65"C, before rehybridizing with the E-selectin probe. The E-selectin probe was a 1.7kb BgnYEcoRI fragment normally located 1.3 to 3 kb downstream
of the human E-selectin gene transcription start site, and was a gift
from T. Collins (Brigham and Women's Hospital, Boston, MA). T
lymphocytes were freshly purified from peripheral blood by Ficoll
to remove
centrifugationtoisolatemononuclearcells,elutriation
monocytes, and nylon wool chromatography to remove B cells.
Transfection assays. Luciferase reporter gene activities were determined as previously describedby transfecting 20 pg of each plasmid construct into 1 X lo6 C1 lSTH cells by the diethylaminoethyl
(DEAE) dextran procedure36 and measuring luciferase expression"
after stimulation with 2 pmoK A23 187 (I) and 20 ng/mL PMA for
9 hours in the presence and absence of 0.1 pmoK CsA.
Neutrophiladhesion assays. Neutrophiladhesionassayswere
Briefly, confluent monolayers
performed as previously de~cribed.~~
of CllSTH cellswereincubated with 100 UlmL TNF-a in the
presence or absenceof 1 pmoK CsA.After 4 hours' activation,
"Cr-labeled neutrophils (9 X lo5 cpm)wereaddedandincubated
atroomtemperature(approximately
22T) for 15 minutes.After
severalwashes with medium,neutrophiladherencewasestimated
by measuring bound 5'Cr.
E-selectin and VCAM-I expression. Cellsurfaceexpressionof
E-selectin and VCAM-I on C l ISTH cells was determined by flow
cytometric (FACS) analysis using specific antibodies for E-selectin
and VCAM-l, as previously described.36 Before analysis, cells were
stimulated for 4 hours with different combinations 100 U/mL I F N 7 , 100 UlmL TNF-a, 20 ng/mL PMA, 2 pmovL A23187 (I), and
10 pmom forskolin.
RESULTS
Activated endothelial cells express NFAT. CsA is a potent immunosuppressive drug known to function in T cells
by inhibiting induction of the transcription factor NFAT.
Although there have been no previous reports of NFAT in
endothelial cells, CsA is used as an antiinflammatory agent,
and some of its actions could be mediated by suppression
of factors in the endothelium. Therefore, we have examined
whether NFAT can be induced in endothelial cells by pathways known to activate NFAT in T cells. To this end, we
stimulated C1 lSTH cells and passaged HUVEs with a combination of the phorbol ester PMA and the calcium ionophore
A23187. These signals mimic the phospholipase C driven
activation of protein kinase C and increase in cytosolic Ca2+
and induce the AP-I and NFATpk components of NFAT,
respectively.
We performed gel electrophoretic mobility shift assays of
nuclear extracts prepared from activated HUVEs and
C1 ISTH cells using the GM-CSF enhancer GM430 sequence as a probe for NFATpk binding (lefthand panel in
Fig 1) and the human IL-2 gene distal NFAT site as a probe
for NFAT (righthand panel in Fig 1). The IL-2 site served
as the prototypic NFAT site most commonly used to assay
for the presence of NFAT in T cells as it cooperatively binds
AP- 1 and NFATpIc toform NFAT complexe~.~
The GM430
site is a high-affinity NFATp site that is able to associate
strongly with the NFATp/c component of NFAT independently of AP- 1.9
Significantly, nuclear extracts from HUVEs and C l ISTH
cells both formed inducible NFATpk-like complexes with
the GM430 element and NFAT-like complexes with the IL-
269 1
2 NFAT site that comigrated with Jurkat T-cell complexes
in gel mobility shift assays (Fig 1). ASin T cells, CsA
completely inhibited the induction of these endothelial cell
NFAT and NFATpk-like complexes (Fig 1). Furthermore,
complex formation with both probes was completely inhibited when either the IL-2 or GM430 NFAT elements were
included as DNA competitors, but only partially inhibited
when an unrelated competitor (X) was used.
NFATp appeared to be the major protein contributing to
NFATpk-like complexes with the GM430 probe in C 11STH
and HUVE extracts as antibodies raised against either recombinant NFATp or toan NFATp peptide specifically inhibited
formation of or super-shifted NFATp-like complexes as efficiently as they did withJurkat cell extracts (Fig 2). Addition
of a 5- to 20-fold greater amount of oct-l antiserum had
little effect on NFATp complex formation with the endothelial cell nuclear extracts. As the 67.1 NFATp antibody was
raised against a peptide not conserved in NFATc, there appeared to be little or no NFATc present in either the endothelial cell or the Jurkat cell extracts employed in this study.
NFATp induction in endothelial cells may require a Ca2+
signal not provided by proinflammatory cytokines, as TNFa did not induce NFATp (data not shown). Incontrast, TNFa was a more efficient inducer of NF-KB in endothelial cells
than PMA and A23187 (data not shown).
GM-CSF expression is regulated by CsA in endothelial
cells. If NFATp regulates gene expression in endothelial
cells then GM-CSF gene activation via Ca2+ pathways in
endothelial cells should also be CsA-sensitive. To explore
this possibility, we examined GM-CSF synthesis in four
independent lines of passaged HUVEs. Asin T cells, the
level of GM-CSF secretion by HUVEs was increased 100fold by the combined actions of the phorbol ester PMA and
the calcium ionophore A23 187 (P",
Fig 3). For each of
the four lines of activated HUVEs, there was a decrease in
GM-CSF expression in the presence of 0.1 pmoUL CsA,
with an average reduction of 50%.
As we anticipated that CsA would inhibit GM-CSF at the
transcriptional level, we also performed RNase protection
assays of GM-CSF mRNA in HUVEs and CllSTH cells.
Just as we observed for GM-CSF protein synthesis, GMCSF mRNAwas strongly induced in both HUVEs and
CllSTH cells byPMA and A23187 (Fig 4). GM-CSF
mRNA induction required calcium ionophore as well PMA,
as sixfold less GM-CSF mRNA was detected in the presence
of PMA alone. In the presence of 0.1 pmoVL CsA the induction of GM-CSF mRNA was reduced by 65% in HUVEs
and 56% in C1 lSTH cells (Fig 4).This inhibition appeared
to be specific, as we observed no effect of CsA on K-8
expression in endothelial cells (data not shown). CsA also
appeared to have little effect on induction of GM-CSF expression by pathways that do not use Ca2+.Hence, CsA had
no significant influence on induction of GM-CSF mRNA or
protein expression in endothelial cells activated with TNFa (data not shown).
The GM-CSF enhancer exists asa DNaseI hypersensitive
site in endothelial cells. In T cells, the GM-CSF enhancer
exists as an inducible CsA-sensitive DNaseI hypersensitive
(DH) site that spans at least two NFAT site^.^'^ To identify
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
COCKERILL ET AL
2692
I HUVE
pmbe
GM430 NFATp
c-ll
m
I
pmbeL 2 NFAT
C-l 1 STH
a role for this enhancer in the GM-CSF locus in endothelial
cells, we examined DH sites upstream of the GM-CSF gene.
These analyses were performed both in Cl ISTH cells (Fig
5A) and in passaged HUVEs (Fig 5B).
We located two DH sites that coincided with the proximal
promoter and the previously defined enhancer 3 kb upstream
of the gene. The DH site located within the promoter ap-
c-l1 sm
U
Fig 1. Gel electrophetic mobility shift assays of
NFATp and NFAT in endothelial cellnuclear extracts.
Nuclear extractswere
prepared from passaged
HUVEs, CllSTH cells, and Jurkat cells that were either unstimulated (nil) or stimulated 2for
t o 3 hours
with 20 ng/mL PMA and 2 pmol/L A23187 in the
presence (PMAIIICsA) or absence (PMA/I) of 0.1
pmol/L CsA. Bands migrating below theNFATp and
NFAT complexes appear t o represent nonspecific
constitutive factors. Where indicated, assays of stimulated CllSTH cell nuclear extract binding t o the
GM430 NFATp and IL-2 NFAT probes also include
25 ng duplex oligonucleotides corresponding t o the
GM430 NFATp site, the IL-2 NFAT site, or an unrelated sequence (X) as competitor. Each assay used
5 p g protein, and the asterisk indicates one lane
where a shorter autoradiographic exposure was included t o assist identification of the NFATp complex
in the Jurkat extract.
.d
Jurkat Tcells
-
HUVE
1
+
NFATp
Fig 2. Gel electrophoretic mobility shift
assays of nuclear extracts
binding t o the GM430 NFATp probe in the presence of NFATp antibodies. Assays used 1 p g stimulated Jurkat cellnuclear extract or 5
p g stimulated CllSTH or HUVE nuclear extract. Extracts were assayed either with no added anti-sera (nil) or after preincubation for
20 minutes on ice with 0.2 p L of preimmune serum, 0.2 p L R59
antisera raised against recombinant NFATp, 0.05 p L 67.1 antisera
raised against an NFATp peptide, or 1p L of an antisera raised against
oct-l. The 67.1-antisera produced super-shifted complexes characteristic ofspecific NFATp binding and does not cross-react with NFATc.
peared as a constitutive site in both Cl I STH cells (Fig 5A)
and HUVEs (Fig 5B). Althoughnot detected in Jurkat T
cells, this site also appeared as a DH site in activated T
lymphocytes (Fig 5B). The DH site within the enhancer
appeared as a weak site before activation and was strongly
induced in the presence of the coactivators PMA andA23 I87
in both C1 ISTH cells and HUVEs. The DH site existed as
a broad region 2.8 to 3.0 kb upstream of the GM-CSF gene,
thus resembling the DH site induced in T cells. Significantly,
induction of this DH site was reduced by about 70% in the
presence of 0.1 pmol/L CsA, which had no effect on the
promoter DH site (Fig 5A). We also examined endothelial
cells activated by TNF-a, but observed that this cytokine
was not a significant inducer ofany DH sites within the
GM-CSF locus (data not shown).
The GM-CSF enhancercontributes to GM-CSF activation
in endothelial cells. To determine whether the upstream
enhancer was required for efficient GM-CSF promoter activation in endothelial cells, the enhancer was coupled to the
GM-CSF promoter in a luciferase reporter gene plasmid.
On transfection into C1 ISTH cells and stimulation with the
coactivators PMA and A23187, the enhancer supported a
fivefold greater induction of luciferase gene expression than
was obtained with a luciferase gene driven by the GM-CSF
promoter alone (Fig 6). Furthermore, this induction was suppressed by about 60% in the presence of CsA.
CsA inhibits neutrophil adhesion to activated endothelial
cells. Having found that CsA could suppress cytokine gene
expression, we next examined whether CsA could influence
neutrophil adhesion to activated endothelial cells. Neutrophils become involved at the earliest stages during the progression of inflammation and are also one of the cell types
activated by GM-CSF.
In the presence of TNF-a, we observed an approximately
sixfold increase in the adherence of neutrophils to a confluent
monolayer of C1 ISTH cells (Table l ) . In the presence of
CsA, we observed a 29% decrease (P = .0006) in the TNFa-induced neutrophil adherence.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2693
GM-CSF AND E-SELECTINGENEEXPRESSION
T
NIL
PI
PIC
Fig 3. Suppression of GM-CSF protein synthesisin HUVEs b y CsA.
Levels of GM-CSF secretion by cultured HUVEs were measured by
ELISA. Four independent lines of HUVEs were either not stimulated
(NIL) or stimulated for 16 hours with 20 nglmL PMA and 2 p m o l l L
A23187 in the presence (PIC) or absence(PI) of 0.1 pmol/L CsA.
Shown above are the mean expression levels obtained with the four
lines of HUVEs together with error bars indicating the SEM. There
was a statistically significant meandecrease of 320 pglmL GM-CSF
(SEM = 132, P < .01)in the four lines of HUVEs in the presence of
CsA.
E-selectin expression is suppressed by CsA in endothelial
cells. To determine which leukocyte adhesion molecules
on endothelial cells might be suppressed by CsA, we examined the regulation of E-selectin and VCAM-I expression
in C1 lSTH cells. E-selectin can interact with receptors on
neutrophils, eosinophils, monocytes, and subsets of T cells
and is an important regulator of both acute and chronic inflammation.23.24
VCAM-l plays a major role in the adherence
of monocytes and lymphocytes to endothelial cells.23
We first showed that E-selectin was induced in C1 lSTH
cells in the expected fashion by either TNF-a or a combination of PMA and A23 187 (PMAII) (Fig 7). IFN-y alone was
unable to induce E-selectin expression, but greatly enhanced
its activation by TNF-a. We also observed that the CAMP
inducer forskolin was a potent inhibitor of TNF-a-inducible
E-selectin expression in C l lSTH cells, as previously observed by others in HUVES.’~
On inclusion of increasing amounts of CsA, we observed
up to a 40% decrease in the cell surface expression of Eselectin expression in C l l STH cells activated by either TNFa, TNF-a plus I F N , or PMA and A23 187 (Fig 7). CsA
reduced the expression obtained with PMA and A23187 to
a level equivalent to that obtained with PMA alone. Furthermore, activation of E-selectin expression in the presence of
PMA alone was essentially resistant to the effects of CsA.
Interestingly, CsA also did not suppress the component of
TNF-a-inducible E-selectin expression that was resistant
to forskolin. The effects of CsA on E-selectin expression
appeared to be specific, as CsA had no effect on the induction
of VCAM-l expression by any of the above agents (data not
shown).
A CsA-sensitive DNaseI hyper-sensitivesite exists in the
E-selectin promoter. To search for regulatory elements that
might account for the CsA-sensitivity of E-selectin gene
expression, we screened the E-selectin locus for CsA-sensitive DH sites. For this purpose we reprobed the filter used
in Fig 5 with an intragenic E-selectin probe.
DNaseI digestion of the E-selectin chromosomal locus
produced additional 3.0- and 6.5-kb subfragments of the 9kb EcoRI fragment, indicating that two DH sites existed
upstream of the E-selectin gene in activated endothelial cells
(Fig 8). One DH site near the origin of transcription was
induced by either TNF-a or a combination ofPMA and
A23187 in both Cl ISTH cells (Fig 8A) and HUVEs (Fig
8B) and has also recently been detected byothers:’
The
second DH site, located 3.5kb upstream, appeared as a
constitutive DH site. Significantly, the inducible but not the
constitutive site, was suppressed by CsA (Fig 8A), suggesting that CsA-sensitive transcriptional activation ele-
c11-sTH
HUVE
”
U
U
U”
U”
M
0-
\
Y
4- GM-CSF
4-w
-GAPDH
0.Fig 4. Suppression of GM-CSF mRNA expression in endothelial
cells by CsA. RNA was isolated from HUVEs and CllSTH cells that
were either unstimulated (Nil),stimulated for 8 hours with 20 n g l
mL PMA (PMA), or stimulated for 8 hours with 20 nglmL PMA and
2 pmollL A23187 in the presence (PMAlIICsA) or absence IPMAlI)
of 0.1 pmollL CsA. GM-CSF mRNA levels were assayed by RNase
protection assay, using GAPDH as an internal control.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
COCKERILLET AL
2694
A
B
rj
GM-CSF
PROMOTER
+ ENHANCER
U
\
z a
+ +
z
\
a
111,
n
b
L 3
zE
U
X
l
X
-
E
-
Probe Enhancer GM-CSF
Fig 5. Mapping ofDH sites from an EcoRl site 6.8 kb upstream of
the GM-CSF gene in endothelial cells. Cells were either unstimulated
(Nil) or stimulated for
4 t o 6 hours with 20 nglmL PMA and 2 p m o l l
L A23187 in the presence (PIIlCsA) or absence (PIU of 0.1 pmolIL
CsA. (A) shows DH sites in CllSTH cells. Note that thesesites are
not detected in the absence of DNase1 digestion (control DNA). P
represents a DH site in the proximal region
of the promoter, whereas
E represents a DH site located in the center of the enhancer 2.8 t o
3.0 kb upstream of the transcription startsite.
ments existed in the proximal promoter. Both DH sites appeared to be endothelial cell specific as they did not appear
in activated Jurkat cells or T cells (Fig 8B) or in a wide
range of other cell types examined (data not shown).
CsA may suppress NF-KB activity in the E-selectin promoter. We examined the sequence of the E-selectin promoter seeking transcription factor binding sites that might
be involved in DH site formation and be suppressed by
CsA. Previous studies of E-selectin gene regulation have
implicated an array of three NF-KB sites in the promoter as
being crucial for activation of E-selectin expression,"0d' and
these sites may be the most likely targets for the actions of
CsA in this locus. Indeed, there is some evidence that NFKB p50 and c-re1 expression is inhibitible by either CsA or
FK506T" which might account for the 40% inhibition of
E-selectin expression that occurs in the presence of CsA.
Nevertheless, there is also evidence obtained with T cells
that NFAT-like factors can in some cases associate with NF&-like regulatory regions."
To determine whether NFAT or NF-KB proteins are more
likely to account for the CsA-sensitivity of E-selectin expression, we examined binding of recombinant NFATp, NF-KB
GM-CSF
PROMOTER
T
NIL PMA PMA
I
I
CsA
NIL
PMA PMA
I
I
CsA
Fig 6. Activationof GM-CSF enhancerlpromoter luciferase reporter gene plasmids in endothelial cells. Luciferase gene plasmids
containing either the GM-CSF promoter (pGMlucl or the GM-CSF
enhancer linked to the promoter (pGMEluc) were transfected into
C l lSTH cells and stimulated for 9 hours with 20 nglmL PMA and 2
pmol/L A23187 in the presence (PMAlIlCsA) or absence (PMAII) of
0.1 pmollL CsA. Luciferase activities wereexpressed as a percentage
of thevalues obtained with stimulated pGME and represent the mean
of nine experiments. Error bars represent the standard deviation.
p50, and NF-KB p65 to the best characterized NF-KB site in
the E-selectin promoter (PD14'), and to three control NFATp
and NF-KB binding sites (Fig 9). This particular E-selectin
NF-KB site was the most proximal of the three NF-KB sites
in the promoter and the one found to be the most essential
for E-selectin promoter activity. As this element encompasses the sequence AGAGGAAA, it is also the E-selectin
NF-KB site that most resembles binding sites for NFATP.'.~
As anticipated from earlier studies of T-cell nuclear extracts,"both the IL-2 NFAT site and the IgK NF-KB site
had the capacity to associate withall three proteins. This
confirmed the view that NF-KB and NFATp have the poten-
Table 1. Suppression of Neutrophil Adhesion
to CllSTHCells bv CsA
Treatment
Nil
T
N
L
F
ITNF-dCsA
Adhesion (cpm x 10")
117 2 7 (n = 7)
795 2 33 (n = 14)
565 2 49 (n = 9)
Results are presented as mean 2 SEM. The 29% decreasein neutrophil adhesion in the presence of CsA was statistically significant as a
Student's t-test gave P = .0006.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
GENE
GM-CSF AND E-SELECTIN
2695
Fig 7. CsA suppresses induction of E-selectin expression in
endothelial cells. E-selectin expression was inducedin CllSTH
cells as indicated above in the
presence of increasing concentrations
of
CsA, which
was
added 10 minutes before stimulation of thecells. See Materials
and Methods for activationconditions.
CsA@W
0
0
0 0.01 0.1 1
tial to cross-compete for binding sites. However, the E-selectin NF-KB site exhibited the weakest relative affinity for
NFATp, while efficiently binding both p50 and p65. Hence,
although NFATp did have limited potential to bind the Eselectin NF-KB site, it appeared less likely than NF-KB to
play a major role in its regulation. In contrast, very little
0 0.01 0.1 1
0 0.01 0.1 1
0 0 . 0 1 0.1 1
00.01 0.1 1
probe, which is a high-affinity NFATp site, and the dominant
NFAT site in the GM-CSF enhancer.'
DISCUSSION
To gainnew insights into processes that regulate inflammation, we focused on the endothelium, which orchestrates
NF-KB p50 or p65 binding was detected with the GM430
IG2
NF'AT
B
A
Sa
I
3
+ + + + & a
+ +
\om
Igk E-selectin GM430
NF"kB NF-kB NFATp
m 0
aa
O A + +
vzaa
"
A
6.5
.
6.5+
+
3.0 +
3.0+
DNase1
-6.0
-3.5
E-selectin gene
Y
DN$?
0
BgUI EcoRI
+1.3
c
-
+3.0
probe
Fig 8. Mapping of DH sites upstream of the E-selectin gene in
endothelial cells from anEcoRl site 3.0 k b upstream of the
tranxrip
tion startsite. Cells were either unstimulated(Nil1 or stimulated for
4 t o 6 hours with 20 ng/mL PMA and 2 pmollL A23187 in the presence
(PlIICsA) orabsence (PlI) of0.1 pmollL CsA or with 100 UlmL TNFQ. (AIshows DH sites in CllSTH cells. Notethatthese
sites are
not detected in the absence of DNase1 digestion (control DNA). The
inducible DH site in the proximal region of the promoter appeared
as a 3.0-kb fragment, whereas an upstream constitutive DH site appeared as a 6.5-kb fragment. The membranes used in (AI and (B) are
the same as those in Fig 3.
Fig 9. Gelelectrophoreticmobility
shift assays of recombinant
NFATp and NF-KB. The indicated probes were incubated with 0.5 ng
NFATp, 10 ng NF-wBp50, or 0.07 p L NF-KB p65. The probes corresponded t o t h eIL-2 promoter distal NFAT site," the K lg gene NF-KB
site." the E-selectin promoter proximal NF-KBsite,u and the GM430
high-affinity NFATp
the
from
site
GM-CSF
enhancer.'
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2696
many early inflammatory events, and CsA, which is in widespread use as an immunosuppressive and antiinflammatory
drug. Two important classes of molecules that are activated
during the early stages of inflammation are the cytokines
and adhesion molecules that direct the activation and trafficking of leukocytes that enter inflammatory lesions. We
have concentrated on GM-CSF and E-selectin as potential
targets for antiinflammatory actions of CsA in endothelial
cells, and these are two molecules that might function in
concert on neutrophils and eosinophils.
Surprisingly, we discovered that immunoregulatory mechanisms initially thought to be restricted to lymphoid cells
also operated in endothelial cells. Hence, the T-cell transcription factor NFAT was induced in endothelial cells by pathways that in T cells are triggered by T-cell receptor and
phospholipase C activation. CsA, an immunosuppressant
previously thought to function primarily by inhibiting induction of NFAT and cytokine gene expression in T cells, also
inhibited activation of NFAT in endothelial cells. The endothelial cell NFAT complexes were found to contain the protein NFATp, which has recently been reported to be expressed in both hematopoietic and nonhematopoietic cells,"
rather than NFATc, which is thought to be lymphoid-specific. Although there are few previous reports suggesting
functions for NFAT outside of the T-cell lineage, a recent
study has implicated NFAT as a factor required for TNF-a
gene expression in B cells.45Other studies have demonstrated
that ligation of surface immunoglobulin results in CsA-sensitive induction of NFAT and activation of NFAT-responsive
reporter genes in B cell^.^,^'
GM-CSF is a proinflammatory cytokine having the potential to activate neutrophils, monocytes, and eosinophils. Of
all the cytokines that can be expressed by endothelial cells,
GM-CSF is perhaps the only one strongly inhibited by CsA
in T cells. Therefore, we have explored the potential of CsA
to act as an antiinflammatory agent working to suppress
activation of myeloid cells by GM-CSF. We observed that
CsA suppressed the Caz+-mediated activation of GM-CSF
protein expression in endothelial cells by 50% and GM-CSF
mRNA expression by approximately 60%.
To determine the molecular basis for the regulation of
GM-CSF expression in endothelial cells, we examined the
functions of regulatory elements within the GM-CSF locus.
Previous studies in T cells suggested that GM-CSF gene
activation is mediated to a large extent by binding of NFAT
to the upstream enhan~er,'.~and binding of NFAT, AP-1,
and NF-KB to the promoter.''-z0 In this study we found that
the upstream enhancer was also required for efficient activation of the GM-CSF promoter in transfected endothelial
cells, and that the activity of the promoter and enhancer
was suppressed twofold in the presence of CsA. As seen
previously in T cells, stimulation with PMA and A23187
led to chromatin structure changes within the enhancer that
were suppressed by CsA. These observations may suggest a
direct role for NFAT in the induction of the GM-CSF enhancer in endothelial cells.
In contrast to T cells, endothelial cells appeared to have
only a partial dependence on NFAT for induction of GMCSF expression. Although CsA completely suppressed in-
COCKERILL ET AL
duction of NFAT, it only partially suppressed the GM-CSF
promoter and enhancer and GM-CSF mRNAandprotein
expression in endothelial cells. In T cells, CsA essentially
eliminates GM-CSF gene expression.' Furthermore, TNF-a
was a potent inducer of NF-KB and GM-CSF expression in
endothelial cells, but was a poor activator of NFAT and an
inefficient inducer of the DH site in the enhancer (data not
shown). Therefore, it is likely that TNF-a induces GM-CSF
expression byusing factors that activate the promoter in
the absence of NFAT. Interestingly, the GM-CSF promoter
existed as a constitutive DH site in endothelial cells (Fig 5),
but not in T cells' (data not shown). Consequently, the GMCSF promoter may exist in a primed state in cultured endothelial cells and have a reduced dependence on the enhancer
for its activation.
We also found some evidence suggesting that CsA can
inhibit endothelial cell functions by suppressing factors other
than NFAT. E-selectin expression was inhibited by about
40% in the presence of CsA by a process unlikely to directly
involve NFAT. The E-selectin promoter is activated principally by an array of NF-KB site^,^.^' which represented poor
binding sites for NFATp. Furthermore, the suppression of
E-selectin by CsA was not limited to activation pathways
involving Ca". CsA reduced E-selectin expression by the
same extent regardless of whether TNF-(Uor PMNA23187
was used to induce expression. This was in marked contrast
to the GM-CSF gene, which was suppressed by CsA when
activated by PMNA23187, but not when activated by TNFa. CsA also suppressed induction of the DH site that forms
over the array of NF-KB sites in the E-selectin promoter,
suggesting that CsA may regulate members of the NF-KB
family in endothelial cells. This suggestion is supported by
reports that CsA and FK506 can partially suppress two NFKB family members in lymphoid cells.43*"Indeed, the NFKB p105/p50 gene promoter4'mayitself be regulated by
CsA, as it includes the sequence TGGACCGCATGACTCTA that closely resembles the NFAT consensus sequence.' Alternatively, CsA may suppress E-selectin expression at the posttranscriptional level, thus accounting for the
ability of CsA to suppress distinct pathways tothe same
extent. However, E-selectin induction via PMA was not significantly influencedby CsA, arguing against a posttranscriptional mechanism.
The evidence accumulated in this study suggests that the
ability of CsA to act as an antiinflammatory drug maybe
partly caused by direct effects on the endothelium. Although
immune and inflammatory disorders clearly involve complex
cytokine networks operating within a confederacy of immune and nonimmune cell types, there is a significant role
that the endothelium plays in their progression. By suppressing GM-CSF and E-selectin expression in endothelial
cells, CsA could reduce the extent to which neutrophils and
eosinophils are recruited at sites of inflammation. In this
study, the effective dose of CsA (0.1 p r n o a ) waswell
within the range of the plasma concentration of approximately 0.3pmol/L CsA that is usually maintained therapeutically. Hence, this study may, in part, account for the reductionin neutrophil and eosinophil infiltration observed on
treatment of disorders such as p s o r i a ~ i s ~and
~ * ~asthma27s4'
'
with CsA.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
GM-CSF AND E-SELECTINGENEEXPRESSION
2697
ACKNOWLEDGMENT
17. O’Keefe SI, Tamura J, Kincaid RL, Tocci M, O’Neill EA:
FK-506- and CsA-sensitive activation of the interleukin-2 promoter
by calcineurin. Nature 357:692, 1992
18. Masuda ES, Tokumitsu H, Tsubio A, Shlomai J, Hung P,
AraiK, Arai N: The granulocyte-macrophage colony-stimulating
factor promoter cis-acting element CLEO mediates induction signals
in T cells and is recognised by factors related to API and NFAT.
Mol Cell Biol 13:7399, 1993
19. Tsubio A, Muramatsu M, Tsutsumi A, Arai K, Arai N: Calcineurin activates transcription from the GM-CSF promoter in synergy with either protein kinase C or NF-KBIAP-I in T cells. Biochem
Biophys Res Commun 199:1064, 1994
20. Jenkins F, Cockerill PN, Bohman D, Shannon MF: Multiple
signals are required for function of the human granulocyte-macrophage colony-stimulating factor gene promoter in T cells. J Irnmunol
155:1240, 1995
21. McCaffrey PG, Jain J, Jamieson C, Sen R, Rao A: A T cell
nuclear factor resembling NF-AT binds to an NF-KB site andto
the conserved lymphokine promoter sequence “cytokine-l.” J Biol
Chem 267:1864, 1992
22. Gasson JC: Molecular physiology of granulocyte-macrophage
colony-stimulating factor. Blood 77: 1131, 1991
23. Bevilacqua MP: Endothelial-leukocyte adhesion molecules.
Annu Rev Immunol 11:767, 1993
24. Springer TA: Traffic signals for lymphocyte recirculation and
leukocyte emigration: the multistep paradigm. Cell 76:301, 1994
25. Lopez AF, Williamson DJ, Gamble JR, Begley CG, Harlan
JM, Klebanoff SJ, Waltersdorph A, Wong G, Clark SC, Vadas MA:
Recombinant human granulocyte-macrophage colony-stimulating
factor (rH GM-CSF) stimulates in vitro mature human neutrophil
and eosinophil function, surface receptor expression and survival. J
Clin Invest 78: 1220, 1986
26. Arend WP, Dayer JM: Cytokines and cytokine inhibitors or
antagonists in rheumatoid arthritis. Arthritis Rheum 33:305, 1990
27. Calderon E, Lockey RF, Bukantz SC, Coffey RG, Ledford
DK: Is there a role for cyclosporine in asthma? J Allergy Clin
Immunol 89:629, 1992
28. Wong RL, Winslow CM, Cooper KD: The mechanisms of
action of cyclosporin A in the treatment of psoriasis. Irnmunol Today
14:69, 1993
29. Kaushansky K: Control of granulocyte-macrophage colonystimulating factor production in normal endothelial cells by positive
and negative regulatory elements. J Immunol 143:2525, 1989
30. Luscinskas F W , Ding H, Lichtman AH: P-selectin and vascular cell adhesion molecule 1 mediate rolling and arrest, respectively,
of CD4+ T lymphocytes on tumour necrosis factor a-activated vascular endothelium under flow. J Exp Med 181:1 179, 1995
31. Montefort S, Gratziou C, Goulding D, Polosa R, Haskard DO,
Howarth PH, Holgate ST, Carroll M P Bronchial biopsy evidence for
leukocyte infiltration and upregulation and leukocyte-endothelial cell
adhesion molecules 6 hours local allergen challenge of sensitised
asthmatic airways. J Clin Invest 93:1411, 1994
32. Koch AE, Burrows A E , Haines GK, Carlos TM, Harlan JM:
Immunolocalisation of endothelial and leukocyte adhesion molecules
in rheumatoid and osteoarthritic synovial tissues. Lab Invest 64:313,
1991
33. Wakita H, Takigawa M: E-selectin and vascular cell adhesion
molecule-l are critical for initial trafficking of helper/inducer/memory T cells in psoriatic lesions. Arch Dermatol 130:457, 1994
34. Sartor RB: Cyclosporine therapy for inflammatory bowel disease. N Engl J Med 330:1897, 1994
35. Wells G, Tugwell P: Cyclosporin A in rheumatoid arthritis:
Overview of efficacy. Br J Rheumatol 3251, 1993
36. Cockerill GW, Meyer G, Noack L, Vadas MA, Gamble JR:
We are indebted to A. Rao for providing NFATp anti-sera and
DNA clones for NFATp, Y. Khew-Goodall for the E-selectin NFKB probe, and T. Collins for providing E-selectin DNA clones. We
thank R. Himes, F. Jenkins, and F. Shannon for the luciferase reporter gene plasmids. We thank L. Noack for technical assistance
with neutrophil adhesion assays and B. Stein for assistance with
statistical analyses. We thank D. Gillis, Y. Khew-Goodall, and
M.F. Shannon for helpful advice and critical reading of the manuscript.
REFERENCES
1. Masuda ES, Naito Y, Arai K, Ami N: Expression of lymphokine genes in T cells. The Immunologist 1:198, 1993
2. Nicola NA: Hemopoietic cell growth factors and their receptors. Annu Rev Biochem 58:45, 1989
3. Mattila PS, Ullman KS, Fiering S , Emmel EA, McCutcheon
M, Crabtree GR, Herzenberg LA: The actions of cyclosporin A and
FK506 suggest a novel step in the activation of T lymphocytes.
EMBO J 9:4425, 1990
4. Nolan GP: NF-AT-AP-1 and Rel-bZIP: hybrid vigor and binding under the influence. Cell 77:795, 1994
5. Rao A: NF-ATP: A transcription factor required for the coordinate induction of several cytokine genes. Immunol Today
15:274, 1994
6. Schreiber SL, Crabtree G R The mechanism of action of
cyclosporin A and FK506. Immunol Today 13:136, 1992
7. Shaw JP, Utz PJ, Durand DB, Toole JJ, Emmel EA, Crabtree
GR: Identification of a putative regulator of early T cell activation
genes. Science 241:202, 1988
8. Cockerill PN, Shannon MF, Bert AG, Ryan GR, Vadas MA:
The granulocyte-macrophage colony-stimulating factorhterleukin 3
locus is regulated by an inducible cyclosporin A sensitive enhancer.
Roc Natl Acad Sci USA 90:2466, 1993
9. Cockerill PN, Bert AG, Jenkins F, RyanGR, Shannon MF,
Vadas MA: Human granulocyte-macrophage colony-stimulating factor enhancer function is associated with cooperative interactions
between AP-l and NFATpk. Mol Cell Biol 15:2071, 1995
10. Jain J, McCaffrey PG, Miner Z, Kerpola TK, Lambert TN,
Verdine GL, Curran T, RaoA: The T-cell transcription factor
NFATp is a substrate for calcineurin and interacts with Fos and Jun.
Nature 365:352, 1993
11. Jain J, McCaffrey PG, Valge-Archer VE, Rao A: Nuclear
factor of activated T cells contains Fos and Jun. Nature 356:801,
1992
12. McCaffrey PG, Luo C, Kerppola TK, Jain J, Badalian TM,
HoAM, Burgeon E, Lane WS, Lambert JS, Curran T, Verdine
GL, Rao A, Hogan PG: Isolation of the cyclosporin-sensitive T cell
transcription factor NFATp. Science 262:750, 1993
13. Northrop JP, Ho SN. Chen L, Thomas DJ, Timmerman LA,
Nolan GP, Admon A, Crabtree GR: NF-AT components define a
family of transcription factors targeted in T-cell activation. Nature
369:497, 1994
14. Northrop JP, Ullman KS, Crabtree GR: Characterization of
the nuclear and cytoplasmic components of the lymphoid-specific
nuclear factor of activated T cells (NF-AT) complex. J Biol Chem
268:2917, 1993
15. Boise LH, Pehyniak B, Mao X,June CH, Wang CY, Lindsten
T, Bravo R, Kovary R, Leiden JM, Thompson JB: The NFAT-l
DNA binding complex in activated T cells contains Fra-l and JunB.
Mol Cell Biol 13:1911, 1993
16. Clipstone NA, Crabtree GR: Identification of calcineurin as
a key signalling enzyme in T-lymphocyte activation. Nature 357:695,
I992
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2698
Characterisation of a spontaneously transformed human endothelial
cell line. Lab Invest 71:497, 1994
37. Himes SR. Coles LS, Katsikeros R, Lang RK, Shannon MF:
HTLV-I tax activation of the GM-CSF and G-CSF promoters requires the interaction of NF-KB with other transcription factor families. Oncogene 8:3189, 1993
38. Dunn SM, Coles LS, Lang RK, Gerondakis S, Vadas MA,
Shannon MF: Requirement for NF-KB p65 and NF-interleukin-6
binding elements in the tumour necrosis factor response region of
the granulocyte colony-stimulating factor promoter. Blood 83:2469,
1994
39. Pober JS, Slowik MR, DeLuca LG, Ritchie AJ: Elevated
cyclic AMP inhibits endothelial cell synthesis and expression of
TNF-induced endothelial leukocyte adhesion molecule-1, andvascular cell adhesion molecule-l, but not intercellular adhesion molecule1. J Immunol 150:.5114, 1993
40. Schindler U, Baichwal VR: Three NF-KBbinding sites in the
human E-selectin gene required for maximal tumour necrosis factor
alpha-induced expression. Mol Cell Biol 14:5820, 1994
41. Lewis H, Kaszubska W, DeLarmarter JF, Whelan J: Cooperativity between two NF-KB complexes, mediated by high mobility
group protein I(Y), is essential for cytokine induced expression of
the E-selectin promoter. Mol Cell Biol 145701, 1994
42. Whitely MZ, Thanos D, Read MA, Maniatis T, Collins T: A
COCKERILL ET AL
strikmg similarity inthe organisation of the E-selectin andbeta
interferon gene promoters. Mol Cell Biol 145464, 1994
43. McCaffrey PG, Kim PK, Valge-Archer VE, Sen R, Rao A:
Cyclosporin A sensitivity of the NF-KB site of the IL2Ra promoter
in untransformed murine T cells. Nucleic Acids Res 22:2134, 1994
44. Venkataraman L, Burakoff SJ, Sen R: FK.506 inhibits antigen
receptor-mediated induction of c-re1 in B and T lymphoid cells. J
Exp Med 181:1091, 1995
45. Goldfeld AE, Tsai E, Kincaid R, Beelshaw PJ, Schreiber SL,
Strominger JL, Rao A: Calcineurin mediates human tumour necrosis
factor a gene induction in stimulated T and B cells. J Exp Med
180:763, 1994
46. Choi MSK, Brines RD, Holman MJ, Klaus GGB: Induction
of NF-AT in normal B lymphocytes by anti-immunoglobulin or
CD40 ligand in conjunction with IL-4. Immunity 1:179, 1994
47. Venkataraman L, Francis DA, Wang Z, Liu J, Rothstein TL,
Sen R: Cyclosporin-A sensitive induction of NF-AT in murine B
cells. Immunity 1:189, 1994
48. Ten RM, Paya CV, Israel N, Le Bail 0, Mattei MG, Virilizier
JL, Kourilsky P, Israel A: The characterization of the promoter of
the gene encoding the p50 subunit of NF-KB indicates that it participates in its own regulation. EMBO J 11:195, 1993
49. Noms AA, Jackson DM, Eady RP: Protective effects of cyclophosphamide, cyclosporin A and FK506 against antigen-induced
lung eosinophilia in guinea pigs. Clin Exp Immunol 89:347, 1992
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
1995 86: 2689-2698
Regulation of granulocyte-macrophage colony-stimulating factor and
E- selectin expression in endothelial cells by cyclosporin A and the Tcell transcription factor NFAT
GW Cockerill, AG Bert, GR Ryan, JR Gamble, MA Vadas and PN Cockerill
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/7/2689.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.