Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Replication and Recombinantion
Document related concepts
DNA sequencing wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA profiling wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
Transcript
Isaiah 33:22 22 For the Lord is our judge, the Lord is our lawgiver, the Lord is our king; he will save us. ©2000 Timothy G. Standish Replication and Recombination Timothy G. Standish, Ph. D. ©2000 Timothy G. Standish The Information Catch-22 “With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination.” Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p 20 ©2000 Timothy G. Standish DNA Replication: How We Know There are three Conservative - Old ways in which DNA could be replicated: Semi-conservative Old strands serve as templates for new strands resulting in double-stranded DNA made of both old and new strands double-stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new Dispersive - In strands together which sections of the old strands are dispersed in the new strands + + or + + ©2000 Timothy G. Standish The Meselson-Stahl Experiment OH N The Meselson-Stahl experiment N N N N demonstrated that replication is semiconservative OH H This experiment took advantage of the fact that nucleotide bases contain nitrogen Thus DNA contains nitrogen The most common form of nitrogen is N14 with 7 protons and 7 neutrons N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit HO P O H2 O ©2000 Timothy G. Standish The Meselson-Stahl Experiment Transfer to normal N14 media Bacteria grown in N15 media for several replications The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semiconservative model must be true. After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Prediction after 2 or more replications X X X ©2000 Timothy G. Standish Stages of Replication Replication can be divided into three stages: 1 Initiation - When DNA is initially split into two strands and polymerization of new DNA is started 2 Elongation - When DNA is polymerized 3 Termination - When the new strands of DNA are completed and some finishing touches may be put on the DNA Both elongation and termination may involve proofreading of the DNA ensuring that mutations are not incorporated into newly formed DNA strands ©2000 Timothy G. Standish Tools of Replication Enzymes are the tools of replication: DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other Primase - Provides an RNA primer to start polymerization Ligase - Joins adjacent DNA strands together (fixes “nicks”) ©2000 Timothy G. Standish More Tools of Replication Helicase - Unwinds the DNA and melts it Single-Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase Gyrase - A topisomerase that relieves torsional strain in the DNA molecule Telomerase - Finishes off the ends of DNA strands ©2000 Timothy G. Standish Initiation Initiation starts at specific DNA sequences called origins (Ori C = origin in E. coli chromosomes) Long linear chromosomes have many origins First the origin melts (splits into two single strands of DNA) Next primers are added Finally DNA polymerase recognizes the primers and starts to polymerize DNA 5’ to 3’ away from the primers ©2000 Timothy G. Standish Initiation - Forming the Replication Eye Or Bubble Origin of Replication 5’ 3’ 3’ 5’ Replication eye or replication bubble 3’ 5’ 5’ 3’ 3’ 5’ 5’ 5’ 3’ 3’ 5’ 3’ 3’ 5’ 5’ 3’ ©2000 Timothy G. Standish Large Linear Chromosomes Have Many Origins Of Replication Origins of Replication 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ ©2000 Timothy G. Standish Extension - The Replication Fork 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ Primase - Makes RNA primers Lagging Strand Okazaki fragment 5’ RNA Primers 3’ 5’ Single-strand binding proteins Prevent DNA from reanealing DNA Polymerase 5’ 3’ Helicase Melts DNA Leading Strand 5’ 3’ ©2000 Timothy G. Standish Extension - Okazaki Fragments 5’ 3’ Okazaki Fragment DNA Pol. 3’ 5’ RNA Primer DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. 5’ 3’ DNA Pol. RNA and DNA Fragments 3’ 5’ RNA Primer DNA Polymerase falls off leaving a nick. 5’ 3’ Ligase 3’ 5’ RNA Primer Nick The nick is removed when DNA ligase joins (ligates) the DNA fragments. ©2000 Timothy G. Standish The Role of DNA Gyrase Helicase ©2000 Timothy G. Standish The Role of DNA Gyrase Supercoiled DNA Gyrase Helicase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish The Role of DNA Gyrase Gyrase ©2000 Timothy G. Standish E. coli DNA Polymerases E. coli has three identified DNA polymerases, each of which has significantly different physical characteristics and roles in the cell Polymerase I II III 5’- 3’ Polymerization Yes Yes Yes 3’-5’ Exonuclease Yes Yes Yes 5’-3’ Exonuclease Molecules/cell Major function Yes 400 Proofreading/ Removal of RNA primers No ? Repair of damaged DNA No 15 Replication polymerization 10 subunits 600,000 daltons ©2000 Timothy G. Standish Mutation When Mistakes Are Made 5’ DNA Pol. 5’ 5’ DNA Pol. 3’ to 5’ Exonuclease activity 5’ 3’ DNA Pol. 3’ 5’ 3’ 5’ ©2000 Timothy G. Standish Mutation Excision Repair 5’ 3’ 3’ 5’ 5’ 3’ 3’ EndoNuclease 5’ ©2000 Timothy G. Standish Mutation Excision Repair 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ EndoNuclease 5’ Nicks DNA Pol. 3’ 5’ ©2000 Timothy G. Standish Mutation Excision Repair 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ EndoNuclease 5’ DNA Pol. 3’ 5’ ©2000 Timothy G. Standish Mutation Excision Repair 5’ 3’ 3’ 5’ 5’ 3’ 3’ EndoNuclease 5’ Nicks 5’ 3’ Ligase 3’ 5’ Nick ©2000 Timothy G. Standish Telomerase At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from Telomere 5’ 3’ 3’ 5’ Degradation of RNA primer at the 5’ end 5’ 3’ 3’ 5’ Next replication 5’ 3’ 3’ 5’ + 3’ 5’ 5’ 3’ ©2000 Timothy G. Standish Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length Telomerase 5’GACCGAGCCTCTTGGGTTGGGGTTG 3’CTGGCTCGG AACCCCAAC RNA ©2000 Timothy G. Standish Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length Telomerase 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG AACCCCAAC RNA ©2000 Timothy G. Standish Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length Telomerase 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG AACCCCAAC RNA ©2000 Timothy G. Standish Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG Guanine Guanine ©2000 Timothy G. Standish Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG DNA T GGGGTTG 3’GTTGGGG T Pol. 3’CTGGCTCGG ©2000 Timothy G. Standish Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing Endo5’GACCGAGCCTCTTGGGTTGGGGTTGGGG DNA T nuclease T AGAACCCAACCCGTTGGGG Pol. 3’CTGGCTCGG ©2000 Timothy G. Standish Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG 3’CTGGCTCGGAGAACCCAACCC Endonuclease ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model Homologous chromosomes Meiosis Prophase I ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model Exonuclease Double strand break ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model Exonuclease ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model Exonuclease ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model Exonuclease ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase ©2000 Timothy G. Standish The Current Eukaryotic Recombination Model ©2000 Timothy G. Standish Holliday Structure ©2000 Timothy G. Standish Holliday Structure Bend ©2000 Timothy G. Standish Holliday Structure Bend Twist ©2000 Timothy G. Standish Holliday Structure Cut ©2000 Timothy G. Standish Holliday Structure Cut ©2000 Timothy G. Standish Holliday Structure Cut ©2000 Timothy G. Standish Holliday Structure Cut ©2000 Timothy G. Standish Holliday Structure ©2000 Timothy G. Standish Cutting The Holliday Structure ©2000 Timothy G. Standish ©2000 Timothy G. Standish
