* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Unit 6 Protein Synthesis
Gel electrophoresis of nucleic acids wikipedia , lookup
Promoter (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Expanded genetic code wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Molecular cloning wikipedia , lookup
Community fingerprinting wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Genetic code wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Bell Ringer-Definitions PG 86 Transcription- to copy Codon- sequence of 3 DNA or RNA nucleotides Anticodon- region of tRNA that is a sequence of 3 bases that are complementary to a codon in the mRNA mRNA- messenger RNA; copies directions from DNA takes them to ribosomes tRNA- transfer RNA; picks up certain AA & brings them to the ribosome for assembly Translation- DNA protein Mutation- changes in DNA codes (harmful, helpful, no effect) Gene mutation- reproductive cells, body cells, point (single base), frame shift (inserted or deleted) Unit VI – Protein Synthesis Protein Synthesis The Story of the Ribosome Target REVIEW: Describe the structure of the DNA molecule REVIEW: Distinguish between genes and chromosomes Explain how DNA codes for proteins and how these proteins lead to traits Compare and contrast DNA and RNA Describe the specific roles of mRNA and tRNA in the making of a protein How do we get actual traits from DNA? Pg 87 Our heritable traits are determined by the proteins that we make (including our enzymes) Example: a gene in DNA has directions for how to build melanin…melanin gives you your skin coloration gene protein trait Rules for Building a Protein PG 87 1) DNA cannot leave the nucleus 2) Must have a messenger to get code from DNA & take it to ribosome (mRNA) 3) Proteins are made from amino acids (AA’s) (tRNA) Both DNA & RNA are needed to build a protein PG 87 Although they are similar there are some important differences: DNA 2 strands Deoxyribose sugar Thymine (T) binds with A RNA 1 strand Ribose sugar Uracil (U) binds with A RNA How does RNA differ from DNA? 1 strand U not T ribose What types of RNA are there? PG 87 mRNA (messenger RNA) - copies the directions from DNA & takes them to the ribosomes (TRANSCRIPTION) tRNA (transfer RNA) - picks up certain AA’s & brings them to the ribosome for assembly (TRANSLATION) DNA Triplets- called codons RECAP DNA RNA Double stranded Single stranded Deoxyribose sugar Ribose sugar Thymine (T) pairs with Adenine Uracil (U) pairs with Adenine Cannot leave nucleus Must have a messenger to get code from DNA and take to Ribosome Elbow Partner Work 5 mins Page 91: Comparison of RNA & DNA Without using your notes try to answer the blanks given to you. Once you are finished, you may use your notes to check your answers! Make sure to study this for your quiz on FRIDAY Construction workers We will go over this together. You can try to fill it out first though (in pencil) How does mRNA know how to copy DNA? PG 87 DNA triplets match up with sets of 3 mRNA bases…called codons (write this under or above squiggly line) If DNA says this…what will mRNA be? TAC – GGA – CTT – GAT – ACA – ATT AUG – CCU – GAA – CUA – UGU – UAA How does mRNA know which AA’s to assemble? PG 87 tRNA carries a code of 3 letters called an anticodon that pairs up with the codons of mRNA Make a tRNA row under mRNA If mRNA says this…what will the tRNA’s be? AUG – CCU – GAA – CUA – UGU – UAA UAC – GGA – CUU – GAU – ACA – AUU How does mRNA know which AA’s to assemble? PG 87 Each tRNA can only pick up one specific AA When it matches up with the codon, it brings along its AA rRNA- ribosomal RNA, essential for protein synthesis in ALL living organisms (write this somewhere on your page!) If tRNA says this…what will the AA’s be? UAC – GGA – CUU – GAU – ACA – AUU Met – Pro – Glu – Leu – Cys - Stop HOW did I get the AA’s? We look at the mRNA codon for the code. These are what the tRNA will pick up PG 89 Use a chart to find order of AA’s: Which AA is: CGU Arg AUC Iso PG 89Use a chart to find order of AA’s: Which AA is: UCA Ser GAG Glu RECAP DNA RNA Double stranded Single stranded Deoxyribose sugar Ribose sugar Thymine (T) pairs with Adenine Uracil (U) pairs with Adenine Cannot leave nucleus mRNA- convey genetic information from DNA to the ribosome Must have a messenger to get code from DNA and take to Ribosome tRNA- helps decode a mRNA sequence into a protein rRNA- essential for protein synthesis in all living organisms. Practice Makes Perfect PG 89 Work on your DNA sequencing (INDIVIDUALLY) when you are finished, raise your hand so I can come check your work 8 Minutes! We will go over it so there is no confusion! If you finish early, go to page 93! Read the information and start working on the worksheet! If you do not finish, this is homework!!!!! Page 89 DNA Strand 2: ATG-GGA-TTC-CGT-GCC-ATT-TAA mRNA STRAND (Codon Sequence): AUG-GGA-UUC-CGU-GCC-AUU-UAA ANTICODON SEQUENCE (tRNA): UCA-CCU-AAG-GCA-CGG-UAA-AUU PROTEIN SEQUENCE (Amino Acid): MET-GLY-PHE-ARG-ALA-ISO-STOP Bell Ringer- Definitions PG 86 Polypeptide- chains of AA’s, proteins are made up of one or more of this! Ribosome- an organelle responsible for production of protein in all living things Protein- macromolecules, consisting of one or more long chains of AA residues Triplet- group of 3 bases, codes for a specific AA Amino Acid- organic compound with Amine & Carboxylic acid functional groups, usually along with a side-chain specific to each AA Protein Synthesis PG 88 Transcription (“to copy”) mRNA goes to nucleus & copies DNA code for one gene mRNA takes the copy to the ribosome in the cytoplasm Protein Synthesis PG 88 Translation (“DNA” to “protein”) Ribosome uses mRNA copy to look for certain tRNA’s (ones with correct anticodon) tRNA’s pick up specific AA’s & bring them to ribosome when they are needed AA’s are pulled off tRNA’s & attached to the growing protein chain Protein Synthesis PG 90 Name the process: Transcription Translation Protein Synthesis PG90 Name the parts: DNA mRNA tRNA Amino Acid Protein Ribosome Protein Synthesis PG 88 write this on the page on the sides (or near name) Changes in DNA code may be harmful, helpful, or have no effect If instructions for cell division are affected, this can lead to cancer! Point Mutation A change in a single DNA base may or may not affect the AA sequence Frameshift Mutation (have the greatest affect!) Codons shift when a single base is inserted or deleted, this changes the AA sequence RECAP Transcription- means to copy mRNA nucleus copies DNA code for one gene Translation- makes DNA into protein Ribosomes use mRNA copy to look for certain AA’s and RNA’s tRNA pick up specific AA take them to ribosome when needed AA’s pulled off tRNA attach to growing protein chain https://www.youtube.com/watch?v=itsb2SqR-R0 Bell Ringer-do this on page 86 or 89 For each DNA strand give the mRNA, tRNA, & AA DNA: TACACCTTGGCGACGACT DNA: TACACCTTGGCGACTACT DNA: TACACCTTGGGACGAACT DNA: TACGACCTTGGCGACGACACT Intro to Gene Mutations https://www.youtube.com/watch?v=GieZ3pk9YVo Gene Mutations PG 95 Sometimes mutation (errors) occur Changes in DNA code may be harmful, helpful, or have no effect EXP= If instructions for cell division is affected, can lead to cancer (uncontrolled cell growth) Cancer Gene Mutations PG 95 May occur in reproductive cells (gametic cells) Affects offspring, not you …Or in “body cells”(somatic cells) Affects you, not offspring Gene Mutations PG 95 Point Mutations A change in a single DNA base THE DOG BIT THE CAT THE DOG BIT THE CAR This may or may not change the protein that is made (some AA’s have more than one code) Gene Mutations PG 95 Point Mutations Point Mutation Exp Gene Mutations PG 95 Frameshift Mutations AA’s shift when a single base is inserted or deleted THE DOG BIT THE CAT THE DOB ITT HEC AT (deletion) THE DOQ GBI TTH ECA (insertion) Gene Mutations PG 95 Frameshift Mutations Uner Tan Syndrome Progeria Mutations Hypertrichosis Epidermodysplasia verruciformis Polycystic Kidney Disease Sickle Cell Disease RECAP Gene mutations Changes in the DNA sequence Point mutations Single base change in AA sequence Frameshift mutations (have the greatest affect) Inserted base in AA sequence Deleted base in AA sequence BELL RINGER- INDIVIDUAL WORK Work on page 93-get a stamp when you are finished When you are finished work on page 92 (practicing mRNA) write down the mRNA sequence & the protein sequence (amino acid) – get a stamp Work on page 94 this is a grade! Add this question to your review: (next slide) Add this question to your review Which mutation would change the greatest number of AA’s in a protein? The deletion of a single Adenine nucleotide in the middle of a gene The substitution of a Thymine nucleotide with a Cytosine nucleotide near the beginning of a gene The addition of the nucleotides that make up an additional stop codon to the end of a gene The insertion of 3 bases, such as a Thymine, a Guanine, and an Adenine nucleotide in that order at the start of a gene