Download Nucleotide sequence of the 3h-terminal two

Journal
of General Virology (1998), 79, 1299–1307. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Nucleotide sequence of the 3«-terminal two-thirds of the
grapevine leafroll-associated virus-3 genome reveals a typical
monopartite closterovirus
K.-S. Ling,1 H.-Y. Zhu,1 R. F. Drong,2 J. L. Slightom,2 J. R. McFerson3 and D. Gonsalves1
1
Department of Plant Pathology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456, USA
Molecular Biology Research, Pharmacia & Upjohn Co., Kalamazoo, MI 49007, USA
3
USDA Plant Genetic Resources Unit, Cornell University, Geneva, NY 14456, USA
2
The RNA genome of grapevine leafroll-associated
closterovirus-3 (GLRaV-3) was cloned as a cDNA
generated from GLRaV-3-specific dsRNA, and a
partial genome sequence of 13 154 nucleotides (nt)
including the 3« terminus was determined. The
sequenced portion contained 13 open reading
frames (ORFs) potentially encoding, in the 5«–3«
direction, proteins of " 77 kDa (ORF1a ; helicase,
HEL), 61 kDa (ORF1b ; RNA-dependent RNA polymerase, RdRp), 6 kDa (ORF2), 5 kDa (ORF3, small
transmembrane protein), 59 kDa (ORF4 ; heat shock
protein 70, HSP70), 55 kDa (ORF5), 35 kDa (ORF6 ;
coat protein, CP), 53 kDa (ORF7 ; diverged coat
protein, CPd), 21 kDa (ORF8), 20 kDa (ORF9),
20 kDa (ORF10), 4 kDa (ORF11), 7 kDa (ORF12),
Introduction
The plant virus family Closteroviridae was established to
include only those viruses with flexuous filamentous particles
longer than 1000 nm (Dolja et al., 1994 ; Agranovsky, 1996).
Two genera have been proposed. The genus Closterovirus
includes those aphid-transmissible viruses with a monopartite
genome of up to 20 000 nucleotides (nt), including beet
yellows virus (BYV) (Agranovsky et al., 1994), citrus tristeza
virus (CTV) (Karasev et al., 1995) and beet yellow stunt virus
(BYSV) (Karasev et al., 1996). The other genus, which includes
whitefly-transmissible viruses with a bipartite genome, is
represented by lettuce infectious yellows virus (LIYV)
(Klaassen et al., 1995). Additional genera may be added as new
Author for correspondence : Kai-Shu Ling.
Fax ­1 315 787 2389. e-mail KL12!cornell.edu
The nucleotide sequence data reported in this paper will appear in
GenBank under accession number AF037268.
and an untranslated region of 277 nt. ORF1b is
probably expressed via a M1 ribosomal frameshift
mechanism, most similar to that of lettuce infectious
yellows virus (LIYV). Phylogenetic analysis using
various gene sequences (HEL, RdRp, HSP70 and CP)
clearly demonstrated that GLRaV-3, a mealybugtransmissible closterovirus, is positioned independently from aphid-transmissible monopartite
closteroviruses (beet yellows, citrus tristeza and
beet yellows stunt) and whitefly-transmissible
bipartite closterovirus (lettuce infectious yellows,
LIYV). However, another alleged mealybug-transmissible closterovirus, little cherry virus, was shown
to be more closely related to the whitefly-transmissible LIYV than to GLRaV-3.
genome sequence information becomes available ; for example,
the genome sequence of the alleged mealybug-transmissible
little cherry closterovirus (LChV) has revealed a typical
monopartite genome structure with a relatively large coat
protein (46 kDa) (Keim-Konrad & Jelkmann, 1996 ; Jelkmann et
al., 1997). Other aphid- or whitefly-transmissible closteroviruses generally have a smaller coat protein, ranging from 22
to 26 kDa (Dolja et al., 1994 ; Agranovsky et al., 1996).
Four closterovirus genomes have been completely
sequenced (Agranovsky et al., 1994 ; Karasev et al., 1995 ;
Klaassen et al., 1995 ; Jelkmann et al., 1997). Based on the
presence of certain common structures in genome organization,
Dolja et al. (1994) first proposed the division of a closterovirus
genome into four modules : the accessory module of proteinase
and vector-specificity factor, the core module of three essential
elements for virus replication, methyltransferase (MTR),
helicase (HEL) and RNA-dependent RNA polymerase (RdRp),
the molecular chaperone module of cellular heat shock protein
70 (HSP70) homologue and a distantly related heat shock
0001-5256 # 1998 SGM
BCJJ
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
K.-S. Ling and others
protein 90 (HSP90) homologue, and the structural module of
coat protein (CP) and its duplicate (CPd). This common
genome structure has been observed in all monopartite aphidtransmissible, bipartite whitefly-transmissible, and monopartite
mealybug-transmissible closteroviruses (Agranovsky et al.,
1994 ; Karasev et al., 1995, 1996 ; Klaassen et al., 1995 ;
Jelkmann et al., 1997).
Seven serologically distinct closteroviruses have been
associated with grapevine leafroll (Boscia et al., 1995 ; Choueiri
et al., 1996), an important and widespread disease of grapevines
(Goheen, 1970). These grapevine leafroll-associated viruses
(GLRaV), designated GLRaV 1–7, have high molecular mass
CPs ranging from 32 to 43 kDa (Hu et al., 1990 b ; Zimmermann
et al., 1990). The exception is GLRaV-2 (Boscia et al., 1995 ;
Goszczynski et al., 1996), which has a CP of 22 kDa.
Observations suggest that leafroll disease does not spread
readily within infected vineyards, except when GLRaV-3 is
present. Several laboratories have shown that GLRaV-3 can be
transmitted by five species of mealybugs : Planococcus ficus
(Rosciglione & Gugerli, 1989 ; Engelbrecht & Kasdorf, 1990),
Pseudococcus longispinus (Tanne et al., 1989 ; Petersen & Charles,
1997), Pseudococcus viburni (¯ affinis) (Golino et al., 1995),
Pseudococcus calceolariae (Petersen & Charles, 1997) and Planococcus citri (Cabaleiro & Segura, 1997). In addition, GLRaV-3
has been reported to be transmitted by the scale insect
Pulvinaria vitis L. (Belli et al., 1994).
We have investigated GLRaV-3 as part of our long-term
goal to characterize the closteroviruses that are associated with
the leafroll virus disease. The NY1 isolate of GLRaV-3 used in
this study was first characterized in our laboratory by Zee et al.
(1987). We demonstrated that closterovirus-like particles were
closely associated with the disease and BYV-type vesicles were
observed in leafroll-infected tissues (Zee et al., 1987 ; Kim et al.,
1989). GLRaV-3-specific antiserum and monoclonal antibodies
were produced against purified virions (Zee et al., 1987 ; Hu et
al., 1990 a). The molecular mass of the GLRaV-3 CP was
estimated on Western blot to be 43 kDa (Hu et al., 1990 b).
However, further characterization of its biochemical and
molecular properties was hampered due to difficulties in
obtaining sufficient amounts of purified virus. Recently, we
constructed a cDNA Lambda ZAPII library by cloning cDNA
that was synthesized from dsRNA isolated from GLRaV-3infected grapevines and the CP gene was identified (Ling et al.,
1997). In this paper, we present the nucleotide sequence of the
3« two-thirds of the GLRaV-3 genome together with an
analysis of its relationship with other closteroviruses, and
discuss the implications for evolution of closteroviruses.
Methods
+ Virus source and dsRNA isolation. The NY1 isolate of GLRaV3 (Zee et al., 1987 ; Hu et al., 1990 b), which is also referred to as isolate
GLRaV 109 by Golino (1992), was used throughout this work. Infected
dormant canes or mature leaves were collected from a central New York
vineyard and kept at ®20 °C until use. DsRNA was isolated from
BDAA
grapevine leafroll-diseased vines according to the method described by
Hu et al. (1990 b). Full-length dsRNA of GLRaV-3, approximately 18 kb
in size, was low melting agarose gel-purified and used as template for the
generation of cDNA libraries (Ling et al., 1997) or for PCR.
+ Identification and sequencing of selected clones. Complementary DNA of GLRaV-3 was synthesized from purified dsRNA and a
Lambda ZAPII library was prepared as described (Ling et al., 1997). The
CP gene of GLRaV-3 was identified by immunoscreening the cDNA
library with GLRaV-3-specific polyclonal and monoclonal antibodies. A
degenerate primer (5« GGIGGIGGIACITTYGAYGTITCI, I ¯ inosine,
Y ¯ T or C) generated from a conserved amino acid sequence from Motif
C of the BYV HSP70 gene (Agranovsky et al., 1991 ; Karasev et al., 1994)
was used to select HSP70-positive clones. Clones containing the CP gene
(Ling et al., 1997) were used as probes to select clones that may contain
sequences beyond the CP gene. In addition, end-sequences from
randomly selected clones were used to establish the initial sequence
contigs. Further sequence extensions were made by the clone walking
strategy, which used sequences that flanked the sequenced contig to
probe the library for a clone that might contain an insert extending
farther in either the 5« or 3« direction. After sequence assembly, additional
gaps were linked by PCR with specific primers on dsRNA template. PCRamplified products were purified from a low melting point agarose gel
and sequenced directly or subcloned into a pBlue T-vector (Novagen).
To determine the 3« end sequence, poly(A) was added to purified
GLRaV-3-specific dsRNAs by yeast poly(A) polymerase (USB) and
reverse transcribed using (dT) primer [KSL95-7, 5« GGTCTCGAG(T) ]
"&
and Moloney murine leukaemia virus (MMLV) reverse transcriptase
(Pappu et al., 1994 ; Karasev et al., 1995). Using this first strand cDNA as
template, a PCR product was amplified with a (dT) primer and a GLRaV3-specific primer (KSL95-16, 5«CGAGGTAAGATGACTAAACT). The
PCR product was either sequenced directly or cloned into a pBlue Tvector prior to sequencing.
Selected clones were initially sequenced using universal vector
primers (T3 and T7) followed by step-by-step primer extension. The
clones were sequenced manually with the Sequenase version 2.0 kit (USB)
or with the Taq DyeDeoxy terminator cycle sequencing kit (ABI) on an
ABI373 automatic sequencer at Cornell’s New York State Agricultural
Experiment Station.
Nucleotide sequences were initially analysed using the Genetics
Computer Group (GCG) sequence analysis software package (version
7.2). The sequence was assembled with Newgelstart to initialize the GCG
fragment assembly system and to support automated fragment assembly.
Later, the SeqMan (DNASTAR) computer-aided sequence analysis
package was used for sequence assembly. Both sequence assembling
programs revealed the same pattern of sequence arrangement.
The amino acid sequences were obtained either from the SWISSPROT database or translated from nucleotide sequences from GenBank.
The Pearson & Lipman (1988) method of the program MegAlign in the
DNASTAR package was used to depict amino acid sequence similarity of
GLRaV-3 with respect to other closteroviruses for various gene regions.
The Clustal method of MegAlign was also used to generate a putative
phylogenetic relationship of GLRaV-3 HEL, RdRp, HSP70 and CP}CPd
with respect to the other closteroviruses. With the Clustal method, a
preliminary phylogeny was derived from the distances between pairs of
input sequences and application of the UPGMA algorithm (Sneath &
Sokal, 1973), which guides the alignment of ancestral sequences. The final
phylogeny was produced by applying the neighbour-joining method of
Saitou & Nei (1987) to the distance and alignment data. To assess more
accurately the relationships among closteroviruses, corresponding HEL
and RdRp sequences from tobacco mosaic virus (TMV) were used as an
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
GLRaV-3 nucleotide sequence
outgroup member. In the case of HSP70, a plant HSP70 (designated
pea70HSP) was used as an outgroup. To further confirm the tentative
phylogenetic relationship, additional phylogenetic analysis with PHYLIP
(version 3.572) (Felsenstein, 1989) was applied, which used the Dayhoff
PAM matrix 001 for calculating distance matrices (Dayhoff, 1979),
followed by the neighbour-joining method (Saitou & Nei, 1987) for tree
construction. Furthermore, Bootstrap was used to obtain a consensus tree
for a better assessment of phylogenetic relationships.
Results and Discussion
Clone selection and nucleotide sequencing
The same cDNA library that was used to identify the CP
gene (Ling et al., 1997) was also used for the present study.
Clone walking, using probes derived from 5« or 3« ends of
mapped clones, was used to isolate 200 clones (insert sizes
ranging from 300 bp to 3 kb). From this large set of clones, 54
were selected for end-sequence analysis to identify the smaller
subset of clones that contained the longest stretch of the
GLRaV-3 genome. This subset of 18 clones was then sequenced
on both strands. After assembling clones by their overlapping
sequences, analysis of the overall sequence revealed two
potential gaps. These gaps were completely sequenced by
directly sequencing GLRaV-3 genomic PCR products or the
subclones of these PCR products (3«-3 and 3«-4 in Fig. 1). A
total of 13 154 nt was sequenced and deposited in GenBank
(accession number AF037268).
Sequence analysis and GLRaV-3 genome organization
The genome sequence of GLRaV-3 revealed in the present
study potentially encompassed 13 open reading frames (ORFs),
tentatively designated ORFs 1a, 1b, and 2–12 following the
conventional closterovirus designation (Agranovsky et al.,
1994). Major genetic components, such as HEL (ORF1a), RdRp
(ORF1b), HSP70 homologue (ORF4), a putative HSP90
homologue (ORF5), CP (ORF6) and CPd (ORF7) were
identified. In general, the genome organization of GLRaV-3 is
consistent with that expected for a typical monopartite
closterovirus (Dolja et al., 1994).
Our analysis of ORF1a shows that it is incomplete, missing
an expected 5 kb in the 5«-terminal portion. However, the
sequence obtained encodes a peptide of 701 amino acids,
which covers approximately one-third of the expected ORF1a.
Database searches indicated that the C-terminal portion of this
protein shared significant similarity with the Superfamily 1
helicase of positive-strand RNA viruses. Pairwise comparison
of the conserved region (291 amino acids) shows a 29±3 %
similarity to BYSV, 28±9 % to BYV, 28±6 % to LIYV, 27±5 % to
CTV and 26±1 % to LChV (Table 1). Six motifs conserved in
helicases of positive-strand RNA virus Superfamily 1
(Hodgman, 1988 ; Koonin & Dolja, 1993) were also observed
(data not shown). Phylogenetic analysis suggests that GLRaV3, which is transmitted by mealybugs (e.g. Cabaleiro & Sequra,
Fig. 1. Schematic presentation of the GLRaV-3 genome, and positions of
the selected cDNA clones that were used to determine the nucleotide
sequence. Clones 3«-3 and 3«-4 were obtained from PCR amplification to
bridge two gaps and other clones were selected from the cDNA library.
Table 1. Percentage amino acid sequence similarity
between GLRaV-3 and other closteroviruses for different
genes in the virus genomes
Amino acid sequence similarity was calculated from a pairwise
comparison of sequences using the Pearson and Lipman method of the
DNASTAR sequence analysis package.
BYV
CTV
LIYV
BYSV
LChV
HEL
RdRp
HSP70
p55
CP
28±9
27±5
28±6
29±3
26±1
39±2
37±9
33±1
36±0
32±2
23±5
23±8
22±0
24±0
22±7
11±2
11±4
11±8
12±2
11±4
12±3
12±6
15±8
11±6
13±2
1997) is located in an independent lineage from the aphidtransmissible (BYV, CTV and BYSV) and whitefly-transmissible (LIYV) closteroviruses (Fig. 2 a). However, GLRaV-3 was
not placed on the same branch as LChV, the other mealybugtransmissible closterovirus (Jelkmann et al., 1997). Rather,
LChV was consistently shown to have a closer relationship
with the whitefly-transmissible LIYV, using either of the
phylogenetic analysis programs (MegAlign and PHYLIP).
ORF1b overlaps the last 113 nt of ORF1a and terminates at
the UAA codon at positions 3711–3713. This ORF potentially
encodes a protein of 533 amino acid residues, including the first
methionine, with a calculated molecular mass of 60 678 Da.
Database searches revealed that this protein has a significant
similarity to the Supergroup 3 RdRp of the positive-strand
RNA viruses. Pairwise comparison of GLRaV-3 with BYV,
CTV, LIYV, BYSV and LChV over a 313 amino acid sequence
fragment revealed striking amino acid sequence similarity
among eight conserved motifs (data not shown). The best
alignment was with BYV, with 39±2 % similarity, followed by
CTV (37±9 %), BYSV (36±0 %), LIYV (33±1 %), and LChV
(32±2 %) (Table 1). Using RdRp sequences (313 amino acids), a
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
BDAB
K.-S. Ling and others
(a)
(b)
(c)
(d)
Fig. 2. Phylogenetic relationship of closteroviruses as determined from
homologue genes. These relationship were determined using amino acid
sequences expected to contain HEL (a), RdRp (b), HSP70 (c) and
CP/CPd (d). In the case of HEL and RdRp, corresponding tobacco mosaic
virus (TMV) sequences (J02415) were used as a non-closterovirus
outgroup. In the case of HSP70, the pea HSP70 (L03299) was used as a
non-closterovirus outgroup. In the case of CP, sweet potato sunken vein
virus (SPSVV) CP (X80995) was also included. To facilitate the
alignment, only 250 amino acid residues in the C-terminal portion of CP
(LChV and GLRaV-3) and CPd (LIYV, LChV and GLRaV-3) were used. The
length of each pair of branches represents the distance between sequence
pairs. The scale beneath the tree measures the distance between
sequences. Numbers indicate total substitution events.
similar pattern of phylogenetic relationships to that of the HEL
was observed (Fig. 2 b).
As first suggested for the expression of ORF1b in BYV
(Agranovsky et al., 1994) and later observed in CTV (Karasev
et al., 1995), LIYV (Klaassen et al., 1995), BYSV (Karasev et al.,
1996) and LChV (Jelkmann et al., 1997), a ­1 ribosomal
frameshift mechanism may also be used for the expression of
an ORF1a}1b fusion protein in GLRaV-3. However, the socalled ‘ slippery ’ GGGUUU sequence and the stem–loop
structure that were proposed to be involved in the BYV
frameshift were absent from the GLRaV-3 ORF1a}1b overlap.
Direct comparison of the GLRaV-3 ORF1a}1b overlap with
other closteroviruses showed a striking amino acid sequence
similarity around the putative frameshift point to LIYV
BDAC
(Klaassen et al., 1995) (data not shown). Additional experiments
on in vitro expression of GLRaV-3 genomic RNA are needed in
order to determine whether a large fusion protein is actually
produced.
ORF2 potentially encodes a small peptide with a calculated
molecular mass of 5927 Da (p6) followed by a long intergenic
region of 1067 nt. There are no counterpart ORFs in the BYV
and LChV genomes, but in CTV (Karasev et al., 1995), LIYV
(Klaassen et al., 1995) and BYSV (Karasev et al., 1996) larger
ORFs (33, 32 and 33 kDa respectively) are found in this
position.
ORF3 potentially encodes a small peptide of 45 amino
acids with a calculated molecular mass of 5090 Da (p5). Direct
comparison with other closteroviruses suggests that this is a
small hydrophobic transmembrane protein (data not shown).
ORF4 potentially encodes a protein of 549 amino acids
with a calculated molecular mass of 59 113 Da (p59). A search
in GenBank revealed significant similarity to the HSP70 family
of chaperones with the highest similarity to those from
closteroviruses. A multiple amino acid sequence alignment of
GLRaV-3 p59 with HSP70 homologues of closteroviruses
showed a sequence similarity among eight conserved motifs
(A–H) (Fig. 3). Functionally important motifs (A–C) that are
characteristic of all proteins containing the ATPase domain of
the HSP70 type (Bork et al., 1992) were also preserved in
GLRaV-3 p59, which suggests that this HSP70 chaperone-like
protein may also possess ATPase activity on its N-terminal
domain and protein–protein interaction on its C-terminal
domain (Dolja et al., 1994). Inspection of a tentative phylogenetic relationship among closterovirus HSP70s and a cellular
HSP70 shows that closterovirus HSP70s are grouped together
and separated from the plant HSP70 (Fig. 2 c). Two mealybugtransmissible viruses (LChV and GLRaV-3) were placed
between the aphid-transmissible and whitefly-transmissible
viruses. Pairwise comparison of p59 with other closterovirus
HSP70s showed the highest percentage amino acid similarity
to BYSV (24±0 %), followed by CTV (23±8 %), BYV (23±5 %),
LChV (22±7 %) and LIYV (22±0 %) (Table 1).
ORF5 potentially encodes a protein of 483 amino acids
with a calculated molecular mass of 54 852 Da (p55). The
deduced protein did not have significant sequence similarity to
proteins observed in GenBank except to the similarly sized and
positioned ORF of other closteroviruses. Direct comparison
with counterparts from closteroviruses revealed very limited
sequence similarity, with 12±2 % to BYSV, 11±8 % to LIYV,
11±4 % to CTV, 11±4 % to LChV and 11±2 % to BYV,
respectively (Table 1). Moreover, two conserved regions of
HSP90 homologue previously delineated in BYV and CTV
were not identified in p55 of GLRaV-3 (data not shown).
ORF6 was previously identified as the CP gene (Ling et al.,
1997). Besides four conserved amino acids (N, R, G and D)
identified in all closterovirus CPs, there was very limited
sequence similarity (11±6–15±8 %) with LIYV, LChV, CTV,
BYV and BYSV (Table 1). ORF7 potentially encodes a protein
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
GLRaV-3 nucleotide sequence
Fig. 3. Amino acid sequence alignment of the HSP70 homologue of GLRaV-3 with respect to the homologues from BYV, CTV,
LIYV, LChV and BYSV. The eight conserved motifs (A–H) of cellular HSP70 are overlined. Consensus amino acids are shown
above the alignment in cases where a majority of the residues match (4 out of 6).
of molecular mass 53 104 Da (p53, CPd) and was identified as
a CPd gene based on the presence of four conserved
closterovirus coat protein residues (N, R, G and D) in the Cterminal portion of this protein. Analysis of the phylogenetic
relationship of closteroviruses using CPs and their diverged
copies again placed GLRaV-3 in an independent lineage from
aphid-transmissible and whitefly-transmissible closteroviruses.
In addition, sequences of GLRaV-3 CP and its diverged copy
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
BDAD
K.-S. Ling and others
were more closely related to one another than their counterparts were in the other mealybug transmissible closterovirus
(LChV) (Fig. 2 d).
The remaining five ORFs downstream of CPd (ORFs 8–12)
potentially encode proteins of 185, 177, 179, 36 and 60 amino
acids with calculated molecular mass values of 21 248 (ORF8,
p21), 19 588 (ORF9, p19.6), 19 652 (ORF10, p19.7), 3 933
(ORF11, p4) and 6768 Da (ORF12, p7), respectively. Searches
of current databases using the BLAST program did not reveal
statistically significant homologies for these proteins.
Although these genes were organized in a similar fashion to
CTV in terms of position and size, direct pairwise comparisons
did not reveal obvious sequence relationships.
The 3« untranslated region (UTR) consisted of 277 nt, for
which sequence database searches found no significant match
except to the p20 sequence identified in another isolate of
GLRaV-3 (Habili et al., 1995). Prediction of extensive secondary structure in the 3« UTR suggested that this region of
the GLRaV-3 RNA may play a role in viral RNA replication.
The sequence information provided by Habili et al. (1995)
showed that they have cloned the region near the 3« terminus
of the GLRaV-3 genome. However, we extended this 3« end
sequence by 16 nt which was in agreement with the size
predicted by their primer extension experiment (Habili et al.,
1995). As observed in CTV (Karasev et al., 1995) and BYSV
(Karasev et al., 1996), a G nucleotide of nonviral origin was
added to the dsRNA. We also observed what may be an
additional G in the dsRNA of GLRaV-3.
In addition to our earlier sequencing of the CP gene and its
flanking regions (Ling et al., 1997), we have now sequenced
about two-thirds of the GLRaV-3 genome. These reports are
the first direct evidence showing that the high molecular mass
dsRNA (C 18 kb) isolated from infected vines is actually
derived from the genome of GLRaV-3. Analysis of the 13
ORFs identified in the present study indicates that the genome
organization of GLRaV-3 bears significant similarity to other
typical closteroviruses.
Another cDNA library was obtained from dsRNA of an
Italian isolate of GLRaV-3 and selected clones reacted
specifically to dsRNA isolated from GLRaV-3-infected vines
on a Northern blot (Saldarelli et al., 1994). However, sequence
information was not reported. Habili et al. (1995) sequenced a
small (1012 nt) part of dsRNA isolated from GLRaV-3-infected
vines from Australia and identified a putative ORF (p20).
However, a pairwise comparison between that sequence and
our GLRaV-3 genome suggested that their p20 sequence was
probably derived from a defective interference (DI) sequence.
When we analysed the p20 sequence by breaking it down into
two parts, the 5« part of 662 nt in p20 mapped to the Nterminal portion of ORF5 (position 6829–7491) with a
similarity of 97±9 % at the nucleotide level and 97±2 % at the
amino acid level. The 3« part (350 nt) of p20 corresponded to
the major region of the 3« UTR (position 12787–13140) with
92±8 % nucleotide similarity. Mawassi et al. (1995 a, b) showed
BDAE
that DI RNAs are rather commonly associated with CTV
infection. Thus, it is not surprising that DI RNAs are present in
GLRaV-3-infected plants.
Several serologically distinct closteroviruses have been
shown to induce a similar type of leafroll symptom on
grapevines ; moreover, mixed infections of different viruses in
a plant are common (Boscia et al., 1995 ; Choueiri et al., 1996).
Thus, the cDNA library developed in the present study may
have contained clones from different viral genomes. In fact,
when we used a degenerate primer to HSP70 as a probe to
screen the cDNA library, we identified some clones with
sequences that were not related to that of GLRaV-3. Thus, it
became even more important that the CP gene of GLRaV-3
was first identified (Ling et al., 1997). We are confident that the
sequence information presented here is of the GLRaV-3
genome because we used the clone-walking strategy with the
CP gene as the anchor point. Except for two gaps that were
bridged over with PCR (3«-3 and 3«-4), all other sequences
were confirmed by at least two overlapping clones. However,
some sequence heterogeneity was still observed in the GLRaV3-specific clones. Final sequence information from these
ambiguous positions (106 nt or 0±8 % of the total nucleotide
sequence) was determined by majority rule with at least one
additional overlapping clone.
Information regarding the genome of GLRaV-3 gives a
better understanding of closteroviruses that are associated
with grapevine leafroll disease and adds to the fundamental
knowledge of closteroviruses. Based on a tentative division of
the closterovirus genome (Dolja et al., 1994), Agranovsky
(1996) suggested that the closteroviruses be divided into three
modules. For GLRaV-3, the 5« accessory module including the
protease and putative vector transmission factor is yet to be
identified. The core module, which includes key domains of the
RNA replication machinery (MTR-HEL-RdRp), is conserved
throughout the alphavirus supergroup and our analysis reveals
that the HEL and RdRp domains are conserved in GLRaV-3
(Fig. 4). The MTR domain of GLRaV-3 is yet to be identified.
The chaperone-CP module, HSP70-p59-CP-CPd, is conserved
in closteroviruses including GLRaV-3 (Fig. 4), which further
supports the inclusion of GLRaV-3 as a member of the
closterovirus family (Hu et al., 1990 b ; Martelli & Bar-Joseph,
1991 ; Coffin & Coutts, 1993).
Sequence comparison and phylogenetic analysis of GLRaV3 with respect to other closteroviruses using several conserved
domains clearly demonstrate that this mealybug-transmissible
closterovirus is at an intermediate position on the closterovirus
evolutionary cascade, with aphid-transmissible (BYV, CTV
and BYSV) and whitefly-transmissible (LIYV) closteroviruses
at two extremes (Fig. 2). Although the apple mealybug
Phenacoccus aceris has been shown to transmit little cherry
disease (Raine et al., 1986), several viruses have been recovered
from infected plants (Jelkmann, 1995 ; Eastwell & Bernardy,
1996). Thus, additional experiments must be done to show that
LChV (Jelkmann et al., 1997) is transmitted by mealybugs.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
GLRaV-3 nucleotide sequence
Fig. 4. Comparison of the genome
organization of GLRaV-3 with four
complete closteroviruses (BYV, CTV, LIYV
and LChV) and one partial closterovirus
(BYSV). Protein homologues are shown
by similar boxed patterns. PRO, papainlike proteinase ; MTR, methyltransferase of
type 1 ; HEL, RNA helicase of Superfamily
1 ; RdRp, RNA polymerase of Supergroup
3 ; HSP70, HSP70-related protein ; CP,
capsid protein. RBP, RNA-binding protein.
Interestingly enough, comparisons of sequences between
LChV and GLRaV-3 did not reveal a close relationship in the
phylogenetic analysis (Fig. 2) or similarity test (Table 1),
although they both possess a large CP (35–46 kDa) and CPd
(53–76 kDa). All aphid-transmissible closteroviruses contain
smaller (22–26 kDa) CP and CPd while the whiteflytransmitted LIYV has a small CP but a large CPd. Moreover,
the genomes of LIYV, LChV and GLRaV-3 have the CPd
downstream of CP. Do these characteristics affect vector
specificity? Additional sequence information on the 5« portion
of GLRaV-3 genome is necessary to get more insight on the
genes that may affect vector specificity. Agranovsky (1996)
suggested that the putative vector transmission factor may be
located in the 5« accessory module, which is yet to be identified
in GLRaV-3.
Based upon major differences in genome format and
organization between BYV, CTV and LIYV, and a phylogenetic analysis, Dolja et al. (1994) proposed the establishment
of the new family Closteroviridae, which includes at least two
genera, Closterovirus (BYV) and a group of whitefly-transmissible viruses (e.g. LIYV ; Klaassen et al., 1995) with a
bipartite genome. Our work on genome organization and
phylogenetic analysis of GLRaV-3, along with evidence that it
is transmitted by mealybugs (Rosciglione & Gugerli, 1989 ;
Tanne et al., 1989 ; Engelbrecht & Kasdorf, 1990 b ; Golino et al.,
1995 ; Petersen & Charles, 1997 ; Cabaleiro & Segura, 1997),
suggest that a new (third) genus under the family Closteroviridae
should also be established.
This research was supported in part by USDA}ARS Cooperative
Agreement no. 58-2349-9-01 with the USDA Clonal Repository at
Geneva, New York and by the Cornell Center for Advanced Technology
(CAT) in Biotechnology, which is sponsored by the New York Science
and Technology Foundation and Industrial Partners. We thank Dr A. V.
Karasev at University of Florida for a critical review of the manuscript
and Mr James Van Ee of the BioResource Center’s computing facility at
Cornell University for assistance in phylogenetic analysis.
References
Agranovsky, A. A. (1996). Principles of molecular organization, ex-
pression, and evolution of closteroviruses : over the barriers. Advances in
Virus Research 47, 119–158.
Agranovsky, A. A., Boyko, V. P., Karasev, A. V., Koonin, E. V. & Dolja,
V. V. (1991). Putative 65-kDa protein of beet yellows closterovirus is a
homologue of HSP70 heat shock proteins. Journal of Molecular Biology
217, 603–610.
Agranovsky, A. A., Koonin, E. V., Boyko, V. P., Maiss, E., Frotschl, R.,
Lunica, N. A. & Atabekov, J. G. (1994). Beet yellows closterovirus :
complete genome structure and identification of a papain-like thiol
protease. Virology 198, 311–324.
Belli, G., Fortusini, A., Casati, P., Belli, L., Bianco, P. A. & Prati, S.
(1994). Transmission of a grapevine leafroll associated closterovirus by
the scale insect Pulvinaria vitis L. Rivista di Patologia Vegetale 4, 105–108.
Bork, P., Sander, C. & Valencia, A. (1992). An ATPase domain common
to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp70 heat
shock proteins. Proceedings of the National Academy of Sciences, USA 89,
7290–7294.
Boscia, D., Greif, C., Gugerli, P., Martelli, G. P., Walter, B. & Gonsalves,
D. (1995). Nomenclature of grapevine leafroll-associated putative
closterovirus. Vitis 34, 171–175.
Cabaleiro, C. & Segura, A. (1997). Some characteristics of the
transmission of grapevine leafroll associated virus 3 by Planococcus citri
Risso. European Journal of Plant Pathology 103, 373–378.
Choueiri, E., Boscia, D., Digiaro, M., Castellano, M. A. & Martelli, G. P.
(1996). Some properties of a hitherto undescribed filamentous virus of
the grapevine. Vitis 35, 1–3.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
BDAF
K.-S. Ling and others
Coffin, R. S. & Coutts, R. H. A. (1993). The closteroviruses, capillo-
viruses and other similar viruses : a short review. Journal of General
Virology 74, 1475–1483.
Dayhoff, M. O. (1979). Atlas of Protein Sequence and Structure, vol. 5,
suppl. 3. Washington, DC : National Biomedical Research Foundation.
Dolja, V. V., Karasev, A. V. & Koonin, E. V. (1994). Molecular biology
and evolution of closteroviruses : sophisticated build-up of large RNA
genomes. Annual Review of Phytopathology 32, 261–285.
Eastwell, K. C. & Bernardy, M. G. (1996). Association of high molecular
weight double-stranded RNA with little cherry disease. Canadian Journal
of Plant Pathology 18, 203–208.
Engelbrecht, D. J. & Kasdorf, G. G. F. (1990). Transmission of
grapevine leafroll disease and associated closteroviruses by the vine
mealybug Planococcus ficus. Phytophylactica 22, 341–346.
Felsenstein, J. (1989). PHYLIP–phylogeny inference package (version
3.2). Cladistics 5, 164–166.
Goszczynski, D. E., Kasdorf, G. G. F., Pietersen, G. & Van Tonder, H.
(1996). Grapevine leafroll-associated virus 2 (GLRaV-2) – mechanical
transmission, purification, production and properties of antisera, detection
by ELISA. South African Journal for Enology and Viticulture 17, 15–26.
Goheen, A. C. (1970). Grape leafroll. In Virus Diseases of Small Fruits and
Grapevines, pp. 209–219. Edited by N. W. Frazier. Berkeley : Division of
Agricultural Sciences, University of California.
Golino, D. A. (1992). The Davis grapevine virus collection. American
Journal of Enology and Viticulture 43, 200–205.
Golino, D. A., Sim, S. T. & Rowhani, A. (1995). Transmission studies of
grapevine leafroll associated virus and grapevine corky bark associated
virus by the obscure mealybug. American Journal of Enology and Viticulture
46, 408.
Habili, N., Fazeli, C. F., Ewart, A., Hamilton, R., Cirami, R., Saldarelli,
P., Minafra, A. & Rezaian, M. A. (1995). Natural spread and molecular
analysis of grapevine leafroll-associated virus 3 in Australia. Phytopathology 85, 1418–1422.
Hodgman, T. C. (1988). A new superfamily of replicative proteins.
Nature 333, 22–23 (erratum 578).
Hu, J. S., Gonsalves, D., Boscia, D. & Namba, S. (1990 a). Use of
monoclonal antibodies to characterize grapevine leafroll associated
closteroviruses. Phytopathology 80, 920–925.
Hu, J. S., Gonsalves, D. & Teliz, D. (1990 b). Characterization of
closterovirus-like particles associated with grapevine leafroll disease.
Journal of Phytopathology 128, 1–14.
Jelkmann, W. (1995). Cherry virus A : cDNA cloning of dsRNA,
nucleotide sequence analysis and serology reveal a new plant capillovirus
in sweet cherry. Journal of General Virology 76, 2015–2024.
Jelkmann, W., Fechtner, B. & Agranovsky, A. A. (1997). Complete
genome structure and phylogenetic analysis of little cherry virus, a
mealybug-transmissible closterovirus. Journal of General Virology 78,
2067–2071.
Karasev, A. V., Nikolaeva, O. V., Koonin, E. V., Gumpf, D. J. & Garnsey,
S. M. (1994). Screening of the closterovirus genome by degenerate
primer-mediated polymerase chain reaction. Journal of General Virology
75, 1415–1422.
Karasev, A. V., Boyko, V. P., Gowda, S., Nikolaeva, O. V., Hilf, M. E.,
Koonin, E. V., Niblett, C. L., Cline, K., Gumpf, D. J., Lee, R. F., Garnsey,
S. M., Lewandowski, D. J. & Dawson, W. O. (1995). Complete sequence
of the citrus tristeza virus RNA genome. Virology 208, 511–520.
Karasev, A. V., Nikolaeva, O. V., Mushegian, A. R., Lee, R. F. &
Dawson, W. O. (1996). Organization of the 3«-terminal half of beet
BDAG
yellow stunt virus genome and implications for the evolution of
closteroviruses. Virology 221, 199–207.
Keim-Konrad, R. & Jelkmann, W. (1996). Genome analysis of the 3«terminal part of the little cherry disease associated dsRNA reveals a
monopartite clostero-like virus. Archives of Virology 141, 1437–1451.
Kim, K. S., Gonsalves, D., Teliz, D. & Lee, K. W. (1989). Ultrastructure
and mitochondrial vesiculation associated with closterovirus-like particles
in leafroll diseased grapevines. Phytopathology 79, 357–360.
Klaassen, V. A., Boeshore, M. L., Koonin, E. V., Tian, T. & Falk, B. W.
(1995). Genome structure and phylogenetic analysis of lettuce infectious
yellows virus, a whitefly-transmitted, bipartite closterovirus. Virology
208, 99–110.
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of
positive-strand RNA viruses : Implications of comparative analysis of
amino acid sequences. Critical Reviews in Biochemistry and Molecular
Biology 28, 375–430.
Ling, K.-S., Zhu, H.-Y., Alvizo, H., Hu, J. S., Drong, R. F., Slightom,
J. L. & Gonsalves, D. (1997). The coat protein gene of grapevine leafroll
associated closterovirus-3 : cloning, nucleotide sequencing and expression
in transgenic plants. Archives of Virology 142, 1101–1116.
Martelli, G. P. & Bar-Joseph, M. (1991). Closterovirus. In Classification
and Nomenclature of Viruses. Fifth Report of the International Committee on
Taxonomy of Viruses, pp. 345–347. Edited by R. I. B. Francki, C. M.
Fauquet, D. L. Knudson & F. Brown. New York & Vienna : SpringerVerlag.
Mawassi, M., Karasev, A. V., Mietkiewska, E., Gafny, R., Lee, R. F.,
Dawson, W. O. & Bar-Joseph, M. (1995 a). Defective RNA molecules
associated with citrus tristeza virus. Virology 208, 383–387.
Mawassi, M., Mietkiewska, E., Hilf, M. E., Ashoulin, L., Karasev, A. V.,
Gafny, R., Lee, R. F., Garnsey, S. M., Dawson, W. O. & Bar-Joseph, M.
(1995 b). Multiple species of defective RNAs in plants infected with
citrus tristeza virus. Virology 214, 264–268.
Pappu, H. R., Karasev, A. V., Anderson, E. J., Pappu, S. S., Hilf, M. E.,
Febres, V. J., Eckloff, R. M. G., McCaffery, M., Boyko, V., Gowda, S.,
Dolja, V. V., Koonin, E. V., Gumpf, D. J., Cline, K. C., Garnsey, S. M.,
Dawson, W. O., Lee, R. F. & Niblett, C. L. (1994). Nucleotide sequence
and organization of eight 3« open reading frames of the citrus tristeza
closterovirus genome. Virology 199, 35–46.
Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological
sequence comparison. Proceedings of the National Academy of Sciences, USA
85, 2444–2448.
Petersen, C. L. & Charles, J. G. (1997). Transmission of grapevine
leafroll-associated closteroviruses by Pseudococcus longispinus and P.
calceolariae. Plant Pathology 46, 509–515.
Raine, J., McMullen, R. D. & Forbes, A. R. (1986). Transmission of the
agent causing little cherry disease by the apple mealybug Phenacoccus
aceris and the dodder Cuscuta lupuliformis. Canadian Journal of Plant
Pathology 8, 6–11.
Rosciglione, B. & Gugerli, P. (1989). Transmission of grapevine leafroll
disease and an associated closterovirus to healthy grapevine by the
mealybug Planococcus ficus. Phytoparasitica 17, 63.
Saitou, N. & Nei, M. (1987). The neighbor joining method : a new
method for reconstructing phylogenetic trees. Molecular Biology and
Evolution 4, 406–425.
Saldarelli, P., Minafra, A., Martelli, G. P. & Walter, B. (1994). Detection
of grapevine leafroll-associated closterovirus III by molecular
hybridization. Plant Pathology 43, 91–96.
Sneath, P. H. A. & Sokal, R. R. (1973). Numerical Taxonomy – The
Principles and Practice of Numerical Taxonomy. San Francisco : Freeman.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
GLRaV-3 nucleotide sequence
Tanne, E., Ben, D. Y. & Raccah, B. (1989). Transmission of closterolike
particles by mealybugs (Pseudococcidae) in Israel. Phytoparasitica 17,
63–64.
Zee, F., Gonsalves, D., Goheen, A., Kim, K. S., Pool, R. & Lee, R. F.
(1987). Cytopathology of leafroll-diseased grapevines and the puri-
fication and serology of associated closteroviruslike particles. Phytopathology 77, 1427–1434.
Zimmermann, D., Bass, P., Legin, R. & Walter, B. (1990). Characterization and serological detection of four closterovirus-like particles
associated with leafroll disease on grapevine. Journal of Phytopathology
130, 205–218.
Received 10 October 1997 ; Accepted 22 December 1997
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 23:16:10
BDAH