Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Protein phosphorylation wikipedia , lookup
Cell nucleus wikipedia , lookup
List of types of proteins wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Protein structure prediction wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Activating Strategy • Think – Pair - Share – Explain why RNA splicing in eukaryotic cells is similar to editing a video. What is the code? • Code for ALL life! – strongest support for a common origin for all life • Code is redundant – several codons for each amino acid – 3rd base “wobble” • Start codon intron = noncoding (inbetween) sequence eukaryotic DNA – AUG – methionine • Stop codons exon = coding (expressed) sequence – UGA, UAA, UAG What is needed to read the code? AP Lesson #51 EQ: How is the message from mature mRNA translated into the proteins? • tRNA (transfer RNA) – Carries amino acids – Translates mRNA (reads) • Ribosomes – Facilitate coupling of tRNA anticodon to mRNA codon E P A How does a cell know what mRNA means? How are the codons matched to amino acids? • tRNA has a “Clover leaf” structure – anticodon on “clover leaf” end • Complementary to mRNA codon DNA TACGCACATTTACGTACGCGG Transcription codon mRNA AUGCGUGUAAAUGCAUGCGCC Translation protein ? Met Arg Val Asn Ala Cys Ala – amino acid attached on 3′ end How does tRNA get its Amino Acids? What is next for the polypeptide? • Aminoacyl tRNA synthetase – enzyme which bonds amino acid to tRNA – bond requires energy = ATP → AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O ■ ■ ■ ■ – Sequence of amino acids that are recognized by Signal-Recognition Particle – SRP delivers the growing polypeptide to where it will be used by the cell ■ secretion nucleus mitochondria chloroplasts cell membrane cytoplasm O activating enzyme tRNATrp tryptophan attached to tRNATrp AC C UGG =O C H2O O anticodon ■ Trp Trp C=O OH OH Destinations: • Interactions among amino acids give the protein its 2nd & 3rd structure and can be modified (ex. carb chains) • Signal Peptides mRNA tRNATrp binds to UGG condon of mRNA What are ribosomes? Summarizing Strategy • Ribosomal RNA (rRNA) & proteins • Complete this graphic organizer Definition – 2 subunits (large & small) Characteristics • A site (aminoacyl-tRNA site) – holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) Translation Examples – holds tRNA carrying growing polypeptide chain Non-Examples • E site (exit site) – empty tRNA leaves ribosome from exit site E P A So how does the ribosome build a protein? Assessment • DNA to Protein Essay • Can you tell the story? • Initiation – brings together mRNA, ribosome subunits, initiator tRNA (Met), read from 5’ 3’ – In an detailed essay, describe the complete process in the figure below – While explaining, be sure to use correct vocabulary and definitions. – Take me through the process the picture shows • Elongation – tRNA brings amino acids based on codon sequence, amino acids form peptide bonds – requires energy from GTP • Termination 3 2 1 – Reach a stop codon, polypeptide is released Leu Val Met Met Met Met Leu release factor Ser Ala Leu Leu A C tRNA G U A C U G AA U 5' C mRNA A U G 3' E P A 5' UA C G AC AU G CU GAA U 5' 3' U A C GA C AU G C UG AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A • Essay is Due on Thursday – 20 point quiz grade Trp 3'