* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download the law of dominance
Therapeutic gene modulation wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Hybrid (biology) wikipedia , lookup
Human genetic variation wikipedia , lookup
Gene expression programming wikipedia , lookup
Transgenerational epigenetic inheritance wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Heritability of IQ wikipedia , lookup
X-inactivation wikipedia , lookup
Genetic drift wikipedia , lookup
Genetic engineering wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Frameshift mutation wikipedia , lookup
Genome (book) wikipedia , lookup
Designer baby wikipedia , lookup
Point mutation wikipedia , lookup
Population genetics wikipedia , lookup
1. A population of grass is spreading out of control in southern California. A scientist studying this grass is trying to determine if the population is evolving and if the grass is likely to slow its spread as time passes. She determines that traits found in the current generation of grass individuals (size, seed number, etc) are predictably passed to offspring generations. Grass individuals with higher seed numbers have more surviving offspring in the following generation. Genetic studies indicate that all the grass individuals tested are genetically identical. Is evolution occurring in this grass? A No, because traits are not heritable for this species. B Yes, because the grass is spreading so quickly. C Yes, because certain traits (like high seed set) lead to increased reproduction. D No, because there is no genetic variation in the population. E You cannot tell until multiple generations have passed. 2. The wings of an ostrich, the pelvis of the whale, and the human appendix are all examples of: A mutations. B analogous structures. C homologous structures. D acquired structures. E vestigial structures. 3. When Mendel crossed dark purple-flowered pea plants with white-flowered pea plants, he never got any pea plants with light purple flowers. This is counter to the… A …theory of blending inheritance. B …idea of acquired characteristic inheritance. C …the laws of probability. D …the assumption of direct transmission of traits. E …the law of dominance. Name_________________________ 4. Recombination… A …decreases the chromosome number from diploid to haploid. B… is the source of new genes. C …is responsible for novel gene combinations. D …only happens in mitosis. E …is the only difference between mitosis and meiosis. 5. The greyhound was originally used to hunt the fastest of game - fox and deer. Early breeders were, unsurprisingly, interested in dogs with the greatest speed. They carefully selected hounds who ran the fastest. From their offspring, the greyhound breeders again selected those dogs who ran the fastest. By continuing this selection of dogs who ran faster than most of the hound dog population, they gradually produced a dog who could run up to 40mph. The above is a description of: A Natural selection B Stabilizing selection C Disruptive selection D Directional selection E Genetic drift 6. Using the table on the back page, if necessary, translate the following RNA sequence: AUGACACCCCAGAGGGGAAGUUAG A Methionine, Threonine, Proline, Histidine, Serine, Glycine, Arginine, STOP B Methionine, Threonine, Proline, Glutamine, Arginine, Glycine, Serine, STOP C Methionine, Threonine, Proline, Glutamine, Serine, Aspartate, Serine, Tyrosine D Leucine, Serine, Histidine, Glycine, Serine, Glycine, Arginine, STOP E Leucine, Serine, Histidine, Glycine, Serine, Glycine, Arginine, Tyrosine Page Total ____________ 2 Name_________________________ 7. Which of the following could be the ploidy level of an aneuploid human? A 40 B 46 C 47 D 24 E 23 8. The following table is the raw data from a dihybrid cross on mice. Phenotype Number of F2s counted Black fur, small ears 54 Black fur, large ears 18 Grey fur, small ears 18 Grey fur, large ears 9 What is the ratio of these F2s? A 9:3:3:1 B 6:2:2:1 C 5:4:4:1 D 3:1 E 1:2:1 Page Total ____________ 3 Name_________________________ 9. A strong band of storms move through the American Midwest. During these storms there are many tornados. During one of the tornados, a bluebird mother and her nest full of eggs are transported from one forest to another. Amazingly, the nest is gently set down in a tree and the eggs are unharmed. The baby birds hatch soon after and are raised in this new forest which has many other bluebirds. These babies eventually mate with individuals that were laid in that forest. This is an example of: A Genetic drift B Gene flow C Natural selection D Non-random mating E Mutation 10. What sort of mutation is this? Original sequence: AUUCAUCCU Mutated sequence: AUCCAUCCU A Silent mutation B Missense mutation C Nonsense mutation D Frameshift mutation E Chromosomal inversion Page Total ____________ 4 Name_________________________ 11. Giraffes vary in terms of neck length, with the tallest giraffes having more offspring than giraffes with shorter necks. Over the course of their lives, long necked giraffes have an average of 4 young, while short necked giraffes have an average of 2 young. What are the relative fitnesses of these two types of giraffes? A Long necked = 1, short necked = .5 B Long necked = .5, short necked = 1 C Long necked = 4, short necked = 2 D Long necked = 8, short necked = 4 E Long necked = .5, short necked = .5 12. The genetic material of which of the following organism’s cells is all found in a single, circular molecule of DNA? A mushroom B snapdragon C E. coli D carpenter ant E all eukaryotes 13. Which of the following was not one of the beliefs of Darwin's time? A The world is fixed and constant. B Species were unchangeable over the course of time. C Operation of natural laws produces constant change and improvement. D The Earth is several thousand years old. E Various organisms and their structures resulted from a divine creator's actions. Page Total ____________ 5 Name_________________________ 14. Which of the following is NOT true of all living cells? A They all have cytosol. B They all have genetic material. C They all have plasma membranes. D They all have proteins. E They all have organelles. 15. For this question brown eyes = B, dominant and blue eyes = b, recessive. Suppose two parents had 11 children, 6 with blue eyes and 5 with brown. Which of the below is the BEST guess of the parents genotypes? A Both parents had brown eyes B Both parents had blue eyes C One parent had blue and the other was homozygous dominant D One parent had blue and the other was heterozygous E Both parents were heterozygous 16. If one strand of DNA reads ACTCCGTACC, what does the other read? A ACTCCGTACC B GCATGGTGAG C CAGAATGCAA D GTCTTACGTT E TGAGGCATGG Page Total ____________ 6 Name_________________________ 17. The Northern Elephant Seal lives and breeds off the coast of California. Though there are now tens of thousands of elephant seals, there was a time when they were hunted nearly to extinction. Which of the following do you expect to be true about elephant seals now? A They have very low genetic diversity because of the bottleneck event they went through. B They now mate assortatively to increase their numbers. C They have very low rates of mutation because they went through a bottleneck event. D There is insignificant gene flow because they all breed off the coast of one state. E They are highly selected for foraging ability. 18. Given the sentence "THE FAT CAT ATE THE RED RAT," which of the following would represent a frameshift mutation? A THE FAT CAT ATE THE RED RAT B THE CAT ATE THE RED RAT C THE FAT RAT ATE THE RED RAT D THE FAC ATA TET HER EDR AT. E THE FAT CAT ATE THE RED MAT Page Total ____________ 7 Name_________________________ 19. Phenotype Average lifetime number of offspring Average leaf width of offspring Percent of population in year 1 Percent of population in year 4 Broad leaves (> 6 cm) 1046 6.4 cm .46 .49 Average leaves (3-6 cm) 910 4.2 cm .15 .09 Narrow leaves (< 3 cm) 1142 2.6 cm .39 .42 What sort of selection is occurring in the plants represented in the above table? A Stabilizing B Disruptive C Directional D Artificial E None, the leaf width is not heritable. 20. Which of the following is the RNA transcript of this DNA sequence? TTGACCATGAC A AACUGGUACUG B UUGACCAUGAC C TTUACCATUAC D AACTGGTACTG E TTGACCATGAC Page Total ____________ 8 Name_________________________ 21. You are closely studying a new species of flowering plant. After doing repeated crosses you discover that plants with thin leaves always have yellow flowers, while plants with broad leaves always have white flowers. What do you know? A There is incomplete dominance for flower color. B The gene for flower color is pleiotropic. C The genes for flower color and leaf width are epistatic. D The genes for flower color and leaf width are close together on the same chromosome. E Your greenhouse environment is affecting the expression of these alleles. 22. In the case of the toothed whales, the fossil record… A has no evidence about how they evolved B shows they evolved from a land mammal with hooves C shows they evolved from swimming dinosaurs D shows they evolved from fish E has fragmentary evidence that cannot be explained. 23. Which of the following is the correct written form of the scientific name for the Cottontopped Tamarin? A Saguinus Oedipus B Saguinus Oedipus C Saguinus oedipus D SAGUINUS Oedipus E Saguinus oedipus Page Total ____________ 9 Name_________________________ 24. You find a yellow Labrador with a brown nose. What is its genotype? A E_B_ B eeB_ C E_bb D eebb E You can’t know without seeing at least one of its parents. 25. Looking at the cytochrome c amino acid sequence of a human and comparing it to the sequence for a gorilla, a chameleon, and a cactus, which of the following columns is the MOST LIKELY number of differences observed? A B C D E 16 60 1 15 5 Chameleon 4 30 15 30 5 Cactus 1 30 100 5 Gorilla 4 Page Total ____________ 10 Name_________________________ Free Response (25 pts) 1. (5 points) Fill in the name of the person who made each contribution in the table below. (.5 each, last name is all that matters) Person Contribution Gregor Mendel Determines initial laws of inheritance Georges Cuvier Determined that some animals have gone extinct James Watson and Francis Crick Discovered the structure of DNA Alfred Russell Wallace Co-discovers natural selection Adam Smith Introduces the idea that a natural force can direct guide a seemingly chaotic process Charles Lyell Natural processes operating in the past are the same as those we can observe operating in the present. James Hutton Proposes that natural processes slowly shape geological structures Thomas Malthus Introduces the idea that populations breed faster than their food sources can grow Carolus Linnaeus Classifies living organisms into a hierarchical structure Jean-Baptiste Lamarck Proposes first full theory of evolutionary change Page Total ____________ 11 Name_________________________ 2. (3 points) You decide to cross two plants which both have solid green leaves. 75% of the offspring have solid green leaves and 25% have variegated (green and white) leaves. If leaf color is genetically controlled and denoted with the letters G and g… What are the genotypes of the two parent plants? (2pts) Both are Gg This is one stage of a monohybrid cross. Given what you know what generation of the cross are the parents most likely from? (1 pt) F1 3. (2 points) In peonies (a flowering plant) red petal color is dominant to white petal color. If you have a white flower of unknown parentage what is the best way to determine its genotype (one sentence)? (Full credit for something like the below, 1 point for test cross) You already know it - white must be homozygous recessive. 4. (4 points) Explain the difference between sister chromatids and a homologous pair. (2 pts for each definition) Sister chromatids are identical (replicated) copies of a single chromosome. A homologous pair is a pair of chromosomes of the same type, one from each of your parents. 5. (1 point) Why can several RNA sequences code for the same amino acid sequence (one sentence or less)? Because the code is degenerate. OR Because each amino acid is coded by multiple RNA sequences. Page Total ____________ 12 Name_________________________ 6. (7 points) For the following question we are tracking two traits: Hair texture: Curly = CC, Wavy = Cc, Straight = cc Freckles: Freckled = FF, no freckles = ff Mom has wavy hair and has freckles (homozygous). Dad has straight hair and is not freckled. What are mom and Dad’s genotypes? (1 pt each, no partial credit) Mom: CcFF Dad: ccff Fill in the below Punnett square. (2 points for the gamete types, 2 points for the filling in the correct crosses – if they filled in the wrong gamete types grade the crosses on what they filled in) Gamete genotypes cf cf cf cf CF CcFf CcFf CcFf CcFf CF CcFf CcFf CcFf CcFf cf ccFf ccFf ccFf ccFf cf ccFf ccFf ccFf ccFf Which trait will all of the offspring from this cross will have? Freckles Page Total ____________ 13 Name_________________________ 7. (3 points) What is the above diagram called? (.5 pt) Karyotype What is the sex of the above individual? (.5 pt) Female How would you need to modify this diagram to show a non-disjunction event? (one sentence) (1 pt – full credit for add OR remove OR both) You would need to add a chromosome to one of the pairs or remove a chromosome. Circle a likely place for such a modification to occur. (1 pt) Circles around pairs (or numbers) 13, 15, 18, 21, 22 or the sex chromosomes get full credit, circles around 14, 16, 17, 19, or 20 get half) Page Total ____________ 14 Name_________________________ Extra credit questions (Answer as many as you can for up to two points of extra credit): 1. What medication may have been behind Van Gogh’s sytle of painting? Digitalis 2. Fossils of an animal named Unenlagia that lived in Argentina around 60 million years ago may be the missing link between: Dinosaurs and birds 3. Where did American Wooly Mammoths go extinct? Asia 4. What type of organisms are now thought to have dominated during the last part of the Triassic period? Crocodilians OR crurotarsans OR ancestors of crocodiles/alligators 5. Why do male owls sing more at dusk than later at night? To prove to females that they can sing on an empty stomach. Page Total ____________ 15