Download Page 1 of 27 Functionally distinct subsets of human

From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Blood First Edition Paper, prepublished online March 21, 2012; DOI 10.1182/blood-2011-11-392324
Functionally distinct subsets of human FOXP3+ Treg cells that phenotypically mirror
effector TH cells
Thomas Duhen1, Rebekka Duhen1, Antonio Lanzavecchia2, Federica Sallusto2 and Daniel J
Campbell1,3.
1
Benaroya Research Institute, 1201 9th Ave, Seattle, WA 98101, USA; 2Institute for Research in
Biomedicine, Via Vincenzo Vela 6, CH-6500 Bellinzona, Switzerland; 3Department of
Immunology, University of Washington School of Medicine, Seattle WA 98195, USA.
Address correspondence to:
Daniel J. Campbell, Benaroya Research Institute, 1201 9th Ave, Seattle, WA 98101, USA; Tel:
206-287-1055; Fax: 206-223-7543; e-mail: [email protected].
Running title: Human FOXP3+ Treg cell subsets
Scientific category: Immunobiology
Page 1 of 27
Copyright © 2012 American Society of Hematology
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Abstract
FOXP3+ regulatory T (Treg) cells are a broadly acting and potent anti-inflammatory
population of CD4+ T cells essential for maintaining immune homeostasis and preventing
debilitating autoimmunity. Based on chemokine receptor expression, we identified distinct
populations of Treg cells in human blood expected to co-localize with different helper T (TH) cell
subsets. Although each population was functionally suppressive, they displayed unique patterns of
pro- and anti-inflammatory cytokine production, differentially expressed lineage-specifying
transcription factors, and responded differently to antigens associated with TH1 and TH17
responses. These results highlight a previously unappreciated degree of phenotypic and functional
diversity in human Treg cells that allows subsets with unique specificities and immunomodulatory
functions to be targeted to defined immune environments during different types of inflammatory
responses.
Page 2 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Introduction
The quality of the immune response against a given pathogen depends on the function of
antigen-specific CD4+ effector T cells. As the mechanisms used to eliminate or control different
types of pathogens can vary widely, it is not surprising that these effector T cells are functionally
heterogeneous, and can be divided into distinct subsets defined by the cytokines they produce and
the transcription factors essential for their differentiation1. Thus, IFN-γ-producing T helper type 1
(TH1) cells require the lineage-specifying transcription factor T-bet for their differentiation and
help eliminate intracellular pathogens, whereas IL-4-producing TH2 cells express the transcription
factor GATA-3 and help expel large extracellular parasites. Likewise, the transcription factors
RORγt and RORα are necessary for the development of IL-17-producing TH17 cells that mediate
responses to extracellular bacteria and fungi, whereas recently described IL-22-producing TH22
cells are targeted to the skin and may contribute to skin homeostasis and inflammation2-4.
In addition to the cytokines they produce, effector T cells can be distinguished by their
differential expression of chemokine receptors that direct them to distinct inflammatory
environments. For example, TH1 cells express CXCR35,6, whereas TH17 cells express the
chemokine receptors CCR6 and CCR47-9, which together promote their migration to inflamed
tissues during TH17-mediated autoimmunity10. Moreover, IFN-γ induces expression of the CXCR3
ligands CXCL9, CXCL10 and CXCL11, and expression of the CCR6 ligand CCL20 is induced by
IL-1711. Thus, these chemokine receptors are thought to function in positive feedback loops to
amplify and segregate TH1 and TH17 cell migration during specific inflammatory responses. More
recently, IL-22-producing TH22 cells have been identified, and these express the cutaneous
lymphocyte antigen (CLA), a functional E-selectin ligand involved in lymphocyte rolling on the
endothelial cells of cutaneous post-capillary venules, along with the chemokine receptors CCR6,
CCR4 and CCR10, which together facilitate the constitutive migration of these cells to the skin2.
Page 3 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Several mechanisms have evolved to restrain CD4+ T cell responses in order to avoid
unwanted tissue destruction, immunopathology and autoimmunity. Among these, CD4+ regulatory
T (Treg) cells are characterized by their ability to inhibit T cell proliferation in vitro, and by their
constitutive expression of the IL-2 receptor component CD25. Highlighting their essential function
in maintaining immune tolerance in vivo, the absence or depletion of Treg cells causes severe
autoimmune and inflammatory disease12. The development of Treg cells depends on the
transcription factor FOXP3, which coordinates expression of genes essential for Treg cell
homeostasis and function, and directly blocks production of pro-inflammatory cytokines13,14.
Although Treg cells are generally considered to be a separate lineage of CD4+ T cells,
recent murine studies have indicated that they use different transcriptional programs to regulate
TH1, TH2 or TH17 responses, and that these are associated with expression or activation of specific
TH-associated transcription factors15-17. This suggests that like conventional TH cells, Treg cells
differentiate into specialized subsets during different types of immune responses, and that this is
essential for the appropriate regulation of different TH cell populations. Additionally, Treg cells are
found throughout the body in both lymphoid and non-lymphoid tissues, and like conventional
effector/memory T cells they express diverse patterns of chemokine receptors expected to target
them to these sites18. Moreover, we and others have shown that the ability of Treg cells to maintain
immune homeostasis and prevent autoimmunity depends on their appropriate co-localization with
effector T cells19-23. However, the degree of phenotypic and functional concordance between
different TH and Treg cell subsets has not been carefully and systematically examined.
To better understand how Treg cells modulate different types of effector T cell responses,
we performed a comprehensive phenotypic and functional analysis of human Treg cells directly ex
vivo. Based on expression of the chemokine receptors CCR6, CXCR3, CCR4 and CCR10, we
identified four separable populations of FOXP3+ Treg cells in human peripheral blood that
Page 4 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
phenotypically mirror different TH cell subsets. Although all of the Treg cell populations showed
suppressive activity in vitro, they differed in their production of both pro- and anti-inflammatory
cytokines, had distinct expression patterns of TH-associated transcription factors, and differentially
proliferated in response to recall antigens associated with either TH1 or TH17 cell responses. Thus,
TH and Treg cells appear to undergo functional specialization in parallel, resulting in the
development of Treg cell subsets capable of co-localizing with and effectively regulating different
types of TH cell responses in vivo.
Page 5 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Materials and Methods
Cell purification and sorting. Blood samples were obtained from healthy donors participating in
the Benaroya Research Institute Immune Mediated Disease Registry. Informed consent was
obtained from all subjects according to IRB approved protocols at Benaroya Research Institute and
following the Declaration of Helsinki. CD4+CD25high Treg cells were enriched from PBMCs after
staining with PE-cyanine 5 (PE-Cy5)-labeled anti-CD25 (Biolegend) followed by positive
selection using anti-PE and anti-Cy5 microbeads (Miltenyi Biotec). On the negative fraction,
CD4+CD25– TH cells were purified by positive selection with CD4-specific microbeads (Miltenyi
Biotec). Memory T cell subsets were sorted to over 97% purity as CD4+ CD45RO+ CD127+ CD25–
CCR6+/– using PerCP/Cy5.5-conjugated anti-CD45RO, Alexa Fluor 488-conjugated anti-CD127,
PE-Cy5-conjugated anti-CD25 and Alexa Fluor 700-conjugated anti-CD4 (all from Biolegend).
Memory Treg cells were sorted to over 97% purity as CD4+ CD127lo/– CD25high CD45RO+ using
PerCP/Cy5.5-conjugated anti-CD45RO, Alexa Fluor 488-conjugated anti-CD127, PE-Cy5conjugated anti-CD25 and Alexa Fluor 700-conjugated anti-CD4. Antibodies used for sorting of
memory TH and Treg cell subsets were: biotin-conjugated anti-CCR6 (BD Pharmingen) followed
by streptavidin-APC-cyanine 7 (APC-Cy7) (Biolegend); PE-conjugated anti-CCR10 (R&D
Systems), PE-Cy7 conjugated anti-CCR4 (BD Pharmingen), Alexa Fluor 647-conjugated antiCXCR3 (Biolegend). Cells were sorted with a FACSAria (BD Biosciences). CD14+ monocytes
were isolated from PBMCs by positive selection with CD14-specific microbeads (Miltenyi
Biotec). Cells were cultured in RPMI 1640 medium supplemented with 2 mM glutamine, 1%
(vol/vol) nonessential amino acids, 1% (vol/vol) sodium pyruvate, penicillin (50 U/ml),
streptomycin (50 µg/ml) (all from Invitrogen) and 5% heat-inactivated human serum.
Page 6 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Intracellular cytokine staining. Intracellular staining for FOXP3, Helios, RORγt, T-bet, IL-22,
IL-17, IFN-γ, IL-10 and IL-4 was performed on sorted T cells stimulated for 5 h with PMA and
ionomycin in the presence of brefeldin A (all from Sigma-Aldrich) for the final 2 ½ h of culture.
Cells were fixed and permeabilized with Fixation/Permeabilization solution (eBioscience)
according to manufacturer’s instructions. Cells were stained with eFluor 450-conjugated antiFOXP3 (eBioscience), Alexa Fluor 647-conjugated anti-Helios (Biolegend), PE-conjugated antiRORγt (eBioscience), Alexa Fluor 647-conjugated anti-T-bet (eBioscience), PE-conjugated antiIL-22 (R&D Systems), PE-conjugated anti-IL-10 (Biolegend), PE-conjugated anti-IL-4
(Biolegend), Alexa Fluor 647- or Alexa Fluor 488-conjugated anti-IL-17 (eBioscience), FITC- or
APC-conjugated anti-IFN-γ (BD Pharmingen and Biolegend, respectively) and analyzed on a
LSRII (BD Biosciences). FACS data were analyzed with FlowJo (Tree Star).
Phenotype analysis of TH and Treg cell subsets. TH and Treg cell subsets were evaluated for
expression of CTLA-4, CLA, ICOS, Helios and Ki-67. Cells were stained with biotin-conjugated
anti-CTLA-4 (BD Pharmingen) followed by streptavidin PE-Cy5, FITC-conjugated anti-CLA
(Biolegend), FITC- or biotin-conjugated anti-ICOS (Biolegend), FITC-conjugated anti-Helios
(Biolegend), Alexa Fluor 488-conjugated anti-Ki-67 (BD Pharmingen).
Suppression assays. CFSE (Sigma-Aldrich)-labeled sorted 5 x 104 CD4+ CD25– T cells were used
as responder and cocultured with 5x104 sorted Treg cells as indicated. These cells were stimulated
in round-bottomed 96-well plates with irradiated 5 x 104 autologous monocytes and anti-CD3
(OKT3). Cellular proliferation was assessed after 4 days by flow cytometry.
Page 7 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
In vitro cell expansion. Sorted TH and Treg cell subsets were activated with anti-CD3/anti-CD28coated microbeads (Invitrogen) at a 1:1 ratio and cultured for 9 days. IL-2 (300 U/ml) was added at
day 0 (Treg cells only) and at days 2, 4, 6 and 8. After 9 days of culture, cells were analyzed for
cytokine production by intracellular cytokine staining and for transcription factor expression by
real-time quantitative RT-PCR.
Real-time quantitative RT-PCR. Total RNA from sorted T cell subsets was extracted using the
RNeasy kit (Qiagen) and treated with DNaseI (Qiagen) to avoid genomic DNA contamination.
cDNA were synthesized with M-MuLV reverse-transcriptase and oligo(dT) primers (Fermentas)
and gene expression was examined with ABI 7500 Fast Real-Time PCR system (Applied
Biosystem) using a SYBR green real-time PCR kit (Fermentas). The data were normalized to βActin (ACTB) gene expression. The primers used were (5’-3’): RORC forward:
GCATGTCCCGAGATGCTGTC and reverse: CTGGGAGCCCCAAGGTGTAG; TBX21 forward:
CCGTGACTGCCTACCAGAAT and reverse: ATCTCCCCCAAGGAATTGAC; GATA-3
forward: GAACCGGCCCCTCATTAAG and reverse: ATTTTTCGGTTTCTGGTCTGGAT;
FOXP3 forward: CCAGCCATGATCAGCCTCAC and reverse:
CCGAAAGGGTGCTGTCCTTC; IL17A forward: GAAGGCAGGAATCACAATC and reverse:
GCCTCCCAGATCACAGA; IFNG forward: CCAGGACCCATATGTAAAAG and reverse
TGGCTCTGCATTATTTTTC; IL10 forward: CAAATGAAGGATCAGCTGGACAA and
reverse: GCATCACCTCCTCCAGGTAAAAC; ACTB forward:
GGACTTCGAGCAAGAGATGG and reverse: AGCACTGTGTTGGCGTACAG.
Antigen-specific proliferation assays. CFSE (Sigma-Aldrich)-labeled sorted TH and Treg cell
subsets (5 x 104) were cocultured in round-bottomed 96-well plates with irradiated autologous
Page 8 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
monocytes (5 x 104), which were either unpulsed or pulsed for 3h with C. albicans (Greer
laboratories) or HCMV (East Coast Bio)) antigens. For Treg cells, anti-CD28 (0.5 μg/ml) and IL-2
(20 U/ml) were added to the cultures. Cellular proliferation was assessed after 5-6 days by flow
cytometry. The percentage of CFSElo cells (defined as cells that had undergone 3 or more
divisions) is represented after subtraction of the background proliferation with autologous
monocytes. In some experiments, after 6 days of culture cells were restimulated with PMA and
ionomycin for 4 h and their cytokine production was analyzed by flow cytometry.
Statistics. Statistical tests were performed using Prism software (GraphPad, San Diego, CA).
Significance was determined by paired two-tailed Student’s t-test or one-way ANOVA analysis
with Tukey correction, as noted in figure legends.
Page 9 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Results
Identification of phenotypically distinct subsets of human Treg cells
Human effector and memory CD4+ T cell subsets express different chemokine receptor
profiles enabling them to migrate to specific tissues such as the skin and to respond to chemokines
produced during different types of inflammatory responses. Based on differential expression of the
chemokine receptors CCR6, CXCR3, CCR4 and CCR10, four subsets of CD4+CD45RO+CD25–
CD127+ TH cells can be defined in the peripheral blood of healthy donors: CXCR3+ TH1 cells that
produce IFN-γ, CXCR3–CCR6+CCR4+CCR10– IL-17-producing TH17 cells, CXCR3–
CCR6+CCR4+CCR10+ TH22 cells that secrete IL-22 but not IL-17, and CCR6–CXCR3– cells that
express CCR4 (data not shown) and are enriched in IL-4-producing TH2 cells (Figure 1A, upper
panels and Supplemental Figure 1).
By applying a similar gating strategy to ex vivo CD4+CD45RO+CD25hiCD127lo memory
Treg cells, we identified four distinct Treg cell subsets phenotypically analogous to the TH
populations described above (Figure 1A, lower panels). Based on their phenotypic resemblance to
the different effector T cell subsets, we refer to these populations as TH1-, TH17-, TH22- and TH2like Treg cells. Underscoring the phenotypic link between the TH and Treg cell subsets, both TH22
cells and TH22-like Treg cells homogeneously expressed CLA, whereas CLA expression in all the
other TH and Treg cell populations was heterogenous (Figure 1B). However, although
phenotypically similar, the frequency of each subset differed among the TH and Treg cells. For
instance, the TH17- and TH22-phenotype cells were found at substantially higher frequency in the
Treg cell compartment, whereas the proportion of CXCR3+ cells was decreased in the Treg cells
(Figure 1C). Additionally, although a small fraction (~10%) of CD4+CD45RA+CD45RO–
CD25hiCD127lo naïve Treg cells expressed low levels of CXCR3, expression of CCR6, CCR4 and
CCR10 was restricted to CD45RO+ Treg cells (data not shown). Thus, as in TH cells, acquisition
Page 10 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
of these homing receptor phenotypes likely occurs following activation of Treg cells in the
periphery.
Consistent with their identification as Treg cells, greater than 90% of the cells in each of
the CD25hiCD127lo cell populations were FOXP3+ (Figure 2A). Additionally, most of these cells
expressed the transcription factor Helios, which is thought to be selectively expressed on ‘natural’
Treg cells of thymic origin24, and high levels of CTLA-4, an inhibitory receptor crucial for the
suppressive function of Treg cells in vivo25 (Figure 2B). Moreover, all the CD25hiCD127lo subsets
effectively blocked proliferation of autologous anti-CD3-stimulated CD4+CD25– T cells,
confirming their identity as functionally suppressive Treg cells (Figure 2C).
Co-expression of pro- and anti-inflammatory cytokines by Treg cells
Treg cells use a number of functional immunomodulatory mechanisms to limit immune
responses and prevent autoimmunity. Of these, production of the anti-inflammatory cytokine IL-10
is required for Treg cell function in a number of models26,27. Additionally, several reports have
indicated that Treg cells can produce pro-inflammatory effector cytokines such as IL-17 and IFNγ28-33. To determine if the Treg cell subsets we identified are functionally heterogeneous, and to
compare their cytokine production profiles to the corresponding effector cell populations, we
examined production of pro- and anti-inflammatory cytokines by both TH and Treg cells directly ex
vivo following stimulation with PMA/ionomycin (Figure 3A and B). As expected, TH17 cells
contained a high frequency of IL-17-producing cells, whereas IFN-γ-producing cells were enriched
in the CXCR3+ TH1 population. Likewise, although present at much lower frequencies, FOXP3+
Treg cells producing IL-17 and IFN-γ were found in the phenotypically equivalent TH17- and TH1like Treg subsets. Surprisingly, production of IL-10 was also limited to the TH17- and TH1-like
Treg populations, where it was frequently co-produced with either IL-17 or IFN-γ (Figure 3C). In
Page 11 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
addition, as reported for IFN-γ and IL-17, IL-10 production was dramatically enriched in the
relatively small population of Helios– cells in each of these Treg cell populations (Supplemental
Figure 2). In contrast to the Treg cells, conventional TH1 and TH17 cells rarely made IL-10.
Additionally, little IL-10-production was observed in either the TH22- or TH2-like Treg cells, and
these cells also did not produce IL-22 or IL-4, the canonical effector cytokines associated with
their cellular phenotypes (Supplemental Figure 3A). The patterns of IFN-γ, IL-17 and IL-10
production amongst the Treg cell subsets were confirmed by ELISA following in vitro activation
of sorted cells (Supplemental Figure 3B). Moreover, quantitative RT-PCR analysis of cytokine
mRNA expression by sorted TH and Treg cells showed that TH1- and TH17-like Treg cells
expressed IL17A, IFNG and IL10 mRNA directly ex vivo (Supplemental Figure 3C), indicating
that production of these cytokines is not an artifact of strong PMA/Ionomycin stimulation. Taken
together, these results demonstrate that Treg cells phenotypically associated with different types of
TH responses are also functionally distinct, producing unique combinations of both pro- and antiinflammatory cytokines.
Transcription factor expression by Treg cell subsets
The characteristic phenotypic and functional properties of the various TH cell subsets are
largely due to the selective expression of transcription factors such as T-bet and RORγt that induce
specific programs of gene expression controlling both cytokine production and migratory potential
of these cells1. Given their phenotypic resemblance to specific TH cell subsets and their ability to
produce effector cytokines such as IL-17 and IFN-γ, we hypothesized that the Treg cell subsets we
identified might also express these lineage-specifying transcription factors. We therefore used
quantitative RT-PCR to measure expression of transcription factors known to regulate TH cell
differentiation and function (Figure 4A). Indeed as in TH1 and TH17 cells, expression of TBX21
Page 12 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
(the gene encoding T-bet) and RORC (the gene encoding RORγt) were found in the TH1- and
TH17-like Treg populations, respectively directly ex vivo. The TH2-associated transcription factor
GATA3 was recently found to have an essential function in Treg cells34,35 and accordingly was
expressed by all of the memory Treg cell subsets. However, there was a trend toward higher
expression of GATA3 in the TH2-like Treg cells. Moreover, although the transcription factors IRF4
and STAT3 are required for Treg cell-mediated suppression of TH2 and TH17 responses in
mice15,17, each Treg cell subset expressed equivalent amounts of IRF4 or STAT3 mRNA (data not
shown).
We used flow cytometry to confirm the expression of RORγt and T-bet by TH17- and TH1like Treg cells and correlate it with production of IL-17 or IFN-γ (Figure 4B). Indeed, IL-17producing TH17-like Treg cells expressed detectable RORγt, and T-bet was expressed by the
majority of both IFN-γ+ and IFN-γ– TH1-like Treg cells. Thus, as has been recently suggested in
murine systems, the selective expression of TH-associated lineage-specifying transcription factors
likely contributes to the phenotypic and functional specialization of human Treg cells.
Human Treg cell subsets are phenotypically and functionally stable
An ongoing issue in the study of human Treg cells is the lack of a definitive Treg cell
marker. Although most Treg cells are CD25hiCD127loFOXP3+, activated TH cells can also
transiently acquire this phenotype. This raises the possibility that a portion of the cells we identify
as Treg cells, especially those producing effector cytokines, are actually contaminating TH cells.
Additionally, recent studies have shown that Treg cells can downregulate FOXP3 expression and
interconvert between effector and regulatory phenotypes36,37. However, the amount of FOXP3
expressed by TH1- and TH17-like Treg cells producing IFN-γ or IL-17 was similar to that observed
Page 13 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
in cytokine negative Treg cells, and therefore expression of these pro-inflammatory cytokines is
not due to decreased or impaired FOXP3 expression (Supplemental Figure 4). In addition,
following in vitro activation and expansion, FOXP3 expression was stable in all of the Treg cell
subsets, and was not substantially upregulated in any of the TH populations (Figure 5A). Moreover,
TH1- and TH17-like Treg cells expanded in vitro by anti-CD3/28 stimulation in the presence of IL2 maintained their preferential expression of T-bet, and RORγt, respectively, as well as their ability
to produce IFN-γ, IL-17, and IL-10 (Figure 5A and B). Thus, under neutral stimulation conditions,
the phenotypic and functional characteristics of these Treg cell populations appear to be relatively
stable. However, as with other TH populations, they may maintain some functional plasticity when
activated in the presence of polarizing cytokines in vivo.
Antigen-specificity of human Treg cells
Despite their anergic phenotype in vitro, Treg cells undergo rapid homeostatic proliferation
in vivo that reflects their recognition of antigens derived from the ‘extended-self’. This not only
includes autoantigens, but also antigens derived from either benign commensal microorganisms or
persistent pathogens. We evaluated the activation status of the various TH and Treg cell subsets by
examining their expression of ICOS, a CD28-like costimulatory molecule that is inducibly
expressed by recently activated T cells38, and the proliferation-associated nuclear antigen Ki-67.
Whereas little or no ICOS expression was detected on any of the TH cell subsets, ICOS+ cells were
present in all four Treg cell populations, and were particularly enriched among the CXCR3+ TH1like Treg cells (Figure 6A, left panels). Although expressed by fewer cells, the pattern of Ki-67
expression closely mirrored that of ICOS (Figure 6A, right panels), and ICOS and Ki-67 were
concordantly expressed by a large portion of the TH1-, TH2- and TH17-like Treg cells (Figure 6B).
Page 14 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Thus, consistent with the notion that Treg cells recognize ubiquitously presented antigens, each of
the Treg cell subsets contains a large population of activated, cycling cells.
To determine if the Treg cell subsets shared antigen specificities with their TH counterparts,
we stimulated sorted CFSE-labeled cells in vitro with antigens from organisms that provoke strong
TH17 (C. albicans) or TH1 (human cytomegalovirus, HCMV) responses 7,39. All TH and Treg cell
subsets displayed strong proliferation when stimulated with anti-CD3/28 (Supplemental Figure 5).
However, results from eight donors showed that TH cells specific for C. albicans were present
mainly in the TH17 population, and could also be found among TH22 and TH1 cells, albeit with
more donor-to-donor variability (Figure 7A, left panel). C. albicans-induced proliferation of Treg
cells was also detected in most donors examined for the TH17- and TH1-like Treg cell subsets, but
was low or undetectable in the TH22- and TH2-like Treg cells. Similarly, HCMV-specific effector
T cells were found in the TH1 cell population in four donors, and of these, three also showed
substantial proliferative responses in the TH1-like Treg cell population (Figure 7A, right panel).
We also compared the cytokine production profile of the CFSElo C. albicans-specific TH
and Treg cells by flow cytometry following restimulation with PMA/ionomycin (Figure 7B).
Following culture with C. albicans, CFSElo TH17 cells contained both IL-17+ and some IFN-γ+
cells, whereas CFSElo TH1 cells were predominantly IFN-γ+. Similarly, IL-17 and IFN-γ-producing
cells were also present in the CFSElo TH17- and TH1-like Treg populations, respectively. However,
consistent with their regulatory phenotype, these cells also contained significant populations of IL10 single-producing cells and IL-10/IL-17 or IL-10/IFN-γ co-producing cells. Thus, Treg cells that
proliferate in response to C. albicans or HCMV are found in the TH17- and TH1-like Treg subsets,
and these differ from pathogen-specific TH cells in the balance of pro- and anti-inflammatory
cytokines they produce.
Page 15 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Discussion
As part of their functional specialization, CD4+ effector T cells acquire expression of
different combinations of adhesion and chemokine receptors that enable their migration to specific
tissues and inflammatory sites. Through a series of ex vivo analyses, we now extend this paradigm
to FOXP3+ Treg cells, and have identified and characterized functionally distinct Treg cell subsets
that phenotypically mimic different TH cell populations. This diversity strongly suggests that TH
and Treg cells undergo phenotypic and functional specialization in parallel during different types
of inflammatory responses, and likely reflects the specialized role each Treg cell subset has in colocalizing with and suppressing specific TH cell populations in vivo.
Although the phenotypic diversity of Treg cells has been well established, the distinct
functional characteristics of different Treg cell subsets are still poorly understood. By performing
comprehensive functional analyses of the various Treg cell subsets, we found that although each
subset was suppressive in vitro, they differed dramatically in their ability to produce both pro- and
anti-inflammatory cytokines. Despite the ability of FOXP3 to directly inhibit IL-17 and IFN-γ
expression40,41, several groups have recently reported the production of these pro-inflammatory
cytokines by Treg cells in both mouse and human28-33. In human, production of these cytokines is
restricted to the Helios– fraction of Treg cells that are thought to be induced from FOXP3– naïve T
cells by sub-optimal stimulation in the presence of TGF-β 24, and this was taken to indicate that
these cells are functionally unstable and could readily convert to pro-inflammatory effector
lineages. Furthermore, both type-1 diabetes (T1D) and multiple sclerosis (MS) have been
associated with an increase in IFN-γ-producing Treg cells, suggesting that re-directed Treg cells
may contribute to autoimmune pathogenesis30,33. We found that production of IL-17 and IFN-γ is
restricted to the TH17- and TH1-like Treg cells that phenotypically mimic conventional TH17 and
Page 16 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
TH1 cells. Moreover, unlike previous studies examining effector cytokine production by Treg
cells, we found that cytokine production in these TH1- and TH17-like Treg cells is qualitatively
different than that observed in their effector TH counterparts. For instance, whereas IL-22 was
frequently co-produced with IL-17 in TH17 cells, co-production of these cytokines was not
observed in the TH17-like Treg population. Additionally, unlike FOXP3– TH1 and TH17 cells,
significant fractions of the IFN-γ and IL-17-producing Treg cells co-produced IL-10, and therefore
appear to retain at least some regulatory activity. Indeed, these Treg cells functionally resemble the
FOXP3– IFN-γ/IL-10 co-producing cells that modulate TH1 responses during persistent parasite
infection in mice42,43, and that were recently described as a small population of CD127loCD25– TH
cells in humans44. In addition, both IFN-γ and IL-17 can have an immunomodulatory functions in
certain immune contexts45,46, and rather than being pro-inflammatory or potentially pathogenic,
production of these cytokines by Treg cells in conjunction with IL-10 may actually help dampen
inflammation. Thus, the increased frequency of IFN-γ-producing Treg cells in T1D and MS
patients may be a response to inflammatory disease in these individuals, rather than a cause of it.
Studies in murine systems have led to the notion that Treg cells use specific TH-associated
transcription factors in order to maintain or restore immune homeostasis during TH1, TH2 and TH17
immune responses15-17. We show that T-bet and RORγt are specifically expressed by TH1- and
TH17-like Treg cells, thereby extending this paradigm to human Treg cells, and demonstrating that
phenotypically distinct Treg cell populations co-opt portions of the transcriptional programs of
specific effector T cell subsets. Indeed, T-bet and RORγt induce expression of CXCR3 and CCR6,
respectively47,48, and therefore expression of these transcription factors may act to link the
migratory properties of these TH and Treg cell populations. Interestingly, although FOXP3 can
antagonize RORγt-mediated production of IL-17 in vitro41, the fraction of RORγt-expressing cells
Page 17 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
that produced IL-17 was similar in the TH17 cells and the TH17-like Treg cells. In addition, the
amount of IL-17 expressed per cell was comparable in the FOXP3+ and FOXP3– cells, thus
indicating that FOXP3-mediated inhibition of IL-17 expression is impaired in the TH17-like Treg
cells. In humans, a second isoform of FOXP3 exists in which exon 2, including the domain
essential for inhibition of RORγt, is removed by alternative splicing41. It is possible that the IL-17producing Treg cells we observe overexpress this FOXP3 isoform, and further studies are needed
to precisely delineate how RORγt, T-bet, and other transcription factors involved in effector TH
differentiation functionally interact with FOXP3 to control the balance of pro- and antiinflammatory gene expression in Treg cells.
The mechanisms by which Treg cells acquire distinct patterns of transcription factor and
chemokine receptor expression are important to define. Their shared phenotypes suggest that the
TH and Treg cell subsets differentiate in parallel in response to inflammatory cues from the
immune environment. Consistent with this, we found that IFN-γ and STAT1 were required for
Treg cell expression of T-bet and CXCR3 in mice16, and human naïve Treg cells can differentiate
into IL-17 producing cells in vitro when stimulated in the presence of specific pro-inflammatory
cytokines49. Additionally, Treg cells may modify their phenotypes in response to anatomical cues
such as the active metabolite of vitamin D3, 1,25-(OH)2D3, which is produced in the skin in
response to sun exposure and can induce T cell expression of cutaneous chemokine receptor
CCR1050.
Although believed to be largely self-reactive or specific for commensal micro-organsims,
the specificity of human Treg cells is still poorly characterized. However, consistent with the
phenotypic relationship between the various subsets of TH and Treg cells, we found that Treg cells
specific for C. albicans and HCMV can be found largely in the TH1- and TH17-like Treg
populations. Moreover, unlike the C. albicans-specific memory TH cells, production of IL-10,
Page 18 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
either alone or in conjunction with either IFN-γ or IL-17 was commonly observed in C. albicansreactive TH1- and TH17-like Treg cells. Thus, the responses we observed in the Treg cells appear to
represent an immunmodulatory response to infection. As HCMV generally establishes life-long
latent infection, and C. albicans is a common component of the oral and intestinal flora, these Treg
cells may help maintain balanced immune responses that result in pathogen control without full
eradication. A broader analysis of the repertoire and specificity of Treg cells in each of the
populations we have characterized will be important for determining how each contributes to the
regulation of immune responses to both foreign and self-antigens.
The identification and characterization of phenotypically and functionally distinct human
Treg cell subsets provides new insights into how Treg cells modulate different types of effector T
cell responses, and suggests that specific populations of specialized Treg cells could be stably
expanded and used to treat inflammatory and autoimmune diseases caused by dysregulated TH1,
TH2, TH17 and TH22 responses. Further exploration of the diversity of human Treg cells is
essential for determining how these cells balance the need to mount robust and effective immune
responses during pathogen infection with the requirement to maintain self-tolerance and prevent
collateral tissue damage and immunopathology. This will also shed light on how aberrant Treg cell
function contributes to the development and progression of immune-mediated diseases, and
provide new avenues for therapeutic manipulation of Treg cell activity.
Page 19 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Acknowledgements
The authors thank K. Arumuganathan for his help with cell sorting and flow cytometry; the
Benaroya Research Institute Translational Research Program Clinical Core for obtaining donor
samples; S.F. Ziegler, J.A. Hamerman and M.A. Koch for comments on the manuscript; and M.
Warren for administrative assistance. This work was in part supported by by grants AR055695,
DK072295, and AI067750 to D.J.C. from the N.I.H. T.D. is a recipient of a postdoctoral
fellowship from the Arthritis Foundation.
Authorship contributions: T.D. and R.D. performed experiments and analyzed results; T.D.,
D.J.C., F.S. and A.L. designed the research, T.D. and D.J.C. wrote the manuscript.
The authors have no conflicting financial interests.
Page 20 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
References
1.
Zhu J, Yamane H, Paul WE. Differentiation of effector CD4 T cell populations (*). Annual
review of immunology. 2010;28:445-489.
2.
Duhen T, Geiger R, Jarrossay D, Lanzavecchia A, Sallusto F. Production of interleukin 22
but not interleukin 17 by a subset of human skin-homing memory T cells. Nat Immunol.
2009;10(8):857-863.
3.
Nograles KE, Zaba LC, Shemer A, et al. IL-22-producing "T22" T cells account for
upregulated IL-22 in atopic dermatitis despite reduced IL-17-producing TH17 T cells. The Journal
of allergy and clinical immunology. 2009;123(6):1244-1252 e1242.
4.
Trifari S, Kaplan CD, Tran EH, Crellin NK, Spits H. Identification of a human helper T
cell population that has abundant production of interleukin 22 and is distinct from T(H)-17, T(H)1
and T(H)2 cells. Nat Immunol. 2009;10(8):864-871.
5.
Qin S, Rottman JB, Myers P, et al. The chemokine receptors CXCR3 and CCR5 mark
subsets of T cells associated with certain inflammatory reactions. J Clin Invest. 1998;101(4):746754.
6.
Sallusto F, Lenig D, Mackay CR, Lanzavecchia A. Flexible programs of chemokine
receptor expression on human polarized T helper 1 and 2 lymphocytes. J Exp Med.
1998;187(6):875-883.
7.
Acosta-Rodriguez EV, Rivino L, Geginat J, et al. Surface phenotype and antigenic
specificity of human interleukin 17-producing T helper memory cells. Nat Immunol.
2007;8(6):639-646.
8.
Annunziato F, Cosmi L, Santarlasci V, et al. Phenotypic and functional features of human
Th17 cells. J Exp Med. 2007;204(8):1849-1861.
9.
Singh SP, Zhang HH, Foley JF, Hedrick MN, Farber JM. Human T cells that are able to
produce IL-17 express the chemokine receptor CCR6. J Immunol. 2008;180(1):214-221.
10.
Reboldi A, Coisne C, Baumjohann D, et al. C-C chemokine receptor 6-regulated entry of
TH-17 cells into the CNS through the choroid plexus is required for the initiation of EAE. Nat
Immunol. 2009;10(5):514-523.
11.
Campbell DJ, Koch MA. Phenotypical and functional specialization of FOXP3(+)
regulatory T cells. Nature reviews Immunology. 2011;11(2):119-130.
12.
Sakaguchi S, Yamaguchi T, Nomura T, Ono M. Regulatory T cells and immune tolerance.
Cell. 2008;133(5):775-787.
13.
Marson A, Kretschmer K, Frampton GM, et al. Foxp3 occupancy and regulation of key
target genes during T-cell stimulation. Nature. 2007;445(7130):931-935.
Page 21 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
14.
Zheng Y, Josefowicz SZ, Kas A, Chu TT, Gavin MA, Rudensky AY. Genome-wide
analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature.
2007;445(7130):936-940.
15.
Chaudhry A, Rudra D, Treuting P, et al. CD4+ regulatory T cells control TH17 responses
in a Stat3-dependent manner. Science. 2009;326(5955):986-991.
16.
Koch MA, Tucker-Heard G, Perdue NR, Killebrew JR, Urdahl KB, Campbell DJ. The
transcription factor T-bet controls regulatory T cell homeostasis and function during type 1
inflammation. Nat Immunol. 2009;10(6):595-602.
17.
Zheng Y, Chaudhry A, Kas A, et al. Regulatory T-cell suppressor program co-opts
transcription factor IRF4 to control T(H)2 responses. Nature. 2009;458(7236):351-356.
18.
Lim HW, Broxmeyer HE, Kim CH. Regulation of trafficking receptor expression in human
forkhead box P3+ regulatory T cells. Journal of immunology. 2006;177(2):840-851.
19.
Dudda JC, Perdue N, Bachtanian E, Campbell DJ. Foxp3+ regulatory T cells maintain
immune homeostasis in the skin. J Exp Med. 2008;205(7):1559-1565.
20.
Erhardt A, Wegscheid C, Claass B, et al. CXCR3 Deficiency Exacerbates Liver Disease
and Abrogates Tolerance in a Mouse Model of Immune-Mediated Hepatitis. Journal of
immunology. 2011.
21.
Sather BD, Treuting P, Perdue N, et al. Altering the distribution of Foxp3(+) regulatory T
cells results in tissue-specific inflammatory disease. J Exp Med. 2007;204(6):1335-1347.
22.
Villares R, Cadenas V, Lozano M, et al. CCR6 regulates EAE pathogenesis by controlling
regulatory CD4+ T-cell recruitment to target tissues. Eur J Immunol. 2009;39(6):1671-1681.
23.
Yamazaki T, Yang XO, Chung Y, et al. CCR6 regulates the migration of inflammatory and
regulatory T cells. J Immunol. 2008;181(12):8391-8401.
24.
Thornton AM, Korty PE, Tran DQ, et al. Expression of Helios, an Ikaros transcription
factor family member, differentiates thymic-derived from peripherally induced Foxp3+ T
regulatory cells. J Immunol. 2010;184(7):3433-3441.
25.
Wing K, Onishi Y, Prieto-Martin P, et al. CTLA-4 control over Foxp3+ regulatory T cell
function. Science. 2008;322(5899):271-275.
26.
Asseman C, Mauze S, Leach MW, Coffman RL, Powrie F. An essential role for interleukin
10 in the function of regulatory T cells that inhibit intestinal inflammation. The Journal of
experimental medicine. 1999;190(7):995-1004.
27.
Rubtsov YP, Rasmussen JP, Chi EY, et al. Regulatory T cell-derived interleukin-10 limits
inflammation at environmental interfaces. Immunity. 2008;28(4):546-558.
Page 22 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
28.
Ayyoub M, Deknuydt F, Raimbaud I, et al. Human memory FOXP3+ Tregs secrete IL-17
ex vivo and constitutively express the T(H)17 lineage-specific transcription factor RORgamma t.
Proc Natl Acad Sci U S A. 2009;106(21):8635-8640.
29.
Beriou G, Costantino CM, Ashley CW, et al. IL-17-producing human peripheral regulatory
T cells retain suppressive function. Blood. 2009;113(18):4240-4249.
30.
McClymont SA, Putnam AL, Lee MR, et al. Plasticity of human regulatory T cells in
healthy subjects and patients with type 1 diabetes. Journal of immunology. 2011;186(7):39183926.
31.
Voo KS, Wang YH, Santori FR, et al. Identification of IL-17-producing FOXP3+
regulatory T cells in humans. Proc Natl Acad Sci U S A. 2009;106(12):4793-4798.
32.
Oldenhove G, Bouladoux N, Wohlfert EA, et al. Decrease of Foxp3+ Treg cell number and
acquisition of effector cell phenotype during lethal infection. Immunity. 2009;31(5):772-786.
33.
Dominguez-Villar M, Baecher-Allan CM, Hafler DA. Identification of T helper type 1-like,
Foxp3+ regulatory T cells in human autoimmune disease. Nature medicine. 2011;17(6):673-675.
34.
Wang Y, Su MA, Wan YY. An Essential Role of the Transcription Factor GATA-3 for the
Function of Regulatory T Cells. Immunity. 2011;35(3):337-348.
35.
Wohlfert EA, Grainger JR, Bouladoux N, et al. GATA3 controls Foxp3+ regulatory T cell
fate during inflammation in mice. The Journal of clinical investigation. 2011.
36.
Bailey-Bucktrout SL, Bluestone JA. Regulatory T cells: stability revisited. Trends in
immunology. 2011;32(7):301-306.
37.
O'Shea JJ, Paul WE. Mechanisms underlying lineage commitment and plasticity of helper
CD4+ T cells. Science. 2010;327(5969):1098-1102.
38.
Greenwald RJ, Freeman GJ, Sharpe AH. The B7 family revisited. Annual review of
immunology. 2005;23:515-548.
39.
Rivino L, Messi M, Jarrossay D, Lanzavecchia A, Sallusto F, Geginat J. Chemokine
receptor expression identifies Pre-T helper (Th)1, Pre-Th2, and nonpolarized cells among human
CD4+ central memory T cells. The Journal of experimental medicine. 2004;200(6):725-735.
40.
Ono M, Yaguchi H, Ohkura N, et al. Foxp3 controls regulatory T-cell function by
interacting with AML1/Runx1. Nature. 2007;446(7136):685-689.
41.
Zhou L, Lopes JE, Chong MM, et al. TGF-beta-induced Foxp3 inhibits T(H)17 cell
differentiation by antagonizing RORgammat function. Nature. 2008;453(7192):236-240.
Page 23 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
42.
Jankovic D, Kugler DG, Sher A. IL-10 production by CD4+ effector T cells: a mechanism
for self-regulation. Mucosal immunology. 2010;3(3):239-246.
43.
Anderson CF, Oukka M, Kuchroo VJ, Sacks D. CD4(+)CD25(-)Foxp3(-) Th1 cells are the
source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis. The Journal of
experimental medicine. 2007;204(2):285-297.
44.
Haringer B, Lozza L, Steckel B, Geginat J. Identification and characterization of IL10/IFN-gamma-producing effector-like T cells with regulatory function in human blood. The
Journal of experimental medicine. 2009;206(5):1009-1017.
45.
O'Connor W, Jr., Kamanaka M, Booth CJ, et al. A protective function for interleukin 17A
in T cell-mediated intestinal inflammation. Nature immunology. 2009;10(6):603-609.
46.
Willenborg DO, Fordham S, Bernard CC, Cowden WB, Ramshaw IA. IFN-gamma plays a
critical down-regulatory role in the induction and effector phase of myelin oligodendrocyte
glycoprotein-induced autoimmune encephalomyelitis. Journal of immunology. 1996;157(8):32233227.
47.
Lord GM, Rao RM, Choe H, et al. T-bet is required for optimal proinflammatory CD4+ Tcell trafficking. Blood. 2005;106(10):3432-3439.
48.
Manel N, Unutmaz D, Littman DR. The differentiation of human T(H)-17 cells requires
transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nature
immunology. 2008;9(6):641-649.
49.
Valmori D, Raffin C, Raimbaud I, Ayyoub M. Human RORgammat+ TH17 cells
preferentially differentiate from naive FOXP3+Treg in the presence of lineage-specific polarizing
factors. Proceedings of the National Academy of Sciences of the United States of America.
2010;107(45):19402-19407.
50.
Sigmundsdottir H, Pan J, Debes GF, et al. DCs metabolize sunlight-induced vitamin D3 to
'program' T cell attraction to the epidermal chemokine CCL27. Nature immunology.
2007;8(3):285-293.
Page 24 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Figure legends
Figure 1. Chemokine receptor expression defines human Treg cell subsets.
(A) Representative flow cytometric analysis of CCR6, CXCR3, CCR4 and CCR10 expression by
gated CD4+CD45RO+CD25– TH cells (upper panels) and CD4+CD45RO+CD25hiCD127lo Treg
cells (lower panels) from peripheral blood. (B) Expression of CLA by the indicated TH and Treg
cell subsets. Each symbol represents one donor; horizontal bars indicate mean. Data are from five
donors. (C) Frequency of cells expressing the indicated chemokine receptor combinations among
TH and Treg cells. Each symbol represents one donor; horizontal bars indicate mean. Data are
from fifteen donors.
Figure 2. The Treg cell subsets are functionally suppressive.
(A) Expression of FOXP3 by the indicated TH and Treg cell subsets. Each symbol represents one
donor; horizontal bars indicate mean. Data are from nine donors. (B) Expression of Helios (left)
and CTLA-4 (right) by the indicated TH and Treg cell subsets. Data are from three or five donors.
(C) CFSE-labeled CD4+CD25– responder T cells were cultured with autologous monocytes + antiCD3 (OKT3) in the presence or absence of the indicated sorted Treg cell subset at a 1:1
suppressor/responder ratio. Numbers indicate the frequency of proliferating CFSElo T cells after 5
days of culture. Data are representative of three independent experiments.
Figure 3. TH17-like and TH1-like Treg cells co-produce pro- and anti-inflammatory
cytokines.
(A) Representative flow cytometric analysis of IL-10, IL-17 and IFN-γ production by sorted TH
(left) and Treg (right) cell subsets stimulated for 5h with PMA/ionomycin. (B) Frequency of ILPage 25 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
17-, IL-10- and IFN-γ-producing cells among gated FOXP3+ Treg cells in each of the indicated
Treg cell subsets. Each symbol represents one donor; horizontal bars indicate the mean. Data are
from ten donors. *P <.0.05; ***P < 0.001 (ANOVA). (C) Frequency of IL-10-producing cells
among IL-17+ cells in TH17 cells or TH17-like Treg cells (left), or among IFN-γ+ cells in TH1 cells
or TH1-like Treg cells (right). Data are from ten donors. ***P < 0.001 (two-tailed paired t test).
Figure 4. TH17-like and TH1-like Treg cells express the lineage-specifying transcription
factors RORγt and T-bet.
(A) Quantitative RT-PCR analysis of RORγt (RORC), T-bet (TBX21) and GATA-3 (GATA3)
expression by the indicated TH and Treg cell subsets. AU, arbitrary units. Data are mean ± SEM of
seven donors. (B) Flow cytometric analysis of IFN-γ, IL-17, T-bet and RORγt expression by sorted
naïve T cells (T naïve), TH17-like and TH1-like Treg cells stimulated for 5h with PMA/ionomycin.
Data are representative of three independent experiments.
Figure 5. TH17-like and TH1-like Treg cells are phenotypically and functionally stable.
(A) Quantitative RT-PCR analysis of RORγt (RORC), T-bet (TBX21) and FOXP3 (FOXP3)
expression by the indicated TH and Treg cell subsets after 9 days of in vitro expansion. AU,
arbitrary units. Data are mean ± SEM of four donors. (B) Flow cytometric analysis of FOXP3,
IFN-γ, IL-17 and IL-10 expression on expanded TH17-like and TH1-like Treg cells stimulated for
5h with PMA/ionomycin. Data are representative of four independent experiments.
Page 26 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Figure 6. Constitutive activation of human Treg cells.
(A) Expression of ICOS (left) and Ki-67 (right) by the indicated TH and Treg cell subsets. Data are
from five donors. (B) Flow cytometric analysis of ICOS and Ki-67 expression by the indicated
Treg cell subsets. Data are representative of four donors. *P <.0.05; **P<0.01; ***P < 0.001
(ANOVA).
Figure 7. C. albicans and CMV-specific Treg cells are present in TH17-like and TH1-like
subsets. (A) Proportion of CFSElo cells (that had undergone 3 or more divisions) among the
indicated TH and Treg cell subsets following 6 days of stimulation with autologous monocytes
pulsed with C. albicans or HCMV antigens. Each symbol represents one donor; small horizontal
bars indicate the mean. Data are from seven (C. albicans) or five (CMV) donors. (B) Flow
cytometric analysis of cytokine production by gated CFSElo C. albicans-specific TH and Treg cells
following restimulation with PMA/ionomycin for 5h. Data are representative of three independent
experiments using three different donors.
Page 27 of 27
From www.bloodjournal.org by guest on June 12, 2017. For personal use only.
Prepublished online March 21, 2012;
doi:10.1182/blood-2011-11-392324
Functionally distinct subsets of human FOXP3+ Treg cells that
phenotypically mirror effector T H cells
Thomas Duhen, Rebekka Duhen, Antonio Lanzavecchia, Federica Sallusto and Daniel J Campbell
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not yet
appeared in the paper journal (edited, typeset versions may be posted when available prior to
final publication). Advance online articles are citable and establish publication priority; they are
indexed by PubMed from initial publication. Citations to Advance online articles must include
digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.