Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Protein Expression Systems Bacterial Cell-free Yeast Mammalian Insect Protein Expression in Bacteria 1. Advantages/disadvantages 2. Genetic elements essential for the expression 3. Cloning strategies 4. Overview of the available expression systems and expression strains 5. Design of cloning procedures using the VNTI program Advantages • Fast growth • Cheap medium and equipment for growing • Good knowledge of the host Disadvantages Limitation for expression of eukaryotic proteins due to: • different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs. • differences in post-translational modifications (SS bonds, glycosylation etc) Disadvantages Accumulation of lipopolysaccharides (generally referred to as endotoxins) … Goals To obtain as much as possible /good expression+good cell growth soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression=danger of aggregation, decreased cell growth Genetic Elements Essential for Expression RBS, START, and STOP Ribosome Bindind Site (RBS): RBS RBS 5-9 n START GAAGGAATTCAGGAGCCCTTCACCATG ... ... START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TGA (UGA), TAA (UAA) Genetic Elements Essential for Expression Promoters Host’s promoters 2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD - Regulation of expression Promoters from phages T7, T3, SP6, T5, PL - Highly efficient and specific expression Plac: Regulation Plac, Ptac, Ptrc: Characteristics Level of expression (inductor) Plac Low level up to middle (IPTG) Ptac Moderately high (IPTG) Ptrc (trp-lac) Key features Weak, regulated. Suitable for expression of gene products at very low intracellular level. Comparatively expensive induction. High-level, but lower than T7 system. Regulated expression still possible.Comparatively expensive induction. High basal level. PPBAD: Regulation PPBAD and RhaPBAD Level of expression (inductor) Key features PPBAD Variable from low to high level (L-arabinose) Can fine-tune expression levels in a dose-dependent manner. Tight regulation possible. Low basal level. Inexpensive inducer. rhaPBAD Variable from low to high level (L-rhamnose) Tight regulation. Low basal activity. Relatively expensive inducer. Phage Promoters Level of expression (inductor) Key features T7 Very high Utilizes T7 RNA polymerase. T5 High Utilizes E. coli RNA polymerase. PL Moderately high (temperature shift) Temperature-sensitive host required. Less likelihood of "leaky" un-induced expression. Basal level; high basal level by temperatures below 30°C. No inducer. Combinations Genetic Elements Essential for Expression Replication Origin Plasmid Replicon Copy Number pBR322 pMB1 15-20 pUC pUC 500-700 pACYC p15A 18-22 pSC101 pSC101 5 colE1 colE1 15-20 Co-expression from two plasmids Protein Expression in Bacteria Part2 1. Cloning strategies 2. Overview of the available expression systems and expression strains 3. Design of cloning procedures using the VNTI program Types of Expression Vectors 1 2 3 Insertion into Transcriptional Vectors Insertion into Translational Vectors Cloning Using Restriction Enzymes NcoI HindIII Cloning Using A-overhangs TA-Cloning with Topoisomerase Directional Cloning CACC Gateway Technology Expression of Fusion Proteins We may fuse the target protein with • various tags to facilitate its purification or detection HHHHHH-target, epitope-target • highly soluble proteins to improve solubility and to facilitate purification Thioredoxin-target, GST-target • signal peptides or other proteins or domains to promote secretion SP-target ‘Short’ Fusion Protein Construction ATG CAT CAC CAT CAC CAT CAC ‘Long’ Fusion Protein Construction NcoI HindIII HindIII PstI pUC18/19 ApaLI (178) ALPHA P(BLA) HindIII (400) ApaLI (2367) PstI (416) XbaI (424) BamHI (430) AvaI (435) APr pUC18 2686 bp XmaI (435) SmaI (437) EcoRI (451) P(LAC) ORI ApaLI (1121) Transcriptional vector pTrc99 Translational vector pQE Translational vector + CDR pET pCR&pEXP pBAD Expression strains # Strain 1 BL21 2 BL21* /STAR Key features Deficient in lon and ompT proteases #1 + deficient in RNaseE Improves the stability of mRNA transcripts and increases protein expression yield 3 BL21*(DE3) #1 or 2 + carry T7 polymerase under Plac Enables T7 expression 4 BL21*(DE3)pLysS/E #3 + plasmid pLysS or pLysE expressing T7 lysozyme Reduces basal expression of recombinant genes 5 BL21-AI 6 BL21 CodonPlusRIL 7 BL21 trxB #1 + carry T7 polymerase under PPBAD (araBAD) Enables T7 expression with tight regulation #1 + Enhances the expression of eukaryotic proteins that contain codons rarely used in E. coli: AGG, AGA, AUA, CUA #1 + deficient of trxB Facilitates cytoplasmic disulfide bond formation Expression optimization To optimase: Level of inducer (e.g. arabinose) Time of induction Temperature of the induction step (popular - 18oC overnight)