Download TRANSLATION Protein synthesis is the final step in the decoding

TRANSLATION
Protein synthesis is the final step in the decoding and expression of the protein-coding
information stored in nucleic acids and is the process by which the amino acid chain of a protein
(a polypeptide chain) is assembled in the correct sequence. The sequence of amino acids in a
polypeptide chain is determined by the sequence of nucleotides in an mRNA, which is itself a
copy of the nucleotide sequence of the corresponding gene. The correspondence of amino acid
sequence to nucleotide sequence follows the rules of the genetic code in which each triplet of
three consecutive nucleotides (a codon) in the mRNA encodes a particular amino acid. Decoding
of mRNA to produce a polypeptide chain is also termed translation. Translation occurs on
subcellular particles called ribosomes. Each ribosome is made up of two nonidentical subunits
(`large' and `small') each of which contains one or more rRNA molecules and different ribosomal
proteins. Several ribosomes may simultaneously translate the same mRNA molecule; such
groups of ribosomes are referred to as polyribosomes or polysomes.
In eukaryotic cells, translation occurs outside the nucleus, primarily in the cytoplasm;
proteins encoded by mitochondrial or chloroplast DNA are, however, translated in these
organelles. The essential mechanism of translation is extremely similar in all cases but there are
important differences in detail, especially between eukaryotic cytoplasmic translation on the one
hand, and translation in prokaryotes and in cellular organelles on the other. Henceforward,
`eukaryotic' will refer to translation in the cytoplasmic compartment of eukaryotic cells.
The genetic code
The genetic code is a collection of base sequences (codons) that correspond to each
amino acid and to stop signals for translation.
U
C
A
G
Proprieties of genetic cod:
(Phe)
(Ser)
(Tyr)
(Cys)
U
▬ Consists of triplets of bases (codons). A
(Phe)
(Ser)
(Tyr)
(Cys)
C
sequence of three successive bases in nucleic acid
U
(Leu)
(Ser)
STOP STOP A
specifies a particular amino acid or a translation
(Leu)
(Ser)
STOP (Trp)
G
termination signal.
(Leu)
(Pro)
(His)
(Arg)
U
▬ The genetic code contains 64 codons of which 61
(Leu)
(Pro)
(His)
(Arg)
C
C
define one or other of the 20 amino acids known in
(Leu)
(Pro)
(Gln)
(Arg)
A
proteins. The remaining three codons encode signals
(Leu)
(Pro)
(Gln)
(Arg) G
(Ile)
(Thr)
(Asn)
(Ser)
U
for the termination of translation (STOP).
(Ile)
(Thr)
(Asn)
(Ser)
C
▬ The genetic cod is universal. With the exception
A
(Ile)
(Thr)
(Lys)
(Arg)
A
of eukaryotic mitochondria, the same codon encodes
(Met)
(Thr)
(Lys)
(Arg) G
the same amino acid.
(Val)
(Ala)
(Asp) (Gly)
U
▬ The genetic cod is redundant (degenerate):
(Val)
(Ala)
(Asp) (Gly)
C
G
several codons encode the same amino acid. These
(Val)
(Ala)
(Glu) (Gly)
A
codons a called synonym.
(Val)
(Ala)
(Glu) (Gly)
G
▬ Each codon codes for a single amino acid.
▬ The genetic code is not overlapping. In
Correct
the mRNA molecule each nucleotide is a part
of a single codon.
ACCGACUUCGAUGCCAGGCACAUUUGC
▬ There is a single initiation codon –
Incorrect
AUG, which encodes for methionine.
Correct
▬ There are tree STOP codons – UAA,
UGA, UAG.
ACCGACUUCGAUGCCAGGCACAUUUGC
Incorrect
Any one of three ways a nucleotide
Genetic code is not overlapping
sequence can be read as a series of triplets.
Messenger RNAs generally contain only one translatable reading frame, which is dictated by the
Translation
position of the initiation codon ACCGACUUCGAUGCCAGGCACAUUUGC
(AUG). The reading frame that
Open reading frame
first contains initiation codon is
Coosing of open reading frame
called open reading frame.
-
The components required for translation
mRNA as template
ribosomes
tRNAs – at least 21 types
aminoacyl tRNA syntethases – 20 types
amino acids – 20 types
ATP and GTP – as sources of energy
MG2+, Ca2+ - for activation of enzymes
specific proteins – translation factors.
Eukaryotic mRNA contains information about synthesis of one type of polypeptide, so it
is monocistronic. After synthesis in nucleus, molecules of primary transcripts ate processed
(CAPing, polyandenilation, splicing), than mRNAs are transported trough nuclear pores into
cytoplasm. Each molecule of mRNA contains at 5’ end a specific site – CAP, which protects
RNA and during initiation of translation serves as site of recognition for ribosome. The sequence
between CAP and first AUG (initiation codon) is called leader sequence. The translated region
consists of exons and determines the sequence of amino acids in polypeptide. At the end of
translated sequence is located one of STOP codons: UAA, UGA or UAG. 3’ end of mRNA is
protected by Poly(A) tail (Fig. 1).
mRNA
CAP
UAA Poly(A)
AUG
5’
Leader sequence
Translated sequence
3’
Untranslated 3’
sequence
Fig. 1. Structure of eukaryotic mRNA
Prokaryotic mRNAs are resulted from transcription of an operon. This mRNA is not
processed and easily may be destroyed in cytoplasm. Prokaryotic mRNAs usually are
polycistronic and contain information about structure of many polypeptides. Synthesis of each
polypeptide begin at AUG, so every AUG preceded at a few bases by sequence Shine-Dalgarno
(5’…AGGAGG…3’) represents a signal for initiation of translation (Fig. 2).
5’
AUG
STOP
AUG
STOP
AUG
STOP
3’
Fig. 2. Structure of polycistronic prokaryotic mRNA
Different products are translated from polycistronic mRNA molecule buy the ribosomes
of prokaryotes and eukaryotes. The prokaryiotic ribosome translates all of the genes, but the
eukaryotic ribosome translates only the gene nearest the 5’ terminus of the mRNA (Fig. 3).
Fig. 3. Translation of the same mRNA using prokaryotic and eukaryotic ribosomes
2
Translation
Transfer ribonucleic acid (tRNA). Transfer RNA (tRNA) is a family of small nucleic acids that
mediate the translation of the nucleic acid
code into the amino-acid sequence of a
protein. tRNA molecules act as adaptor
molecules, which match the codon in mRNA
to its particular amino acid. They could
recognize a codon in mRNA and could also
able to bind the amino acid corresponding to
that codon. The main function of tRNAs is to
carry amino acids to the ribosomes and to
incorporate the correct amino acid into the
nascent protein chain. There are 61 types of
tRNAs, which transport 20 types of amino
acids.
tRNAs are between 74 and 90
ribonucleotides long. The secondary structure
can be written in the form of a cloverleaf.
Most of the bases are adenine (A), uracil (U),
guanine (G), and cytosine (C), but up to 10%
of the bases are modified during tRNA
Fig. 4. Secondary structure of tRNA
maturation (dihydrouridine, pseudouridine,
thymine). tRNA sequences show a very high degree of conservation, the principal feature being
the terminal CCA sequence which is present in all tRNAs.
The acceptor arm contains the 3’ and 5’ ends of the molecule. The free 2 or 3 hydroxyl
group of the terminal adenine at the 3-terminal CCA is the primary site of aminoacylation (can
be linked to an amino acid). The anticodon arm (anticodon loop) contains the anticodon base
triplet. The D arm (D loop) is named for its content of the modified base dihydrouridine. It
interacts with aminoacyl-tRNA synthetase. The Ψ arm (Ψ arm) is named after the modified
base pseudouridine. It interacts with ribosome. The extra arm is the most variable region of the
molecule. The functional significance of the extra arm is unknown (Fig. 4).
Aminoacyl tRNA synthetases are ere enzymes responsible for covalently linking amino
acids to 2’ or 3’-OH position of tRNA. There are 20 aminoacyl tRNA suntetases. These enzymes
sort the tRNAs and amino acids into corresponding sets, each synthetase recognizing a single
amino acid and all tRNAs that should be charged with it. The catalytic domain includes the
binding sites for ATP, amino acid and tRNA (Fig. 5). The reaction takes place in two steps:
I. Amino acid + ATP  Aminoacyl-AMP + P~P
II. Aminoacyl-AMP + tRNA  Aminoacyl-tRNA + AMP.
Fig. 5. An aminoacyl-tRNA synthetase charges tRNA with an amino acid
Ribosomes. A ribosome represents a large ribonucleoprotein particle which is present in
many copies in all cells and which is the site of protein synthesis. All ribosomes consist of two
subunits of unequal size, the large and small subunit, whose size and composition differ between
3
Translation
prokaryotic and eukaryotic cell, although the overall architecture is similar. Bacterial ribosomes
have a sedimentation coefficient of 70S. They are composed of a large subunit of 50S and a
small subunit of 30S. The 50S subunit is made up of 34 different proteins and the rRNAs 23S
and 5S. The 30S subunit contains 21 ribosomal proteins and a 16S rRNA.
Eukaryotic ribosomes, which occur in the cytoplasm, and in many cells are found
clustered at the cytoplasmic face of the endoplasmic reticulum, have a sedimentation coefficient
of 80S. They are composed of a large subunit of 60S and a small subunit of 40S. The large
subunit contains three rRNAs (5S, 28S, and an rRNA unique to eukaryotes, 5.8S rRNA), and 50
proteins. The small subunit contains 33 proteins and an 18S rRNA. In eukaryotes, ribosomes are
assembled in the nucleolus from rRNAs transcribed in the nucleolus and ribosomal proteins
imported from the cytoplasm. Assembled ribosomes are then exported from the nucleus to the
cytoplasm.
All ribosomes contain several active sites. The most important are:
- A-site (acceptor site), which binds with incoming aminoacyl-tRNA.
- P-site (donor site), which is occupied by peptidyl-tRNA, a tRNA carrying the
nascent polypeptide chain.
The mechanism of translation
Proteins are synthesized starting with their N termini, corresponding to translation of the
mRNA in the 5’ to 3’ direction. Translation of mRNA may be conveniently divided into three
stages: initiation, where the correct site on the mRNA for commencing translation is identified
and binding of the ribosome to the mRNA occurs; elongation, during which the coding sequence
of the mRNA directs the synthesis of the polypeptide chain; and termination, which occurs
when the ribosome encounters a stop or termination codon signaling the end of the coding
sequence of the mRNA which results in release of the completed polypeptide chain and the
ribosome from the mRNA. During the elongation stage, tRNAs carrying the appropriate amino
acid recognize the codons in mRNA by means of anticodon:tcodon interactions and thus deliver
amino acids for addition to the growing peptide chain in the correct order.
Initiation. Translation commences at an initiation codon. This is generally AUG
although other closely related codons such as GUG may also be used, especially in bacteria.
Since AUG encodes the amino acid methionine, this is the first amino acid incorporated (even
when non-AUG codons are employed). In bacteria the methionine is modified to Nformylmethionine. AUG is the only codon to code for methionine, and different tRNAs exist
for methionine as the initial amino acid (initiator tRNA) and for methionine in internal positions
within polypeptide chains. Initiation is mediated by proteins termed initiation factors.
As the AUG codon is ambiguous (it can indicate either the start of translation of the
mRNA or merely the location of methionine residues within proteins) mechanisms must exist to
distinguish between these functions. In bacteria, the initiator AUG (`start codon') is distinguished
from internal AUGs on the basis of an interaction between complementary sequences in the
rRNA of the small ribosomal subunit (16S rRNA) and a purine-rich sequence immediately
upstream of the start codon (the Shine-Dalgarno sequence) in the mRNA.
In eukaryotes no such interaction occurs. All eukaryotic cellular cytoplasmic mRNAs
have at their 5’ end a cap consisting of 7-methylguanosine triphosphate linked to the first
nucleotide of the mRNA itself by a 5’:5’-phosphodiester bond. Several eukaryotic initiation
factors can interact directly or indirectly with the cap (and are therefore termed cap-binding
proteins). They are believed to mediate the unwinding of regions of secondary structure within
the 5’-leader region of the mRNA, which interfere with initiation. The ribosome binds to the
mRNA and scans along the mRNA in a 5’→3’ direction to locate the start AUG codon:
translation in eukaryotes generally starts at the first AUG from the 5’-end.
There are some steps during initiation of translation (Fig. 6):
- Binding of methionine to tRNAMet;
4
Translation
-
Activation of GTP to methionyl-tRNAMet complex;
Binding of methionyl-tRNAMet-GTP complex to P-site of small ribosomal subunit;
Attaching of this complex to mRNA;
Moving into 3’ direction and recognition of AUG; An ATP is used as energy;
Adding of large subunit.
Fig. 6. Initiation of translation
Elongation. This process is essentially identical in all organisms. Immediately after
initiation, the ribosomal P-site is occupied by the initiator methionyl-tRNA and the next codon is
aligned with the vacant ribosomal A (aminoacyl)-site. Entry of the correct cognate aminoacyltRNA (whose anticodon matches the codon in the A-site) is mediated by an elongation factor,
associated with GTP. Formation of the peptide bond between the methionine moiety of
methionyl-tRNA and the amino acid carried by the incoming aminoacyl-tRNA then follows,
catalysed by the peptidyltransferase activity associated with the large ribosomal subunit. The
GTP is also hydrolysed to GDP and Pi. The second elongation factor then mediates the
translocation step in which the spent tRNA leaves the P-site, the peptidyl-tRNA moves from the
A- to the P-site and the ribosome moves by the equivalent of one codon (three nucleotides)
relative to the mRNA to align the next codon with the A-site. This step is also associated with
GTP hydrolysis. Peptide-chain elongation consists of repetitive cycles of this elongation process,
the nascent chain being extended by one amino acid residue at each cycle (Fig. 7).
Termination occurs when the translating ribosome encounters a termination or stop
codon (UAA, UAG or UGA). Since no tRNA exists to decode such codons, elongation ceases.
The termination process involves release of the now complete polypeptide chain, the final tRNA
and the ribosomal subunits, which are then free to participate once more in mRNA translation.
This process requires proteins termed release factors (Fig. 8).
Post-translational events. The polypeptide chain released from the ribosome is not
necessarily the final functional form of the protein, and it may undergo post-translational
modification(s) (e.g. limited proteolysis, glycosylation, phosphorylation), assembly into a larger
multisubunit protein (or other macromolecular assemblies) or translocation to other sites in the
cell (e.g. to organelles, or through the secretory pathway).
5
Translation
Fig. 7. Elongation of translation
Fig. 8. Termination of translation
Antibiotic inhibitors of translation. A number of antibiotics and other agents inhibit
mRNA translation usually by interacting with ribosomes and impairing specific steps in the
process. These compounds include chloramphenicol, cycloheximide, erythromycin, puromycin,
streptomycin and tetracycline. Such agents have proven extremely useful as (for example)
antibacterial agents owing to the selectivity for bacterial (70S) ribosomes rather than eukaryotic
(80S) ribosomes, or to their selective entry into bacterial cells.
6