Download Control of Cleavage Cycles in Drosophila Embryos by fru¨ hstart

Developmental Cell, Vol. 5, 285–294, August, 2003, Copyright 2003 by Cell Press
Control of Cleavage Cycles
in Drosophila Embryos by frühstart
Jörg Großhans,1,2,* H. Arno J. Müller,3
and Eric Wieschaus2
1
ZMBH
Universität Heidelberg
Im Neuenheimer Feld 282
69120 Heidelberg
Germany
2
Howard Hughes Medical Institute
Department of Molecular Biology
Princeton University
Princeton, New Jersey 08540
3
Institut für Genetik
Heinrich-Heine-Universität
Universitätsstrasse 1, Geb. 26.02
40225 Düsseldorf
Germany
Summary
Early metazoan development consists of cleavage
stages characterized by rapid cell cycles that successively divide the fertilized egg. The cell cycle oscillator
pauses when the ratio of DNA and cytoplasm (N/C)
reaches a threshold characteristic for the species.
This pause requires maternal factors as well as zygotic
expression of as yet unknown genes. Here we isolate
the zygotic gene frühstart of Drosophila and show that
it is involved in pausing the cleavage cell cycle. frs is
expressed immediately after the last cleavage division.
It plays a role in generating a uniform pause and it can
inhibit cleavage divisions when precociously expressed. Furthermore, the expression of frs is delayed
in haploid embryos and requires activity of the maternal checkpoint gene grapes. We propose that zygotic
frs expression is involved in linking the N/C and the
pause of cleavage cycle.
Introduction
Development in animal embryos begins with the cleavage stage, during which the large fertilized egg cell is
split into increasingly smaller cells by an invariant number of rapid cell divisions. The end of cleavage and
the associated transition to the following developmental
stage is marked by a pause in the cell cycle, changes
in cellular morphology, and a requirement for zygotic
gene expression. This “midblastula transition” has been
characterized in a variety of different animal species
(e.g., Xenopus, zebrafish, Drosophila) and can be regarded as a simple example of a switch in developmental programs (Newport and Kirschner, 1982).
A common feature observed in many species is the
control of the number of cleavage divisions by the
nucleocytoplasmic ratio (N/C). The cleavage cell cycle
pauses when the ratio of the amounts of DNA to cytoplasm reaches a specific threshold. In haploid embryos,
*Correspondence: [email protected]
for example, there is one more cleavage division than
in diploids; in tetraploid embryos there is one fewer
(Boveri, 1902). According to a model discussed by Newport and Kirschner (1982), chromosomes titrate a cytoplasmic factor that represses the transition until its level
reaches a critical value. The molecular nature of this
control mechanism remains largely unclear, but the ratelimiting cytoplasmic factor apparently controls DNA replication, perhaps through some cell cycle component or
checkpoint (Edgar and Datar, 1996; Sibon et al., 1997,
1999; Kimelman et al., 1987).
The entry of Drosophila embryos into cycle 14 and
the following stage, cellularization, show many similarities to the midblastula transition observed in other species. Drosophila embryos have a superficial cleavage
typical for insects with 13 nuclear divisions. In the last
three cycles, mitotic cyclins (Edgar et al., 1994) and
String/Twine, the Cdc25 phosphatases for Cdk1 in Drosophila (Edgar and Datar, 1996), may become limiting.
The cell cycle lengthens from 8 to 18 min (Foe et al.,
1993), and major zygotic transcription begins. The pause
of the cleavage cell cycle that occurs in cycle 14 normally coincides with the onset of cellularization, a major
morphological transition requiring genes like nullo, bnk,
slam, and sry-␣, whose transcription begins during the
extended cycles and peaks by the end of cycle 13
(Schweisguth et al., 1990; Rose and Wieschaus, 1992;
Scheijter and Wieschaus, 1993; Lecuit et al., 2002).
Cell cycle progression during the final cleavage divisions is monitored by a DNA repair checkpoint involving
the protein kinase Grapes (D-Chk1) and Mei41 (Fogarty
et al., 1997; Sibon et al., 1997, 1999; Yu et al., 2000). In
one model, the checkpoint would delay mitosis in the
last three cycles until DNA replication is completed, possibly by phosphorylating D-Cdc25, as suggested by the
homology to Chk1 (Walworth et al., 1993; Sanchez et
al., 1997). Embryos from grapes mutant females lack
this checkpoint. Cell cycles 11–13 do not elongate, and
perhaps as a consequence of incomplete DNA replication, the chromosomes arrest in metaphase 13. Other
aspects of the cell cycle, like spindle formation and
nuclear envelope breakdown and assembly, continue
to undergo oscillations despite the metaphase arrest of
the chromosomes, suggesting that the grapes checkpoint is required for the absolute pause in cell cycle
characteristic of cycle 14. The pause may also involve
an effect of grapes on zygotic transcription. Studies
using ␣-amanitin indicate that at least some product of
zygotic transcription is required for a complete cell cycle
pause in cycle 14 (Gutzeit, 1980; Edgar et al., 1986;
Edgar and Datar, 1996; Foe et al., 1993; Sibon et al.,
1997). Although cycle 13 embryos mutant for grapes
express the cellularization genes nullo, slam, and bnk
(data not shown) and patterning genes runt and ftz (Sibon et al., 1997), the block in metaphase 13 appears to
prevent the major increase in zygotic transcription that
normally occurs in cycle 14 (Sibon et al., 1997). If the
zygotic products required for the cell cycle pause normally accumulate only in cycle 14, the metaphase arrest
in grapes might block their expression. On the other
Developmental Cell
286
Figure 1. Mapping of frs
Physical map of the frs/71CD region with STS
positions, the annotated genomic sequence
according to Flybase, and the approximate
breakpoints of the deficiencies. The lines of
the deficiencies indicate the deleted region.
The deficiencies Df(3L)XG9 and Df(3L)fz-M21
do not, while the other deficiencies indicated
do, uncover the ventral furrow defect of frs
when crossed to C(3) females.
hand, no such zygotic genes that are targets of grapes
and control cell cycle progression have been identified.
In a previous study we and others investigated the
interaction of mitosis and morphogenetic movements
during ventral furrow formation and the invagination of
the mesoderm anlage (Mata et al., 2000; Seher and Leptin, 2000; Großhans and Wieschaus, 2000). We described
a mitotic inhibitor which specifically delays mitosis in the
cells of the ventral furrow to prevent an interference of
mitosis and furrow formation. At least two genes constitute
the mitotic inhibitor: tribbles (trbl), encoding a protein kinase-related protein, and frühstart (frs).
Here we isolate the zygotic gene frs. In addition to its
role during mesoderm invagination, frs appears to be
involved in pausing the rapid nuclear cycles prior to
cellularization. Since the onset of frs expression is delayed in haploid embryos with respect to the number
of cleavage cycles, frs provides a link of the N/C and
cleavage cell cycle pause.
Results
frs Encodes a Uniformly Expressed Small
Basic Protein
Our initial approach to the cloning of frs relied on its
cell cycle effects during gastrulation. We mapped the
ventral furrow phenotype (Großhans and Wieschaus,
2000; Seher and Leptin, 2000) with deficiency chromosomes to a region of about 50 kb predicted to encode
18 transcripts (Adams et al., 2000; Figure 1). One of
these transcripts (designated z600 by Schulz and Miksch,
1989) was described as having an expression profile
reminiscent to that of trbl. To test whether this transcript
encodes frs, we recombined a frs deficiency with a
transgene carrying 1.7 kb of genomic DNA of this region.
When crossed to C(3)se females, the deficiency alone
produces a premature mitosis in all zygotically mutant
embryos (104%; Table 1). The defect was eliminated by
the transgene; the majority of the deficiency embryos
had a normal timing of mitosis and formed a proper
ventral furrow, suggesting that we identified the frs gene
(18%; Table 1).
frs encodes a cytoplasmic protein (see below) of 90
amino acid residues, including 19 basic residues with
an isoelectric point of 10 (Schulz and Miksch, 1989).
Proteins that have obvious similarities to the frs protein
have not yet been described in any other species. We
generated antibodies to the frs protein and confirmed
their specificity by showing that they fail to stain frsdeficient embryos (Figures 2I–2L). On a cellular level,
Frs appears to be excluded from the nucleus, despite its
positive charge and a size below the apparent exclusion
limit of the nuclear pores. When analyzed by immunofluorescence at higher resolution, Frs staining appears particulate (Figures 2 and 5; data not shown).
In wild-type embryos, frs RNA is expressed in a narrow
peak early in cycle 14 (Figures 2A–2C) and is downregulated in a complex pattern during late cellularization and
gastrulation. frs RNA persists until stage 9 (extended
germband stages) in a set of dorsal cells, presumably
the aminoserosa anlage (Figure 2D). Frs protein shows
the same developmental profile (Figures 2E–2H). In frs
mutant gastrula, only the cells of mitotic domain 10
divide prematurely. To test whether this spatially restricted phenotype is due to the pattern of frs expression
during gastrulation, we uniformly expressed the frs
cDNA in frs-deficient embryos under UAS control during
cellularization and gastrulation (Table 1). Expression of
the UAS-frs transgene rescued the mitotic defect in the
ventral cells, but did not obviously delay mitosis in the
other regions of the gastrula (Table 1), suggesting that
differential sensitivity of the ventral furrow cells during
gastrulation reflects a regional cell-type-specific restriction in frs activity.
frs Expression Is Sufficient to Pause
the Cleavage Cycles
During gastrulation, frs inhibits mitosis in the ventral
furrow. The stage when frs is first expressed, however,
Cleavage Cell Cycle Pause in Drosophila
287
Table 1. frs Phenotypes
(A) Ventral Furrow Phenotype
Genotype/Cross
Normal VF
Defective VF
Penetrance (%)
Df frs
mGal4/UAS-frs; Df frs
C(3) ⫻ Df frs/⫹
C(3) ⫻ frs⫹ Df frs/⫹
27
30
82
165
71
3
29
8
71
10
104a
18a
Genotype/Cross
13 Cycles (Normal)
14 Cycles (Partial, Comp.)
Penetrance (%)
Df frs
Df frs/⫹, ⫹/⫹
4⫻twn⫹
4⫻twn⫹; twn⫹/⫹
4⫻twn⫹; Df frs
4⫻twn⫹; Df frs/⫹, ⫹/⫹
4⫻twn⫹; frs⫹ Df frs
4⫻twn⫹; frs⫹ Df frs/⫹, ⫹/⫹
112
304
241
211
12
180
67
143
10
1
5
36
88
70
9
18
(B) MBT Phenotype
8
0.3
2
15
88
28
12
11
(A) Embryos from mGal4; Df frs/TM3 females crossed with UAS-frs; Df frs/TM3 males scored for a premature mitosis (p-histone 3 staining)
in mitotic domain 10. 25% of the embryos from the C(3) cross are homozygous for Df frs.
a
The indicated penetrance is the actual score related to the expected 25%. mGal4, maternal Gal4; frs⫹, transgene with frs genomic region;
VF, ventral furrow; temperature, 22⬚C.
(B) Extra nuclear division prior to cellularization (nuclear division 14). Embryos were stained, sorted according to their genotype and scored
for an extra nuclear division, seen as randomly located patches of variable size. Less often, the extra division comprised the whole embryo.
4⫻twn⫹, homozygous second chromosome with a twn⫹ transgene; frs⫹, transgene with frs genomic region. Chromosome used: TM3, hblacZ, Df frs, Df(3L)BK10; temperature, 25⬚C.
Figure 2. Expression of frs
frs detected in fixed wild-type embryos by RNA in situ hybridization
(A–D) and by immunohistochemistry (E–H) ([A, B, E, and F], blastoderm; [C and G], gastrulation; [D and H], extended germband). Specificity of the frs antibody (I–L). frs homozygous ([I and K], marked
by kni) and heterozygous embryos (J and L) stained for Frs (I and
J) and Eve (K and L). The label ⌬frs kni indicates the chromosome
Df(3L)XG10 kni.
coincides with the more general pause in mitosis associated with the end of cleavage and the onset of cycle
14. To test whether Frs could also inhibit cleavage stage
mitoses and thus might be involved in pausing the cell
cycle in the cycle 14, we expressed frs prematurely by
injecting synthetic frs mRNA into the posterior end of
the embryos during cycles 10 to 12.
We found that posteriorly injected frs mRNA inhibited
mitosis in most of the embryos (35 of 43 embryos scored;
Figures 3C and 3D). In fixed embryos, patches with fewer
and larger nuclei could be seen at the posterior injection
site. The anterior regions of such embryos displayed a
nuclear density normally observed in cycle 14. Injection
of an unrelated mRNA, used as a control, did not change
the mitotic behavior (pelle mRNA, 40 embryos scored).
The premature end of cleavage resulted in a temporal
asymmetry of cellularization. With live or fixed specimens or embryos carrying a histone 2Av-GFP, we observed that the cells at the injection site started cellularization prematurely, were more advanced during the
process of cellularization, and also entered gastrulation
before the surrounding cells (Figure 3D; data not shown).
Cleavage divisions could also be stopped before cycle
12, when higher amounts of RNA were applied or injected before pole cell formation. These embryos did not
enter cellularization. Instead, the nuclei stopped dividing
and developed an abnormal morphology (data not shown).
Such an early arrest prior to zygotic transcription would
suggest that frs is sufficient for the cell cycle pause
without any other zygotic factor.
It has been proposed that stg RNA is degraded by a
zygotic factor (Edgar and Datar, 1996). To test whether
frs may induce stg RNA degradation and consequently
mitotic inhibition, we analyzed embryos that were locally
injected with frs mRNA by stg RNA in situ hybridization
(Figures 3H and 3I). We expect any direct effect of frs
on stg RNA stability to be graded around the injection
site, with the regions of mitotic inhibition corresponding
Developmental Cell
288
Figure 3. Control of Cleavage Cell Cycle
by frs
(A and B) Df frs embryo [Df(3L)BK10] with a
patch of higher nuclear density and asynchronous cellularization; DNA, blue; myosin,
red.
(C, D, and G–M) Embryos injected with frs
mRNA at the posterior side.
(C and D) Wild-type embryo; f-actin, green;
DNA, blue.
(E and G) Diploid and (F) haploid (x ms(3)K81
males) embryos from grapes females.
(G) The nuclei in the posterior half lag behind
by two cycles. Injected embryos stained for
(H and I) stg RNA, (J and K) Sry-␣ protein,
and (L and M) Nullo protein.
(A, E–G, I, K, and M) Fluorescent DNA staining.
(C, J, and K) Photographs of the same embryo.
(B and D) Cross-section at a higher magnification.
(E, F, H, and I) DIC and fluorescence optics.
(A–D, G, and J–M) Optical sections (confocal
optics).
to areas of maximal stg RNA degradation. We do in fact
observe a reduction in stg RNA level in regions of lower
nuclear density, but rather than being graded, the
downregulation of stg RNA shows a sharp border that
precisely matches the region of differential cell cycle
behavior (n ⫽ 16). This observation suggests that the
premature degradation of stg RNA may not be a direct
consequence of injected frs activity, but instead a consequence of the pause in the cell cycle.
frs Is Involved in a Uniform Pause
of the Cleavage Cycles
Given that frs is expressed immediately after the last
cleavage division and injection of frs mRNA is sufficient
to prematurely pause the cleavage cycles, we tested
embryos for a previously undetected requirement of frs
in the cycle 14 pause in mitosis. Among embryos deficient for frs, we observed a small fraction (less than
10%) containing patches of higher nuclear density which
appear to be due to an extra (14th) cleavage division
prior to cellularization (Figures 3A and 3B; Table 1).
These patches are variable in size and location and in
few cases comprise all cells of an embryo. In wild-type
embryos such patches are not observed. Doubling the
maternal dose of twine (4⫻twn⫹), which by itself gives
rise to an additional mitosis in a small proportion of the
embryos (Edgar and Datar, 1996; Table 1), enhances the
penetrance of the frs phenotype to almost 90% (Table
1). To test whether the extra mitosis is caused by absence of frs rather than by the other genes deleted in
the deficiency chromosome, embryos homozygous for
the frs deficiency carrying a frs genomic transgene were
scored. In most of these embryos, the number of cleavage divisions was restored to 13 (88% to 12% penetrance for the 4⫻twn females; Table 1), suggesting that
the absense of frs is responsible for the extra mitosis in
deficiency embryos. Furthermore, we injected frs dsRNA
into wild-type embryos to mimic the effect of the deficiency and observed phenocopies in about 10% of the
embryos (16/141; control RNAi, 0/140).
The consequence of the patchy extra cleavage cycle
for embryogenesis is a temporal asymmetry of cellularization, formally similar to the asynchrony observed following frs mRNA injection. The nuclei/cells that divided
only 13 times are more advanced than the nuclei that
went through an additional mitosis (Figure 3B). During
cellularization, the nuclei lengthen, and the furrow canal,
which forms the tip of the invaginating plasma membrane, migrates basally. The cells that underwent additional divisions enter gastrulation later.
frs Expression Is Delayed in Haploid Embryos
The number of cleavage cycles is ultimately determined
by the N/C, which appears to be facilitated in part by
zygotic genes, because embryos treated with ␣-amanitin
or embryos lacking the 3L chromosome arm undergo
an extra cleavage division prior to cellularization like
haploid embryos (Edgar et al., 1986; Merrill et al., 1988;
Yasuda et al., 1991). Since frs is involved in pausing the
cleavage cycle, we wondered whether frs expression
might respond to the N/C.
First we analyzed the expression profile of frs RNA in
diploid embryos during early development in greater
detail. frs RNA is not expressed before mitosis 13 (Figures 2A and 4A; Table 2). Of 62 embryos in cycle 13,
only two had a faint staining. The expression starts in
mitosis 13, when the majority of the embryos displays
weak staining (36 of 50). Full expression is observed
immediately after completion of mitosis 13 (Figure 4B).
The expression at the beginning of the cell cycle 14 is
unusual. Other zygotic genes like nullo, sry-␣, hunchback, and slam show a strong increase in the second
Cleavage Cell Cycle Pause in Drosophila
289
Figure 4. Expression of frs RNA in Haploid
Embryos
frs RNA detected by in situ hybridization in
diploid (A and B) and haploid (C–E) embryos
from fs(1)mh females. The embryos were
staged according to the nuclear density by
the fluorescent DNA staining shown in the
panels below each photograph: (A and C) no,
(D) faint/weak, and (E) strong staining, classification of Table 2.
half of the interphase 13 immediately before entry into
mitosis (data not shown).
Since the RNA detection method that we employed
does not allow a more quantitative analysis of the expression levels, we established the expression profile
for the frs protein using immunofluorescence staining.
The age of the embryos was determined by the density
of the nuclei and during cellularization by the distance
between the basal end of the nuclei and the outline
of the embryo. This distance is a linear function (with
0.2⫺0.3 ␮m/min) of the age of the embryos during cellularization (Figure 5I). Integrating the fluorescence signal
provides a (nonlinear) measure for the expression level in
individual embryos. As an internal control, the embryos
were costained for Sry-␣, which is expressed similarly
to Frs, but independently of the N/C (Figure 5; Rose and
Wieschaus, 1992). The sry-␣ transcript is slightly longer
than the frs transcript, and neither gene has introns. The
frs protein is not expressed during the cleavage cycles,
including cycle 13, but becomes detectable within minutes after completion of mitosis 13 (Figures 5A, 5B, and
5J). The expression peaks after 15–30 min of cellularization as judged by nuclear length (Figures 5C, 5D, and
Table 2. Expression Profile of frs RNA
Diploid
Haploid
Cycle Number
⫹⫹⫹
⫹⫺
⫺
⫹⫹⫹
⫹⫺
⫺
12
13
M13
14
M14
15
0
0
0
237
0
2
36
42
25
62
14
11
0
0
0
2
3
136
0
0
0
27
14
14
21
31
9
43
10
4
Diploid and haploid embryos were stained for frs RNA by in situ
hybridization and scored for the number of divisions by their nuclear
density and the intensity of the staining. ⫹⫹⫹, clear staining; ⫹⫺,
faint staining; ⫺, no staining (see Figure 4D). Cycle 14 of the diploid
and cycle 15 of the haploid embryos include only embryos in the
first phase of cellularization before the nuclei have elongated. M13,
M14, mitosis.
5J). The period of time between the last mitosis and the
peak of Frs expression is in the range of the length of
the preceding cleavage cycle and corresponds to the
point in cycle 14 when an ectopic mitosis occurs in frs
mutants or in haploid embryos (see below).
We then analyzed frs expression in haploid embryos.
frs RNA is strongly expressed only in cycle 15, after the
14th nuclear division (Figures 4C–4E; Table 2; 136 of
154). No staining was observed in embryos in mitosis
13, and during interphase 14, mostly weak expression
was observed (41 of 99, 5 with strong expression; Figure
4D). Comparing the profiles in diploids and haploids
indicates a delay in haploid embryos with respect to the
cell cycle number. Similarly frs protein is barely detectable and does not accumulate during the approximately
14 min of interphase 14 (Figures 5E and 5F). In cycle
15, however, Frs is detected in a profile comparable to
cycle 14 in diploids (Figures 5G, 5H, and 5K). We found
that Sry-␣ is expressed in cycle 14 of haploids and diploids in comparable levels (Figures 5E and 5F). In cycle
15 of haploids, Sry-␣ is present from the beginning of
the interphase, while Frs shows a profile comparable to
the cycle 14 profile in diploid embryos, reaching the high
point of expression after about 15–30 min (Figures 5G,
5H, and 5K). Since frs RNA and protein expression is
repressed in cycle 14 of haploid embryos and shifted
to cycle 15, it appears that the onset of frs expression
responds to the N/C.
Relation of the Cell Cycle Pause and Zygotic
Gene Expression
Cellularization immediately begins after the pause of the
cell cycle, even when occurring one cycle too early. This
connection suggests that the pause of the cell cycle
and the start of zygotic transcription and cellularization
are coordinated (Edgar and Schubiger, 1986). Alternatively, the cell cycle may be dominant over the various
molecular rearrangements constituting this morphological transition. Since cellularization requires the expression of the zygotic genome, we ask whether there is a
Developmental Cell
290
Figure 5. Expression of frs and sry-␣ Protein in Diploid and Haploid Embryos
(A–D) Diploid, cycle 14, (E amd F) haploid, cycle 14, and (G and H) haploid, cycle 15. Nuclear density by DNA stain (surface view). The sections
show the single channels for Sry-␣ and Frs and the overlay (red, Sry-␣; green, Frs; blue, DNA). The invaginating membrane and length of the
nuclei indicate how far cellularization has advanced.
(I) The distance between the basal end of the nuclei and the outline of the embryo as a function of time after mitosis 13 (cycle 14 in diploid,
circles; cycle 15 in haploid, squares). The onset of cellularization in the haploid embryo was set to t ⫽ 18 min.
(J and K) Fluorescence of Frs staining in diploid (J) and haploid (K) embryos. Abscissa: age of the embryo in length and position of the nuclei
(in ␮m) and the corresponding time in cycle 14 (J) or 15 ([K], in min). Ordinate: relative fluorescence of Frs staining in individual embryos. The
abscissa in (K) is shifted by 18 min to take into account the extra cleavage cycle in haploid embryos. Crosses in (K) indicate the indirect Frs
fluorescence of four haploid embryos in cycle 14. The fitted curves are cubic polynomial. The fluorescence intensity may be a nonlinear but
monotonic function of Frs concentration. The absolute numbers of (J) and (K) cannot be compared.
correlation between the pause of the cell cycle and
the onset of zygotic transcription of the cellularization
genes nullo and sry-␣. In a previous study, Rose and
Wieschaus (1992) found that the onset of nullo and sry-␣
expression is similar in haploid and diploid embryos.
Here we analyze whether the onset of expression is
changed by a premature cell cycle pause. We stained
embryos injected with frs mRNA for Sry-␣ or Nullo proteins (Figures 3J–3M). In all of the injected embryos with
a premature transition in the posterior part (Sry-␣, n ⫽
11; Nullo, n ⫽ 15), Sry-␣ and Nullo staining appeared
uniform with no obvious differences between anterior
and posterior sides, suggesting that the onset of sry-␣
and nullo expression does not depend on the state of
the cleavage cell cycle, at least during the cycles 13–14.
These observations are in contrast with the differential
degradation of maternal stg RNA in frs mRNA-injected
embryos (Figures 3H and 3I) and suggests that the expression of nullo and sry-␣ may be controlled differently
than the degradation of maternal string RNA.
The apparent cell cycle independence of nullo and
sry-␣ expression is consistent with the earlier observation by Edgar et al. (1986) that the morphological events
of cellularization, which require zygotic gene expression, are not delayed in haploid embryos. We repeated
these studies using molecular markers for junction formation and membrane invagination (Hunter and
Wieschaus, 2000). Both haploid and diploid embryos
show a redistribution of cell surface Armadillo and myosin into adjacent nonoverlaping domains at the beginning of cycle 14 (Figure 6). This redistribution marks
the formation of the basal junction/furrow canal and
indicates that both embryos initiate cellularization. In
haploid embryos, this pattern is lost during the extra
mitosis, but is restored at the onset of cycle 15 (Figures
6E–6H). This transient formation and reformation of the
furrow canal in haploid embryos has also been observed
in living embryos by time-lapse microscopy (Edgar et al.,
1986; data not shown). Since these early morphological
changes are initiated at cycle 14 in diploid and haploid
embryos, we conclude that neither the morphological
changes themselves nor the expression of genes that
control them are dependent on the N/C that controls frs
expression.
Correlation of frs and the grapes Checkpoint
In Drosophila, one well developed model for the cell
cycle pause at cycle 14 invokes the DNA replication
checkpoint controlled by the Chk1/Rad27 homolog
grapes. This checkpoint is thought to extend interphase
length in the last three cleavage cycles and then to
pause the cleavage cycle after the 13th division (Fogarty
et al., 1994, 1997; Sibon et al. 1997). Since frs is normally
only transcribed after entry into cycle 14, the metaphase
arrest in cycle 13 of grapes embryos would be expected
to prevent frs expression. We have confirmed that this
is the case, using RNA in situ hybridization of embryos
from grapes females and observed little or no frs expression compared to wild-type embryos (data not shown).
The effects of grapes are complex and clearly detectable
before the mitosis 13 arrest (Su et al., 1999). Since the
early effects of the grapes checkpoint have an impact
Cleavage Cell Cycle Pause in Drosophila
291
Figure 6. Cell Morphological Changes in Diploid and Haploid Embryos
Optical sections of fixed diploid (A–D) and
haploid (E–H) embryos in cycle 14 (A–F) and
15 (G–H) labeled for DNA (blue), Myosin (red),
and Armadillo (green). The nuclear cycle (14
or 15) was determined by the nuclear density
seen in the surface view (DNA, white). Myosin
marks the tip of the invaginating plasma
membrane, and Armadillo marks the basal
junction located apical to the furrow canal.
on the interpretation of frs role in the MBT, we reexamine
the role of grapes in detecting the N/C.
Using the metaphase arrest as a readout, we compared the grapes phenotype in diploid and haploid embryos. Haploid embryos were obtained from eggs of
fs(1)mh females or eggs fertilized by ms(3)K81 males.
In diploid embryos from grapes females, we observe
nuclear densities corresponding to cycle 13 and lower
(n ⫽ 9 in cycle 13; Figure 3E), while haploid embryos
from grapes females reached densities corresponding
to cycle 14 (cycle 14: with ms(3)K81, n ⫽ 12; with fs(1)mh,
n ⫽ 8; Figure 3F). The doubled nuclear density and the
apparent arrest in metaphase 14 in haploids suggests
that the number of cleavage cycles in grapes embryos
still depends on the N/C ratio, even though these embryos lack the grapes checkpoint. Thus the N/C must
affect some property of the egg for which grapes activity
is not essential to respond to the N/C, although the
presence of a grapes-dependent checkpoint determines the nature of the response (see Discussion).
We also tested whether the cell cycle arrest induced
by precocious expression of frs depends on the grapes
checkpoint. We deposited frs mRNA in the posterior
regions of grapes embryos and analyzed nuclear densities during cleavage (Figure 3G). Nuclear densities at
the posterior injection site were 2- or 4-fold lower than
those at the anterior end of the egg, indicating that
posterior nuclei were lagging behind by one or two cycles. Earlier injection lead to an even stronger difference.
These observations suggest that frs acts formally downstream or in parallel to grapes. Although frs injection
thus produces similar cell cycle pauses in wild-type and
grapes embryos, there is one crucial difference. In
grapes embryos, the region paused in the cell cycle
did not show any sign of premature cellularization, and
f-actin distribution did not rearrange into a hexagonal
array (data not shown). Although grapes embryos would
be expected to express the early transcripts like nullo
and sry-␣, the morphological transitions associated with
cellularization may also require the cell cycle progression and entry into cycle 14 interphase governed by the
grapes checkpoint. Once those transitions have been
initiated in cycle 14, the checkpoint may be irrelevant,
but frs is still required to prevent mitosis that would
disrupt the progress of cellularization.
Discussion
Based on the phenotypes reported in this study, we
believe the simplest explanation for the frs function is
that it inhibits entry into mitosis in a stage- and developmental-specific fashion. We initially identified the gene
based on its role during gastrulation, when it delays
mitosis during mesoderm invagination (Großhans and
Wieschaus, 2000; Seher and Leptin, 2000). Here we describe and characterize a second function of frs at the
end of the cleavage divisions: controlling the cell cycle
pause after precisely thirteen mitoses. Similar developmental transitions are found in many animal embryos
and are often referred to as the midblastula transition.
In all cases studied so far, the timing of this transition
depends on the ratio of nuclei to cytoplasm (N/C) and
is shifted one cycle in haploid embryos where the nuclear DNA content is half that of diploids. We show
that Drosophila embryos undergo a similar although less
penetrant extra mitosis in the absence of frs and show
fewer divisions if frs is precociously expressed. Since frs
is itself differentially regulated in haploids and diploids, it
may provide a unique handle on the junction between
the N/C and the cell cycle pause.
Frs differs from other known cell cycle regulators in
that it is not an essential component for cell cycle progression. Rather, Frs modulates and adjusts cell proliferation to requirements of the developmental program. In
the absence of frs, the embryo develops, and the normal
cell cycle control is largely maintained. Due to the lack
of coordination, however, the overall efficiency and robustness of the cleavage-cellularization transition and
mesoderm invagination is affected. The invariance is
also disrupted by changing the maternal gene copy
number of cell cycle regulators like string and twine
(Edgar and Datar, 1996; Table 1), creating a genetic
background in which frs is required for the correct cell
cycle pause with a penetrance of the mutant phenotype
of 90%. During both cleavage divisions and ventral furrow formation, the D-Cdc25 (stg and twine) and frs and
trbl form opposite poles in a subtle balance that determines mitotic progression. The invariance of the transition is probably based on multiple regulatory inputs, so
that natural variation in a single regulator does not lead
to dramatic defects.
Developmental Cell
292
The gastrulation defects that led to frs’s identification
also uncovered a second gene, tribbles, which encodes
a kinase-like protein with a mutant phenotype similar to
frs (Großhans and Wieschaus, 2000; Seher and Leptin,
2000; Mata et al., 2000). Trbl may act in concert with
Frs to pause the cleavage cell cycle after 13 divisions,
since onset of trbl expression is comparable to the onset
of frs expression, and injection of synthetic trbl mRNA
also stops the cleavage cycle prematurely. Their mutant
phenotypes during ventral furrow formation are indistinguishable, and the double mutant does not produce any
stronger effects (Großhans and Wieschaus, 2000).
Expression of frs shows two striking features that contrast with the behavior of previously characterized genes
zygotically active in early Drosophila development. First,
the expression peak is very narrow and rises in the early
part of the interphase 14, only after the last cleavage
division. The levels of other early zygotic transcripts
(nullo, sry-␣, bnk, slam) show strong increases slightly
earlier, during the extended interphase 13, such that
their levels are already high at the beginning of cycle
14. Second, unlike nullo and sry-␣, frs expression apparently responds to the N/C. This particular expression
pattern, together with its antimitotic activity, suggests
a unique role for frs linking the N/C and the number of
the cleavage divisions.
In the current model for pausing the cleavage cycle,
called here the checkpoint model (O’Farrell et al., 1989;
Edgar et al., 1994; Sibon et al., 1999), the N/C is measured by a maternal factor that is rate-limiting for DNA
replication and is titrated by the increasing amount of
chromatin. A DNA replication checkpoint involving
Grapes and Mei41 delays entry into mitosis until replication is complete. As the maternal replication factor becomes limiting and DNA replication slows, the checkpoint extends the G2 phase of the last three cleavage
cycles. During these cycles, zygotic transcripts can be
made before the replication checkpoint is released, and
they accumulate to high levels before the nuclei pass
through the last cleavage division. In cycle 14, these
zygotic genes trigger the cell morphological changes
characteristic for cellularization and may also prevent
entry into mitosis 14 even when cycle 14 replication
has been completed. In the context of this model, frs
transcription and Frs’s antimitotic activity may be part
of the zygotic response to prevent the extra division in
cycle 14.
Certain features of the frs transcription profile, however, are not easily explained by this model and strongly
suggest that frs transcription depends on an N/C detection system that operates in parallel with the checkpoint.
In the extended cycles 11–13, frs transcription is still
repressed, even though it has no introns and is smaller
than many of the genes that are transcribed during that
period. The failure to activate frs expression may reflect
the fact that frs is normally expressed only at the beginning of the cell cycle and might not be affected by a
replication checkpoint that primarily extends G2. Some
other feature of the N/C must explain why frs is transcribed at the beginning of cycle 14, but not at the
beginning of the preceding cycles. The same feature
may also explain the delay in frs transcription in haploid
embryos, a delay not observed for other genes like nullo
or sry-␣, whose transcription begins in the cycles extended by the grapes-dependent checkpoint.
To incorporate these observations we propose that
the N/C affects cell cycle progression in two essentially
independent ways. One pathway relies on the grapesdependent checkpoint and includes the role for the
checkpoint in the previous model. In this model, the
exponentially increasing number of nuclei would titrate
some factor necessary for DNA replication such that by
cycle 13, the decreased levels of this factor would retard
replication. Incompletely replicated DNA would activate
the grapes checkpoint to prevent entry into mitosis before DNA replication is completed. Failure to activate
this checkpoint in grapes mutants would result in metaphase arrest and block the cell’s entry into cycle 14.
Since frs is normally transcribed at the beginning of
cycle 14, metaphase-arrested embryos would fail to
transcribe frs. The residual cycling observed in nuclear
membrane breakdown and spindle morphology might
reflect this absence and frs’s normal role in insuring an
absolute pause in cycle 14. In this view, the immediate
readout of the N/C ratio is delayed DNA replication.
Removal of the grapes checkpoint affects morphological consequences of the N/C, but does not block the
ability of the embryo to measure the N/C per se. This
would be consistent with our finding that grapes mutant
embryos are still sensitive to the N/C and shift the final
point of their arrest by one cycle in haploid embryos.
The checkpoint per se however does not address why
frs transcription is repressed in cycles 11–13. Although
zygotic transcription of genes like nullo and sry-␣ occurs
simultaneously with the extended interphases induced
by the grapes checkpoint, our results and those of others (Sibon et al., 1997, 1999) indicate that the extensions
are not essential for their transcription. Expression of
nullo and sry-␣ during cycle 13 appears to be normal in
grapes mutants. Grapes mutants do block the major
burst in transcription during cycle 14, but this can be
attributed to the condensed state of the chromosomes
in the metaphase arrest. Although grapes is essential
for the embryo to get to a point where it can express
frs, given that the checkpoint is normally released prior
to entry into mitosis 13, it is hard to see how activation
of grapes in cycle 13 would directly affect transcription
of frs at the start of the cycle that follows. It is possible
that some residual signal of a previously activated
checkpoint might persist through mitosis, but since the
checkpoint accounts for the elongation of the earlier
cycles 11 and 12, a persistent checkpoint signal would
not explain the exclusive activation on frs in cycle 14.
The one thing that distinguishes cycle 14 from the preceding cycles is not the existence of a preceding checkpoint but the N/C itself. In the simplest view, the N/C
would directly influence frs transcription, triggering a
switch that distinguishes cycle 14 from the preceding
cycles. In haploid embryos, frs expression occurs after
the switch has been delayed by one cycle.
The most direct test of our model may involve an
analysis of the cis-acting control regions of the frs gene
itself. Such an analysis might identify elements responsible for its differential expression in haploids and diploids. Equally relevant for the understand of frs function
would be a biochemical analysis of the molecular mechanism that accounts for its antimitotic activity and how
Cleavage Cell Cycle Pause in Drosophila
293
the conserved cell cycle machinery is inhibited by this
protein.
Experimental Procedures
Genetic Experiments
The frs gene is listed in flybase as Z600/CG17962 (Swissprot number
P22469). Commonly used procedures, genetic material, and fly
strains were applied and used as described in Lindsley and Zimm
(1992), in the Flybase (http://fly.ebi.ac.uk/), and by the Drosophila
Genome Project (BDGP, http://www.fruitfly.org). Staging of embryos
was according to Campos-Ortega and Hartenstein (1997) or by the
number of the cleavage cycle determined by the nuclear density.
The following chromosomes and alleles were used: CyO, hb-lacZ,
TM3, hb-lacZ, kni5G, fs(1)mh, ms(3)K81, mat-tubulin-GAL4 (St. Johnston, Cambridge), His2AvGFP (Yu et al., 2000), string7M5, stringAR2,
grapesfs(1)A4, C(3)se, Df(3L)BK10, Df(3L)rR4-4, and Df(3L)fz-M21. NulloHA, nullo protein tagged with HA (hemagglutinin epitope) expressed
by the nullo promoter (Hunter and Wieschaus, 2000). Insertions of
a twn⫹ transgene on the second chromosome were obtained by
mobilizing a twn⫹ genomic rescue construct with transposase (Alphey et al., 1992; Glover, Cambridge).
Characterization of the Genetic Region of frs
104 males carrying a w⫹ insertion next to the CrebA gene (B204;
Rose et al., 1997) were irradiated with X-rays. Out of 1.2 ⫻ 105
mutagenized chromosomes in the F1 progeny, 42 w revertants were
isolated, of which 17 are lethal over Df(3L)BK10. A genetic map was
established with lethal mutations of the 71C–F region (collection of
Cherbas, Bloomington) and other deficiencies. The physical map
was established by PCR analysis with STS described in flybase
(DM and mex primer pairs) and the following primer pairs: STS71-1
(TCCCAAGCCCCCACTTTAAC, CCCCTTTTGGGTGAATCTGC) maps
between CG7804 and CG7489; STS71-2 (GCCCAACACGAACTGTG
TAC, GGTGCTAGAATGAAAAACAGCA, proximal to CG7815; and
STS71-3 (GGATCCATCCTGGTGTCCC, CGCCATCCTCGCATTCACC)
within CG17014. Homozygous embryos were identified by absence
of the TM3, hb-lacZ balancer. Template DNA was obtained by boiling
5–10 embryos in 50–100 ␮l of water with a few chelex beads (Sigma).
0.1–0.5 embryo equivalents were used as templates for the PCR.
Mapping of frs
Embryos from crosses with C(3) females were scored for defective
ventral furrow formation by live observation or staining of fixed
embryos for mitotic nuclei (p-histone3).
Histology
Fixation (4% formaldehyde in PBS/heptane or boiling for 10 s) and
protein and RNA detection in situ were performed according to
common protocols. The following antibodies were used: anti-Arm
(mouse clone N27A1, rabbit polyclonal, Wieschaus, Princeton, NJ),
anti-Serendipity-␣ (mouse clone 6B12), anti-myosin (C. Fields, Boston, MA), anti-Eve (J. Reinitz, New York), anti-p-histone3 (Upstate),
anti-␤-galacatosidase (Roche). RNA was detected with the Digoxigenin system with alkaline phosphatase (Roche). Proteins were detected by immunohistochemistry with peroxidase (Vector Lab, Burlington, VT) or by immunofluorescence with Alexa dyes (Molecular
Probes). Filamentous actin was visualized with phalloidin coupled
with fluorescent dyes (Molecular Probes). DNA was stained by
Hoechst dye or oligreen (Molecular Probes). Specimens mounted in
Durcupan (Fluka), Aquapolymount (Polysciences), or Mowiol/Dabco
were observed with microscopes Zeiss Axioplan and Axiophot or
Leica DMRXA (brightfield, differential interference contrast, fluorescence) and confocal microsopes Zeiss LSM510 and LeicaTCS. Photographs were taken on slide film (EPY64T, Kodak) or CCD cameras,
digitalized, and enhanced with the computer program Photoshop
(Adobe).
Frs Expression Profile
Frs expression was quantified with the computer program NIH Image
(NIH, Bethesda, MD) by integrating the fluorescence (8 bit color
depth) of Frs antibody staining in an area basally to the nuclei on
the dorsal side at 50% egg length. The approximate age of the
embryos in cellularization was determined by the distance between
the outline of the embryo and the basal end of the nuclei. The
fixation, staining, and evaluation of the diploid and haploid embryos
were performed in parallel, but in separate experiments, so that the
absolute numbers cannot be directly compared. The parameters of
the cubic polynomials were chosen by minimizing the sum of the
square distances.
Molecular Genetics and Antibody Production
The frs cDNA was amplified by PCR with P1 clone DS08110 as
template and primers JG70 (GGGAATTCAGTAGCAAATCAGCAAC
GTCA) and JG71 (GGCTCGAGAAGGCGCGGAAAGTAAAATGT) and
cloned as an EcoRI XhoI fragment into pCS2 (R. Rupp, Munich,
Germany). The UAS-frs plasmid was made by transfer of frs cDNA
from pCS-frs to pUAST. For the rescue experiment, the frs genomic
region (⫺1205 to 468, ⫹1 transcription start site) was amplified from
P1 clone DS08110 by PCR (primer SV1, GGCTCGAGTACATGGTGG
TGGGGAGATG; SV8, GGATCGATAAGGCGCGGAAAGTAAAATGT,
with XhoI and ClaI sites), ligated to 3⬘HSP (cloned as a BamHI
fragment from pCasperHS in pBKS), and transfered into the XhoI
XbaI sites of pCasper4. w flies were transformed with pUAS-frs and
pCfrs-rescue by standard procedures (lines used: UAS-frsD, frs⫹ [#1,
III. chr.], frs⫹ [#19, II.chr.]). For production of recombinant protein,
the frs coding sequence and 3⬘UTR were amplified with primers
JG95 (GGGAATTCATGTCGTCGACCAATGAA) and JG71 and cloned
as an EcoRI XhoI fragment into pGEX4T (Pharmacia). Serum (36/III)
was obtained from rabbits immunized with recombinant GST-Frs
expressed in E. coli and purified with GST-frs coupled to Sepharose
(Pharmacia). The antibody was eluted with 4 M MgCl2. dsRNA was
prepared by transcription in vitro with T7 RNA polymerase (Roche,
Mannheim). The templates for frs (full length) and CG9505 (500 bp;
T. Lecuit, Marseille) were prepared by PCR with Taq DNA polymerase and included T7 promoter sites on both ends. Synthetic mRNA
with a cap and a ␤-globin leader was synthesized as described
(Großhans et al. 1999)
Microinjection of Embryos
Microinjection was performed as described (Großhans et al., 1999).
mRNA and dsRNA were injected into the posterior half of stage 2–4
embryos at a concentration of 1 mg/ml, if not otherwise indicated.
Injected embryos were fixed in 4% formaldehyde/PBS/Heptan. The
vitelline membrane was manually removed.
Acknowledgments
We thank U. Abdu, S. Bartoszewski, B. Houchmandsade, T. Lecuit,
T. Schüpbach, A. Swan, and the fly laboratories in Princeton and
Heidelberg for discussions, suggestions, or comments on the manuscript. We gratefully received materials, reagents, or fly stocks from
A. Carpenter, L. Cherbas, B. Edgar, C. Field, T. Lecuit, J. Reinitz, S.
Smolik, F. Sprenger, D. St. Johnston, the Drosophila stock center
(Bloomington, IN), and the Hybridoma bank in Iowa. We thank A.
Baum and J. Goodhouse for assistance with microscopy, Y. KusslerSchneider for technical assistance, S. Voltmer for cloning of the frs
rescue construct, and A. Frank for DNA injections. J.G. thanks the
fly laboratory in Tübingen for hospitality when having no U.S. visa.
J.G. received a long-term fellowship from the Human Science Frontier Programme. This work is supported by the Emmy Noether program of the Deutsche Forschungsgemeinschaft, the Howard
Hughes Medical Institute, and grant 5R37HD15587 from the NICHD.
Received: June 13, 2002
Revised: May 29, 2003
Accepted: May 29, 2003
Published: August 11, 2003
References
Adams, M.D., Celniker, S.E., Holt, R.A., Evans, C.A., Gocayne, J.D.,
Amanatides, P.G., Scherer, S.E., Li, P.W., Hoskins, R.A., Galle, R.F.,
et al. (2000). The genome sequence of Drosophila melanogaster.
Science 287, 2185–2195.
Alphey, L., Jimenez, J., White-Cooper, H., Dawson, I., Nurse, P., and
Glover, D.M. (1992). twine, a cdc25 homolog that functions in the
male and female germline of Drosophila. Cell 69, 977–988.
Boveri, T. (1902). Ueber mehrpolige Mitosen als Mittel zur Analyse
Developmental Cell
294
des Zellkerns. Verh. Mediz. phys. Gesellsch. Würzburg N. F. 35,
67–90.
Campos-Ortega, J.A., and Hartenstein, V. (1997). The Embryonic
Development of Drosophila melanogaster, 2nd Edition (Berlin, Heidelberg: Springer).
Edgar, B.A., and Datar, S.A. (1996). Zygotic degradation of two maternal cdc25 mRNAs terminates Dorsophila’s early cell cycle program. Genes Dev. 10, 1966–1977.
Edgar, B.A., Kiehle, C.P., and Schubiger, G. (1986). Cell cycle control
by the nucleo-cytoplasmic ratio in early Drosophila development.
Cell 44, 365–372.
Edgar, B.A., and Schubiger G. (1986). Parameters controlling transcriptional activation during early Drosophila development. Cell 44,
871–877.
Edgar, B.A., Sprenger, F., Duronio, R.J., Leopold, P., and O’Farrell,
P.H. (1994). Distinct molecular mechanisms regulate cell cycle timing at successive stages of Drosophila embryogenesis. Genes Dev.
8, 440–452.
Foe, V.F., Odell, G.M., and Edgar, B.A. (1993). Mitosis and morphogenesis in the Drosophila embryo: point and counterpoint. In The
Development of Drosphila melanogaster, M. Bate, and A. Martinez
Arias, eds. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press), pp. 149–300.
Fogarty, P., Kalpin, R.F., and Sullivan, W. (1994). The Drosophila
maternal-effect mutation grapes causes a metaphase arrest at nuclear cycle 13. Development 120, 2131–2142.
Fogarty, P., Campbell, S.D., Abu-Shumays, R., de Saint Phalle, B.,
Yu, K.R., Uy, G.L., Goldberg, M.L., and Sullivan, W. (1997). The
Drosophila grapes gene is related to checkpoint gene chk1/rad27
and is required for late syncytial division fidelity. Curr. Biol. 7,
418–426.
Großhans, J., and Wieschaus, E. (2000). A genetic link between
morphogenesis and cell division during formation of the ventral
furrow in Drosophila. Cell 101, 523–531.
Großhans, J., Schnorrer, F., and Nüsslein-Volhard, C. (1999). Oligomerisation of Tube and Pelle leads to nuclear localisation of Dorsal.
Mech. Dev. 81, 127–138.
Gutzeit, H.O. (1980). Expression of the zygotic genome in blastoderm
stage embryos of Drosophila: analysis of a specific protein. Rouxs
Arch. Dev. Biol. 188, 153–156.
Hunter, C., and Wieschaus, E. (2000). Regulated expression of nullo
is required for the formation of distinct apical and basal adherens
junctions in the Drosophila blastoderm. J. Cell Biol. 150, 391–401.
Kimelman, D., Kirschner, M., and Scherson, T. (1987). The events
of the midblastula transition in Xenopus are regulated by changes
in the cell cycle. Cell 48, 399–407.
Lecuit, T., Samanta, R., and Wieschaus, E. (2002). slam encodes
a developmental regulator of polarized membrane growth during
cleavage of the Drosophila embryo. Dev. Cell 2, 425–436.
Lindsley, D.L., and Zimm, G.G. (1992). The Genome of Drosophila
melanogaster (San Diego, CA: Academic Press).
Mata, J., Curado, S., Ephrussi, A., and Rørth, P. (2000). Tribbles
coordinates mitosis and morphogenesis in Drosophila by regulating
String/CDC25 proteolysis. Cell 101, 511–522.
Merrill, P. I, Sweeton, D., and Wieschaus, E. (1988). Requirements
for autosomal gene activity during precellular stages of Drosophila
melanogaster. Development 104, 495–509.
Newport, J., and Kirschner, M. (1982). A major developmental transition in early Xenopus embryos: I. Characterization and timing of
cellular changes at the mid-blastula stage. Cell 30, 675–686.
O’Farrell, P.H., Edgar, B.A., Lakich, D., and Lehner, C.F. (1989).
Directing cell division during development. Science 246, 635–640.
Rose, L.S., and Wieschaus, E. (1992). The Drosophila cellularization
gene nullo produces a blastoderm-specific transcript whose levels
respond to the nucleocytoplasmic ratio. Genes Dev. 6, 1255–1268.
Rose, E., Gallaher, N.M., Deborah, J.A., Goodman, R.H., and Smolik,
S.M. (1997). The CRE binding protein dCREB-A is required for Drosophila embryonic development. Genetics 146, 595–606.
Sanchez, Y., Wong, C., Thoma, R.S., Richman, R., Wu, Z., PiwnicaWorms, H., and Elledge, S.J. (1997). Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science 277, 1497–1501.
Scheijter, E.D., and Wieschaus, E. (1993). bottleneck acts as a regulator of the microfilament network governing cellularisation of the
Drosophila embryo. Cell 75, 373–385.
Schulz, R.A., and Miksch, J.L. (1989). Dorsal expression of the Drosophila z600 gene during early embryogenesis. Dev. Biol. 136,
211–221.
Schweisguth, F., Lepesant, J.A., and Vincent, A. (1990). The serendipity alpha gene encodes a membrane-associated protein required
for the cellularization of the Drosophila embryo. Genes Dev. 4,
922–931.
Seher, T.C., and Leptin, M. (2000). Tribbles, a cell-cycle brake that
coordinates proliferation and morphogenesis during Drosophila
gastrulation. Curr. Biol. 10, 623–629.
Sibon, O.C.M., Stevenson, V.A., and Theurkauf, W.E. (1997). DNAreplication checkpoint control at the Drosophila midblastula transition. Nature 388, 93–96.
Sibon, O.C.M., Laurençon, A., Hawley, R.S., and Theurkauf, W.E.
(1999). The Drosophila ATM homologue Mei-41 has an essential
checkpoint function at the midblastula transition. Curr. Biol. 9,
302–312.
Su, T.T., Campbell, S.D., and O’Farrell, P.H. (1999). Drosophila
grapes/CHK1 mutants are defective in cyclin proteolysis and coordination of mitotic events. Curr. Biol. 9, 919–922.
Walworth, N., Davey, S., and Beach, D. (1993). Fission yeast chk1
protein kinase links the rad checkpoint pathway to cdc2. Nature
363, 368–372.
Yasuda, G.K., Baker, J., and Schubiger, G. (1991). Temporal regulation of gene expression in the blastoderm Drosophila embryo. Genes
Dev. 5, 1800–1812.
Yu, K.R., Saint, R.B., and Sullivan, W. (2000). The grapes checkpoint
coordinates nuclear envelope breakdown and chromosome condensation. Nat. Cell Biol. 2, 609–615.