Download ppt - Language Log

Genetics: The source of
variability for evolution
How population survival strategies
determine human biology and
provides the basic background for
human variation
What does the genetic material do, anyway?
1. Transmits genetic information from one generation
to the next (for example, in spite of the fact that all living
things have the same genetic materials that govern their
development, humans always produce human infants and
not baby rats or elephants).
2. Since every cell in the body (with several
exceptions) has more or less the same genetic material as
the original cell (the fertilized egg), the genetic material
must be able to reproduce itself when new cells are
produced during growth and development as well as
normal body maintenance.
3. The genetic materials are organized around a
sequence of chemical ‘bases’ that encode for the synthesis
of proteins, a huge class of chemicals that perform a wide
range of functions in the body.
A major function of the DNA:
coding for the synthesis of proteins
• While the functions of the genetic material located
on the chromosomes are numerous and
complicated, for our purposes, we can examine the
major function: that of the synthesis of proteins.
• Proteins are a very large class of molecules which
perform a huge array of functions in living things.
It has been estimated that there are over 60,000
different proteins in the human body, only about
1500 of which have been identified.
• Proteins differ from one another, and thus perform
differently, based on their organization and
makeup.
Proteins: what distinguishes one
from another?
1. Proteins are composed of
chains of amino acids
(Polypeptide chains).
2. Polypeptide chains have
variable lengths.
3. The sequence of amino acids
along the chains vary.
4. Proteins can be made up of
one or, more usually, two
or more chains of amino
acids.
5. Proteins have a folded three
dimensional structure
Amino Acids: What are they and where do they
come from?
Glycine (gly)
(glu)
Alanine (ala)
Valine (val)
Leucine (leu)
Threonine (thr)
Lysine (lys)
Glutamine (gln)
Methionine (met)
Tryptophan(trp)
Histidine (his)
(phe)
• Chemical group
Glutamic acid
based on their
composition: an
Aspartic acid (asp)
“amine” and an
Isoleucine (Ile)
“acid”
Serine (ser)
• Of the 20 common
Proline (pro)
amino acids:
Arginine (arg)
Aspargine (asn)
Cysteine (cys)
Tyrosine (tyr)
Phenylalanine
– 12 the body can
make
– 8 (or 9) must be
obtained from foods
(these are the
essential amino
acids)
What is a gene?
• A “recipe” for a protein, or
more accurately, for a
single polypeptide chain.
• Located at a specific
region (locus) on a
specific chromosome
• Implications:
different chromosomes
carry different
information
• Obvious Question:
do homologous
chromosomes carry the
same information?
DNA
• Double helix structure
• Biochemically:
– Deoxyribose sugar
– Nucleic Acids
purines:
adenine, guanine
pyrimidines: thymine, cytosine
• Base pair rules:
c g
a t
Genes and their protein products:
How does a gene “code” for a protein?
What is the process by which the structure of
DNA determines the structure of a protein?
• For example, how is a segment of coding DNA
translated?
DNA bases:
• CCTGAGGAG
• GGACTCCTC
The genetic code
• 1. Only one strand of DNA is the ‘recipe’, or
code
• The “genetic code” :
three sequential nucleic acids (a codon)
specify for a specific an amino acid
• DNA: CAAGTAGAATGCGGACTTCTT
• AA: val his leu thr pro glu glu
Code to Protein: Shuttle system
• Because the synthesis of an amino acid
polypeptide chain takes place in the cell proper
and not in the cell nucleus, the code must be
copied and transported to this site.
• A messenger transmits DNA sequence to protein
assembly site:
– messenger RNA (Ribose Nucleic Acid)
• distinct from DNA: single strand C G A (Uracil,
“U”, substitutes for “T”)
– self-assembles as it “reads” the DNA by base-pair rules
– goes to ribosome, site of protein assembly
Case Study: Genetics in action at
the level of
the population
•
Sickle cell anemia
•
Background:
1. 1912 James Herrick:
•
Case Report
Blood smear analysis
2. 1940’s family
studies:
•
•
Mendelian genetics
Geographic distribution
Red Blood Cells:
What do they do?
• Origin in bone marrow
– 120 day life cycle
• Oxygen-carriers
– Pick up oxygen in
lungs
– Deliver oxygen to
body tissues
• By what mechanism?
Rbcsinblood on top half
alvertonoutpouch on bottom
The Protein Hemoglobin
• A protein in red blood cells
(RBCs).
• Helmoglobin functions in the
transport of oxygen from the
lungs to body cells.
• Like almost all proteins, its
structure is part of the code
carried by the chromosomes
in the nucleus.
• How does hemoglobin carry
Oxygen?
The function depends on structure:
How hemoglobin works
• Three dimensional
• Four components:
– Two “alpha” chains
• chromosome 16
– Two “beta” chains
• chromosome 11
• Red marks the spot!
– Where oxygen binds
– Iron ion critical here
• Hemoglobin: Structure
Sickle Cell Anemia
• Sickle Cell:
– red blood cell shape
• Anemia:
– poor oxygen delivery
• Cause:
– abnormal hemoglobin based on
an amino acid substitution on the
Beta chain.
• It is thus a genetic disease.
• There are many other anemias
which have other bases,
including iron deficiency and
protein deficiency anemias,
both of which have mainly
environmental causes.
Hemoglobin “S” vs Hemoglobin “A”
(Sickle [S] vs Normal [A])
First 6 amino acids:
• Beta globin gene:
Valine
Valine
Histidine
Histidine
Leucine
Leucine
Threonine
Threonine
Proline
Proline
Glutamic acid
Valine
A
S
– 146 amino acids
• Hbs beta globin chain
– one different amino
acid
– valine replaces
glutamic acid at
position 6
What causes the sickling?
• Under certain kinds of stress
(high altitude, for example), The
hemoglobin molecule changes
shape
• This results in distortion of
RBC
• This produces major functional
effects in the ability of the RBC
to carry oxygen as well as to
effectively move through the
smallest vessels of the arterial
system, the capillaries.?
Why does the hemoglobin do this?
• WHEN: Abnormal
hemoglobin molecule
unstable under
conditions of low
oxygen, high acidity
•HOW: Crystalline
structure results
•WHY? Structural
instability
Why is the frequency of HbS
high in some populations?
Population Frequency of HbS
• In Africa
– In a broad swath across
central Africa, 1 in 5 people
are carriers.
– They have the HbS/HbA
genotype; they are
heterozygous
(hetero=different)
– The expression of Beta
hemoglobin is a codominant trait:
both proteins are expressed
Heterozygote vs
Homozygote?
Dominant
vs recessive?
HbS and adaptation:
• In a population of 100 individuals, calculate
the number of HbS and HbA alleles if 20 %
of the people are heterozygotic and the rest
are homozygotic normal.
• What is the percentage of HbS and HbA
genes in the population?
• Why do you think there are no HbS/HbS
individuals?
Genes vs genotype
•
•
•
•
•
•
In 100 individuals
genotype
genes
20 are HbS/HbA = 20 HbS
+ 20 HbA
80 are HbA/HbA =
160 HbA
20 HbS
180 HbA
20/200 = 10% HbS and 180/200=90% HbA
Thus, the gene frequency of HbS is .1 (10%)
And the gene frequency of HbA is .9 (90%)
Given that HbS/HbS is usually lethal, it would be
expected that the frequency of HbS would decrease
over time, but in fact, these frequencies remained stable
generation after generation.
An Environmental factor:
Malaria
Disease is:
• Mosquito-borne
• A parasite is introduced
into the host when blood
is taken. One of the most
deadly of many forms of
malaria is:
– Plasmodium
falciparum
Illness is often fatal, with
symptoms like:
– High fever
– rigor
– sweats
• High mortality
– very high in infants and
children
(It has been estimated for
example that each year
around the world more than
20 million children die of
malaria).
Malaria in Africa
• Symptoms:
– fever, rigor, sweats
• Disease organism:
Parasite: Plasmodium
falciparum
gambia
vivax
malariae
• Vector: Mosquito
– Anopheles gambiae vs
– Anopheles funestus
Malarial Illness and Parasite
• Illness intensity
related to parasite
density
– Fewer parasites, less ill
• Mechanisms to
decrease parasites:
– kill mosquitoes (DDT)
– interrupt parasite
lifecycle (anti-malarial
drugs)
– change the microenvironment of the
parasite in the body
• parasite needs oxygen
How to make the body inhospitable for the
parasite and increase the likelihood of
individual human’s survival
• Decrease available
oxygen to parasite
• Within limits set by
the survivability of the
host
• Red blood cell
biochemistry
Natural Selection and the introduction of a new
agricultural technique
• About 2000 years ago, several new domestic
plants (banana, taro, yams and coconuts) were
introduced into Central Africa from Malaysia.
• This area, because of its poor soils, was not
cultivated prior to this time and the local
populations were gatherer/hunters.
• In this environment, only slash and burn
agricultural methods would work. This resulted in
the forest clearing and a markedly more open
environment.
New Environment: New Mosquitoes
• Prior to the changes brought about by slash and
burn agricultural methods, the local mosquito was
Anopheles funestus, which breeds in shade and
uses bovids (antelopes) as its main host.
• After the changes from slash and burn, there was
much more open land and standing water, leading
to the spread of a new mosquito, Anopheles
gambiae, from West Africa. This animal breeds in
sun and uses humans as its primary host.
• As a result, more people contracted malaria, and
high mortality followed.
• Thus, a mutation that introduced HbS would be
selected for as a means of conferring some
resistance against this deadly disease.
A New Mutation: HbS
Mutations are random and occur in all populations.
In the case, individuals with traits that are
adaptive in the face of parasites have a better
chance to reach adulthood.
In central Africa, HbS/HbA individuals:
1. Parasites use host oxygen, causing conditions
resulting in sickling of red blood cells
2. Anemia is detrimental to parasite survival
3. Parasite numbers decrease, individual improves
An example of natural selection
Many solutions to the malaria
problem
• In Southeast Asia, the disease thalassemia
represents a similar outcome of selection for
hemoglobin variants
• In the Mediterranean, other red blood cell
enzyme errors
• The heterozygote has the advantage
How are new genes introduced into
populations?
• By random mutations that occur in all populations
at all times. Mutations DO NOT happen because
the new variation is needed to better adapt a
population to its environment. Most mutations are
deleterious and do not survive in a population
• New genes are also introduced by people.
• Migration into and out of populations: people take
their genes with them, an example of gene flow
• For example, the relative frequency of HbS in the
populations of African descent in the United States
has decreased in the past two centuries as a result
of intermixture with other populations, as well as
selection against the allele in a non-malarial
environment.
Review 1: Sickle cell anemia
• Random mutation (beta hemoglobin
gene: chromosome 11, at position
six), producing the sickling allele.
• This modification results in a RBC which
changes shape when it deoxygenates in
the terminal capillaries.
• The sickled RBCs limit smooth blood
flow, preventing tissues from being
properly oxygenated.
Review 2: Sickle cell anemia
• Those who are homozygous for the
sickling allele (Hb S / Hb S) usually die
from the effects of sickle cell disease prior
to reaching adulthood. This is known as
sickle cell anemia.
• Those who are heterozygous for the
allele suffer periodic bouts but can live a
relatively normal adult existence. This
form is known as sickle cell trait,
Review 3: Sickle cell anemia
• In an environment without any selection
favoring the sickle cell allele, it would be
maintained at a very low frequency via
mutations and, potentially, gene flow.
• This is the situation in many human
populations in non-malarial environments.
Review 4: Sickle cell anemia
• In Central Africa, 2000 years ago, new
domesticated plants (banana, coconut,
yams and taro) were introduced into the
area inhabited by gatherer/hunters.
• Slash and burn agriculture was necessary in the poor soils, which, over time,
dramatically changed the environment,
and bringing about a replacement of the
Anopheles funestus mosquito by the
West African A. gambiae.
Review 5: Sickle cell anemia
• The introduction of this new mosquito,
which overwhelmingly uses humans as
hosts, brought about the spread of a
deadly form of malaria, Plasmodium
falciparum.
• Heterozygous individuals, by lowering
the Oxygen content of their blood, are
able to limit the reproductive capacity of
the malarial parasite.
Review 6: Sickle cell anemia
• As a result of selection favoring the
heterozygote, a balanced polymorphism
evolved in this part of Africa with the
allele frequency of Hb s reaching 10%.
• When the environment changed (spraying with DDT, for example) or when
Africans left this area, the frequency of
the allele decreased, but never to zero.
• An example of human micro-evolution.
Concepts you should know and understand after our
discussions:
I. Basic Genetics
•
•
•
•
•
•
•
•
The differences between chromosomes, gene, allele
How cell division occurs
Meiosis
DNA, RNA and the process of protein synthesis
How mutations, recombination, translocation effect this
Codon
The relationship between nucleic acid, amino acid, protein
The human karyotype: autosomes, sex chromosomes
Concepts you should know and understand after our
discussions: II. How genetics works in populations
• The specific case of sickle cell anemia:
– An example of a mutation that became advantageous to a
population
– The specifics of the mutation, the structure and function of
hemoglobin, how it affects the red blood cell, and the effects for
the individual
• The selective pressure of malaria:
– The nature of the disease, the organism that causes it, how it is
contracted by people; how they survive it.
• Why did malaria and sickle cell anemia evolve together in a human
population?
– An example of balanced selection
• How genetic mutation, natural selection, genetic drift and gene flow
effect a population’s gene pool
DNA Replication: Mitosis
One crucial function of the DNA is to more or
less accurately replicate itself during
ordinary cell division, so that each of the
two resulting daughter cells receive the
same complete set of 23 pairs of
chromosomes as the original parental cell.
This is accomplished by the opening of the
DNA helix and each single strand
reproducing its complement to form two
sets of the complete double helix.
DNA self-replication