* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Open full article - About the Conference MendelNet 2016
SNP genotyping wikipedia , lookup
Microevolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Helitron (biology) wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
MENDELNET 2016 PROGRESS IN EARLY SEX DETERMINATION OF CANNABIS PLANT BY DNA MARKERS PETER MENDEL1, AJINKYA BHARAT LALGE1, TOMAS VYHNANEK1, VACLAV TROJAN1, PETR KALOUSEK1, HUGO MAASSEN2, LADISLAV HAVEL1 1 Department of Plant Biology Mendel University in Brno Zemedelska 1, 613 00 Brno CZECH REPUBLIC 2 Department of Phyto Engineering Bedrocan International 2009, 9640 CA Veendam NETHERLANDS [email protected] Abstract: The cannabis plant is a tall annual crop of economic importance. It is mostly dioecious, but fiber hemp varieties have been bred to be monoecious. Separating male and female plants at early developmental stage is useful due to the influence of gender at agriculturally significant traits. Several experiments have been focused on developing a reliable molecular marker for sex determination in cannabis plants. Our study compares three DNA markers for the detection of male genotype in totally twelve samples of industrial hemp and medicinal cannabis plants. Genotype scoring of SCAR119 marker appeared to be the most reliable, followed by MADC2 and SCAR323, when compared to the observed phenotype of plants. The results confirmed the insights given in previous studies. Research and Polymerase Chain Reaction (PCR) analysis should continue in order to find more advanced DNA markers for sex determination of cannabis plants. Key Words: cannabis, sex determination, DNA markers INTRODUCTION Cannabis (Cannabis sativa L.) is a tall upright annual herb. It is generally dioecious i.e. producing separate male and female plants but fiber hemp varieties have been specifically bred to be monoecious (hermaphrodite) (Debruyne et al. 1994, Srivastava and Yadav 2013). The sex of most dioecious plants can only (reliably) be determined at the time of flowering. The significance of separating male and female plants at seedling stage lies in the fact that in many dioecious plants gender influences the economic value, breeding schemes and opportunities for commercial use of genetically modified materials (Parker and Clark 1991). The discussed demand for tools supporting sex determination in plants gave rise to a series of molecular studies investigating DNA markers that could be used for that purpose. A molecular marker (DNA marker) is a DNA sequence observed in at least two versions that are easy to distinguish (Brown 2002), which reveals individual polymorphisms. The preferred marker should demonstrate the widest possible range of variation in the analyzed trait, and it should not be affected by environmental factors. An effective marker should guarantee reproducibility, and it should be easy to detect. Molecular markers facilitate analyzes of variations between individuals, regardless of their development stage (SztubaSolińska 2005), which is particularly useful in sex determination studies of plants. Some researchers have suggested that effective markers for plants should be relatively short to support sex determinations in herbarium specimens with damaged DNA. Shorter sequences increase the probability of successful amplification (Korpelainen et al. 2008). This study is focused on testing the reliability and reproducibility of three developed molecular markers linked to male sex in the cannabis plant (Cannabis sativa L.). Standard technical hemp varieties, as well as medicinal ones were included. 731 | P a g e MENDELNET 2016 MATERIAL AND METHODS DNA isolation and samples used Four well known varieties of industrial hemp and six experimental varieties of medicinal cannabis were included in this experiment (Table 1). The medicinal cannabis samples were all provided by Bedrocan International in form of DNA. For the variety Bialobrezskie, three plants from an experiment, where plants were treated with phytohormones were selected: a NAA (naphtylacetic acid) – auxin analogue variant, a BAP (benzylaminopurine) – cytokinin analogue variant and an untreated control group. Chemicals were applied every two weeks by spraying it on the leaves in six different doses, each for different group: 5, 10 and 20 mg/l for NAA and 10, 25 and 50 mg/l for BAP. After 11 weeks of application, one plant from the most concentrated auxin group as well as one from highest cytokinin dosing, showed male flowering structures. DNA was isolated from these two plants as well as from one plant of the untreated control group. These three plants were included in the sex determination experiment. Total genomic DNA was isolated from 0.1 g of fresh leaves homogenized by mortar and pestle and liquid nitrogen. A DNeasy Plant Mini Kit (Quiagen) was used for the isolation process. Concentration and purity of isolated DNA was measured using Picopet 1.0 spectrophotometer (Picodrop). Table 1 Overview of used samples Sample Variety/ genotype marking CAR Carmagnola Material Source/ provider seeds Hempoint Ltd. KHT Kompolti Hybrid TC leaves Hempoint Ltd. UNI Unikó leaves Hempoint Ltd. B-C Bialobrezskie leaves Hempoint Ltd./ untreated control B-M1 Bialobrezskie leaves male plant treated with 20 mg/l NAA B-M2 Bialobrezskie leaves male plant treated with 50 mg/l BAP BK1 medicinal cannabis (unspecified) medicinal cannabis (unspecified) medicinal cannabis (unspecified) medicinal cannabis (unspecified) medicinal cannabis (unspecified) medicinal cannabis (unspecified) DNA Bedrocan International DNA Bedrocan International DNA Bedrocan International DNA Bedrocan International DNA Bedrocan International DNA Bedrocan International BK4 BK5 BK7 BK8 BK9 PCR conditions Three different primer pairs for sex determination were tested (Table 2). The first two markers (SCAR – sequence-characterized amplified region) were developed from RAPD primers by Tӧrjék et al. (2002), the other marker (MADC – male-associated DNA from Cannabis sativa) is based on the research of Mandolino et al. (1999). PCR was performed in a total volume of 25 μl consisting of 0.5 U Taq polymerase (Promega), 1˟ aliquot buffer, 0.1 mM of each dNTP(Promega), 0.3 M of each primer and 20 ng of template DNA in a T3 thermocycler (Biometra) for the SCAR markers and gradient thermal cycler QB-96 (Quanta 732 | P a g e MENDELNET 2016 Biotech) for the MADC marker. We used the same PCR protocols as the aforementioned authors, without any further optimization for the SCAR (Tӧrjék et al. 2002) and the MADC (Mandolino et al. 1999) markers. Electrophoresis was performed in a 1.5 % agarose gel on a Blue Marine 200 apparatus (Serva), with Tris-acetate-EDTA buffer (TAE) and ethidium-bromide used for for staining. The presence and size of PCR products was visualized by using a UV transluminator and VisionCapt software (Vilber Lourmat). Table 2 Primers used for sex determination Marker name Amplification product Primer sequence 5’-3’ SCAR119_F SCAR119_R SCAR323_F SCAR323_R MADC2_F MADC2_R male sex linked DNA (119 bp) male sex linked DNA (323 bp) male sex linked DNA (390 bp) TCAAACAACAACAAACCG GAGGCCGATAATTGACTG GAGCGGACATCATTGCCT ATCACCCCACCGTTTAGG GTGACGTAGGTAGAGTTGAA GTGACGTAGGCTATGAGAG RESULTS AND DISCUSSION MADC marker amplification products Total genomic DNA of all twelve cannabis plant samples was amplified by specific primers. A single DNA band of size about 390 bp was expected for all putative male plants, while all female and monoecious plants were expected to have two products of about 560 and 870 bp. This appeared to be the case with ten of the samples, two deviations – in the case of Carmagnola and Kompolti Hybrid TC have possible explanations (Figure 1). Figure 1 Visualisation of PCR products for sex determination of cannabis varieties (MADC2 marker) SM CAR KHT UNI B-C B-M1 B-M2 BK1 BK4 BK5 BK7 BK8 BK9 SM Legend: SM – 100 bp size marker, CAR – Carmagnola, KHT – Kompolti Hybrid TC, UNI – Unikó, B-C – Bialobrezskie monoecious control, B-M1 – Bialobrezskie male plant treated with NAA, B-M2 – Bialobrezskie male plant treated with BAP, BK1, BK4, BK5, BK7, BK8, BK9 – unknown genotypes of medicinal cannabis (Phyto Engineering Department, Bedrocan International) As mentioned by Mandolino et al. (1999), MADC2 is probably a non-coding genome region and it is not confirmed whether the sequence is a part of the genes for sex determination. Most likely, it is not located solely on the male chromosome, as in previous studies MADC2 failed to discriminate sex phenotype in some cases (Sakamoto et al. 1995). Our results support this hypothesis, as the first two samples should be phenotypically female/ monoecious, but show products supposedly corresponding to the male genotype. In addition, DNA of the first variety (Carmagnola) was isolated from seeds. Sex 733 | P a g e MENDELNET 2016 determination in cannabis is complex and can even be reversed or modified by chemical treatment and environmental factors (Chailakhyan 1979, Mohan Ram and Sett 1979). At the same time, male flowers are able to develop on female plants under extreme conditions (Clarke 1997). BK8, although being a medicinal cannabis plant, was observed to form male flowering structures and was, based on the examination of the plant morphology, classified as a male and possibly dioecious plant. This theory can help us explain the fact, that during our experiment with phytohormones two unexpected staminate plants with male phenotypes appeared (they produced a lot of pollen), while the used variety Bialobrezskie is normally monoecious, as stated in a list (2014) by the Czech Central Institute for Supervising and Testing in Agriculture. Two slightly visible bands of higher molecular weight can be seen on the gel (Figure 1) in case of the second male plant. This suggests some gradual development from a previously monoecious plant. Another hypothesis is genetic recombination between the sex locus and the marker, on which both authors (Mandolino et al. 1999, Tӧrjék et al. 2002) - speculated. The research group of Techen et al. (2010) was dealing with sex determination of cannabis and certain types of MADC and SCAR markers as well, being able to reliably identify female individuals in all cases. However, the experiment was carried out in very early seedling stage and it is not exactly known whether they included monoecious plants, in which stage of onthogenesis the development of male phenotype really begins and what mechanisms are underlying it. Comparison with SCAR markers The same set and order of DNA samples (Table 1) was used to test the SCAR markers. In case of SCAR119, our sex determination results seem to be generally in accordance with MADC2 and with the information from Tӧrjék et al. (2002) – that male plants are presented with single band of 119 or 323 bp (for SCAR323). And while some female plants may show the same product as well, it is much less intensive. This, however, appeared to be in contrast with our results for SCAR323 – the high intensity for male might be corresponding in case of Carmagnola seeds, previously mentioned BK8 and two phenotypic males (B-M1, B-M2), but there was still quite a robust product of 323 bp in the case of the monoecious Bialobrezskie plant (B-C) and some of the medicinal genotypes (BK4 and BK7). An overall evaluation of phenotype versus genotype scoring of all varieties and DNA markers used in this study is shown in Figure 2. Figure 2 Final comparison of DNA markers results for all varieties Legend: - plant with female phenotype, - plant with male phenotype, - monoecious plant, GREEN colour – sample with genotype scoring in accordance to phenotype, RED colour – samples with incorrect genotype indication CONCLUSION Three molecular markers were tested for their ability to detect male plants in cannabis. DNA material of various origin was used, twelve different varieties of cannabis plants in total. The SCAR119 marker appeared to be the most reliable, with genotype scoring results corresponding to phenotype in case of all twelve samples. The MADC2 marker showed only one 734 | P a g e MENDELNET 2016 contradictive sample result. The SCAR323 marker appeared to be the most controversial, with three deviant results. This study confirmed that sex determination of the cannabis plant is a complex process, for which further research is needed to develop a reliable molecular tool to distinguish male and female plants at an early developmental stage. ACKNOWLEDGEMENTS The research was financially supported by the IGA FA MENDELU No. IP 2/2016. All authors thank to Hana Gabrielová and Hugo Maassen for providing research material and cooperation, and to Peter van Peer for grammar correction. REFERENCES Brown, T.A., 2002. Genomes. [Online]. Manchester, UK: UMIST. ISBN-10: 0-471-25046-5. Available at: https://www.scribd.com/doc/12279173/Genomy-2001-Brown-T-A [2016-09-14]. Chailakhyan, M.K., 1979. Genetic and hormonal regulation of growth, flowering and sex expresion in plants. American Journal of Botany 66(6): 717–736. Clarke, R.K. 1997. Hanf: Botanik, Anbau Vermehrung und Züchtung. Aarau, Schweiz: AT Verlag. Debruyne, D., Albessard, F., Bigot, M.C., Moulin, M. 1994. Comparison of three advanced chromatographic techniques for cannabis identification. Bulletin on Narcotics, 46(2): 109–121. Korpelainen, H., Bisang, I., Hedenäs, L., Kolehmainen, J. 2008. The first sex-specific molecular marker discovered in the moss Pseudocalliergon trifarium. Journal of Heredity, 99(6): 581–587 Mandolino, G., Carboni, A., Forapani, S., Faeti, V., Ranalli, P. 1999. Identification of DNA markers linked to the male sex in dioecious hemp (Cannabis sativa L.). Theoretical and Applied Genetics, 98(1): 86–92. Mohan Ram, H.Y., Sett, R.1979. Sex reversal in the female plants of Cannabis sativa by cobalt ions. Proceedings of the Indian Academy of Sciences, 88(4): 303–308. Parker, J.S., Clark, M.S. 1991. Dosage sex-chromosome systems in plants. Plant Science, 80(1-2): 79– 92. Sakamoto, K., Shimomura, K., Komeda, H., Satoh, S. 1995. A male associated DNA sequence in a dioecious plant, Cannabis sativa L. Plant and Cell Physiology, 36(8): 1549–1554. Srivastava, A., Yadav, V. K. 2013. Microscopical and chemical study of Cannabis sativa. Journal of Forensic Research, 5(1):210. Sztuba-Solińska, J. 2005. Molecular markers systems and their application in plant breeding. Kosmos, 54 (2-3): 227–239. Techen, N., Chandra, S., Lata, H., Elsohly, M.A., Khan, I.A. 2010. Genetic identification of female Cannabis sativa plants at early developmental stage. Planta Medica, 76 (16): 1938–1939. Tӧrjék, O., Bucherna, N., Kiss, E., Homoki, H., Finta-Korpelová, Z., Bócsa, I., Nagy, I., Heszky, L.E. 2002. Novel male-specific molecular markers (MADC5, MADC6) in hemp. Euphytica, 127(2): 209– 218. 735 | P a g e