Download Ex vivo analysis of splicing assays

Title: Ex vivo analysis of splicing assays
Authors: Isabel Cristina López Mejía and Jamal Tazi
Affiliation : Institut de Génétique Moléculaire de Montpellier UMR 5535 CNRS, 1919
route de Mende, 34293 Montpellier cedex 5, France; Université Montpellier 2, Place
Eugène Bataillon, 34095 Montpellier cedex 5; Université Montpellier 1, 5 Bd Henry IV,
34967 Montpellier cedex 2.
ABSTRACT
It is more and more evident that a number of human diseases are due to changes in
alternative splicing patterns (Ward et al., 2009; López-Bigas et al., 2005). The question is
how to improve our understanding of new disease-causing mutations, that do not affect the
coding potential of a gene, but that affect pre-mRNA splicing.
In order to analyse precise mechanism of alternative splicing most laboratories use socalled mini-gene reporters. These reporters can easily be transfected in a large number of
cell lines. The use of a splice site can then be assayed by RT-PCR or qRT-PCR.
Ex vivo analysis of splicing assays can be an accurate, rapid and simple method to
reproduce splicing events in vivo. For example it can serve to study the effects of the
knock-down or the over-expression of any factor on the studied splicing event. For larger
screens, adapted reporters may be constructed. Splicing reactions may then be studied
without RNA isolations followed by RT-PCR reactions. After the construction of stable cell
lines, a splicing event can then be analysed on a larger scale, simply by using luciferase or
fluorescence assays for example.
In the laboratory, we have developed the two kinds of analysis to study the regulation of
one single splicing event that is responsible for the majority of the cases of one rare
disease: Hutchinson-Gilford Progeria Syndrome.
Keywords: splicing reporter, transfection, alternative splicing, HGPS.
THEORETICAL BACKGROUNG
1. Studying an alternative splicing event.
Traditionally, single alternative splicing events were analysed by in vitro splicing assays.
This cell-free strategy allows you to study splicing, and splicing only, of an RNA of your
choice.
Nevertheless, splicing substrates based on human genes, which contain large introns and
suboptimal splice sites, do not always splice efficiently in vitro.
Moreover, when you wish to study the consequence of the lack or the excess of one factor
on one single splicing event in vitro, the in vitro splicing strategy may be laborious and time
consuming.
Current laboratory cell lines, like HeLa and HEK 293, constitute living “splicing factories”
that can be used to assess the behaviour of splicing reporters after transient transfection.
These reporters carry the splicing sites to study, plus the “theoretical” cis-elements that are
required for their regulation.
Ex vivo analysis of splicing allows us to precisely study the regulation of a certain number
of alternative splicing events. Indeed, one can study directly the cis-elements (site directed
mutagenesis), and/or study the influence of different trans-factors (SR proteins, hnRNPs,
…) by cotransfection of plasmids encoding for those factors (Cáceres et al., 1994) or by
siRNA or shRNA treatment.
Our studies focus on splicing events that concern 5’ splice sites in exon 11 of LMNA gene.
Indeed, the inclusion of the 3’ fraction of exon 11 of the LMNA gene is required for the
proper posttranslational maturation of pre-lamin A. Incomplete maturation leads to a
dominant negative form that is highly cytotoxic and that is at the origin of the progeria
phenotype [Figure 1]. Splicing reporters reproducing splicing regulation that is responsible
for the progeria phenotype will be presented in this chapter in order to provide the reader
an example of ex vivo splicing analysis.
2. Transfecting adherent cell lines:
There are three main kinds of methods to transiently or stably transfect adherent cells.
1. Calcium phosphate based transfection has been used for nearly 40 years to transfect
plasmid DNA into cultured cells. DNA is introduced into the cells through an unknown
mechanism that implies the attachment of a precipitate to the cell membrane. It was
first used in 1973 (Graham et al., 1973), and is still being used, mainly because of its
low cost. It only involves plasmid DNA and simple solutions that can easily be prepared
in any laboratory.
Nevertheless, in order to achieve high transfection efficiencies, various steps of
optimization may be required. Indeed, it has been shown that transfection efficiency is
highly dependent on several parameters, for example, a very narrow PH range, CO2
concentration, the size of the complexes and the quality of plasmid DNA.
2. Electroporation involves the creation of pores in the cell’s plasma membrane by an
electric field (Wong et al., 1982; Potter, 1988). This method is commonly used for
suspension cell lines, like Jurkat cells (immortalized T lymphocytes that are difficult to
transfect with other procedures). This method can give rise to high transfection
efficiencies after optimization (Chu et al., 1987), but it requires special equipment and
very often leads to a very high level of cell death. To our knowledge, experimentalists
have had a hard time achieving a compromise between effective transfection and high
survival rate of the cells.
3. Finally, many laboratories currently use cationic lipid-mediated transfection.
DreamFectTM reagent is the commercial cationic lipid-mediated transfection reagent
that we use in the laboratory. It is based on the Tee-Technology (Triggered
Endosomal Escape). DreamFectTM contains a polyamine that ensures the interaction of
the reagent with plasmid DNA and a lipophile that ensures the interaction of the
plasmid DNA containing complex with the cell surface. The hydrophobic properties of
the complexes also facilitate the transit of the DNA from the endosomal compartment
to the nucleus.
The main advantages that we found with this reagent when compared to other
reagents is the price, the reproducibility, the broad specificity, and specially the fact that
any investigator can achieve successful transfections, especially when compared to
calcium phosphate transfection.
This reagent has also been successfully used to perform siRNA treatment, but we have
obtained better results when transfecting siRNAS with Oligofectamine Reagent
(Invitrogen): this reagent is also a cationic lipid.
PROTOCOL, EXAMPLE OF AN EXPERIMENT
1. Scientific background:
Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disorder phenotypically
characterized by
numerous features of premature aging. Most of HGPS patients carry a heterozygous silent
mutation that
activates the use of a cryptic 5’ splice site in exon 11 of LMNA pre-mRNA. This aberrant
splicing event leads to the production of a truncated protein called progerin, this protein
has a dominant negative effect which is responsible for the observed phenotype (De
Sandre-Giovannoli et al., 2003; Eriksson et al., 2003).
Both in vitro and ex vivo experiments showed that the single point mutation (1824C>T) in
exon 11 was sufficient to induce utilization of a cryptic 5’ splice site in exon 11. The
truncated splicing isoform lacks 150 nucleotides when compared to the full length splicing
isoform.
2. Reagents and solutions needed:













Dreamfect ReagentTM (OZ biosciences)
DMEM medium (GIBCO) supplemented with 10% Fetal Bovine Serum and
antibiotics
Opti-MEM medium (GIBCO)
D-PBS (GIBCO)
TRI Reagent (SIGMA), caution, this product contains phenol. Handle with extreme
caution to avoid contact and ingestion.
Chloroform
Isopropanol
Ethanol
RNase-free water or DEPC (diethylpyrocarbonate) -treated water.
First Strand cDNA synthesis kit (Amersham), contains dNTPs and random
hexamers.
Forward primer for PCR, sequence: 5’GCTTCTGACACAACTGTGTTCACTAGC3’
Reverse primer for PCR, sequence: 5’GCAGTTCTGGGGGCTCTGG3’
PCR reagents.
3. Materials





HeLa cells are our standard, but a broad range of cell lines has been used
successfully for this experiment, including HEK293, MCF-7, MDA 231, HCT-116, …
Splicing reporter: Wild type and Mutant Progeria expression clones. The aim of
presenting these plasmids is only to provide researchers with an example of this
kind of experiment, see figure 3 for a schematic figure of our mini-gene reporters
and of the anticipated result.
6-well tissue culture plates
Humidified incubator at 37°C, 5%CO2.
RNase-free microcentifuge tubes.


Refrigerated microcentrifuge.
Thermocycler.
4. Transfection protocol [Figure2]:
1- The day before transfection, seed ~ 5.105 cells per well in a 6-well plate with 1.5 ml
of complete DMEM growth medium (supplemented with 10% FBS + ATB).
2- Incubate the cells at 37°C in a CO2 incubator. The day of the transfection the cells
should be subconfluent.
3- For each well to be transfected, dilute 1µg of DNA into 100µl Opti-MEM I Reduced
Serum Medium.
4- For each transfection, dilute 4µl of DreamFectTM into 100µl Opti-MEM medium and
gently mix (do not vortex!)
Combine diluted DNA (from step 3) and DreamFectTM (from step 4), mix gently and
incubate at room temperature for 20 min to allow transfection complexes to form.
While complexes are forming, replace the medium on the cells with 0.8 ml OptiMEM medium. Never vortex or centrifuge the solutions.
Never use serum-containing media for steps 3 and 4 as serum will impede the proper
formation of complexes. .
5- Overlay the complex solution onto the cells with freshly replaced medium.
6- Incubate the cells with the complexes for 6 hours at 37°C in a CO2 incubator.
7- Following incubation, remove the transfection mixture, wash the cells with D-PBS,
and replace with complete DMEM growth medium.
8- Recover the cells for RNA or protein extraction 24 hours after addition of serum
containing medium to the transfected cells.
For protein overexpression, a minimum time of 16 to 18h of expression is usually required.
Plasmids encoding for splicing factors can then be cotransfected with the splicing
reporters. Concerning siRNA knockdown, longer incubations are usually required in order
to see an effective downregulation on Western Blots. We recommend 72 to 96 h
experiments. Splicing reporters should then be transfected from 16 to 24h before the time
of recovery of the cells.
5. RNA extraction protocol:
1- Lyse cells directly on the culture dish. Use 500 µl of TRI Reagent per well. Incubate
for 5 min at room temperature. After addition of the reagent, cell lysates should be
passed several times through a pipette’s tip to form an homogenous lysate before
recovering in 1.5 ml microcentrifue tubes (we recommend the use of cell lifters
before recovering the cell lysate). The reagent should become viscous (viscosity is
an indicator of cell lysis).
To ensure complete dissociation of nucleoprotein complexes, allow samples to
stand for 5 more minutes at room temperature. Add 100 µl of chloroform. Cover the
sample tightly, vortex vigorously for 15 seconds and allow them to stand for 10
minutes at room temperature. Centrifuge the resulting mixture at 13,000 x g for 15
minutes at 4°C. Centrifugation separates the mixture into 3 phases: a pink organic
phase (containing protein), an interphase (containing DNA), and a colourless upper
aqueous phase (containing RNA)
2- Transfer the aqueous phase to a fresh tube and add 250 µl of isopropanol and mix
(the pink lower phase may be stored for subsequent protein isolation. This is
particularly interesting if you are performing siRNA or overexpression experiments).
Allow the sample to stand for 10 minutes at room temperature. Centrifuge at 13,000
g for 15 minutes at 4°C. The RNA precipitate will form a pellet on the side and
bottom of the tube. If you think your sample contains little RNA, the addition of 1µl
of glycogen (20mg/ml) will help precipitation and the visualization of the pellet.
Remove the supernatant and wash the RNA pellet by adding 500 µl of 80% ethanol.
Vortex the sample and then centrifuge at 7,500 x g for 5 minutes at 4°C.
3- Remove the supernatant and briefly dry the RNA pellet for 5-10 minutes by airdrying. Do not dry the RNA pellet by centrifugation under vacuum (speed-vac). Do
not let the RNA pellet dry completely, as this will decrease its solubility and might
degrade it. Add an appropriate volume of DEPC treated water (10-30 µl according
to the size of the pellet).
4- Determine RNA concentration of an aliquot diluted in water by measuring the A 260.
5- Verify the integrity of the extracted RNAs by agarose gel electrophoresis.
6. RT-PCR protocol:
cDNA synthesis using an Amersham Biosciences kit:
1- Place 1.5 µg total RNA in a microcentrifuge tube and add RNAse-free water, if
necessary, to bring the RNA to a total volume of 4 µl.
2- Denature the RNA by heating RNA solution at 65°C for 10 minutes, then chill on ice.
3- Gently pipette the Bulk first-strand cDNA reaction mix to obtain a uniform
suspension. Then add a mixture containing 2.5 µl of the Bulk first-strand cDNA
reaction mix to the RNA, 0.5 µl DTT solution (200mM) and 0.5 µl pd(N)6 random
hexamers (0.2 µg/µl).
4- Incubate at 37°C for 1 hour.
PCR reaction:
1- The RT reaction is diluted 1 to 5. Place 2 µl of the diluted cDNA in a
microcentrifuge tube and add a mix containing:
o 5 µl 10X PCR Buffer (20mM Tris-HCl pH 8.4, 500 mM KCl )
o 1 µl Magnesium Chloride 50 mM
o 0.5 µl dNTP mix 10mM
o 0.5 µl Primer mix (20 µM each)
o 0.25 µl Taq DNA polymerase (5U/µl)
o 40.75 µl autoclaved distilled water
2- Cap tubes and centrifuge briefly to mix and collect the contents at the bottom
3- Incubate tubes in a thermal cycler at 94°C for 3 minutes to completely denature the
template
4- Perform 28 cycles of PCR amplification as follows:
o Denature 94°C for 30 sec
o Anneal 64.2°C for 30 sec
o Extend 72°C for 30 sec
5- Incubate for an additional 2 minutes at 72°C and maintain the reaction at 15°C.
6- Analyse the amplification products by 2% agarose gel electrophoresis and visualize
by ethidium bromide staining. Use 1 Kb+ molecular weight standard. Load with
xylene cyanol only, as bromophenol blue might interfere with the visualization of the
truncated amplicon. The same primers amplify both splicing isoforms.
REFERENCES
Ward, A.J., and Cooper, T. A. (2010). The pathobiology of splicing. J. Pathol. 220, 152163.
López-Bigas, N., Audit, B., Ouzounis, C., Parra, G., and Guigo, R. (2005) Are splicing
mutations the most frequent cause of hereditary disease? FEBS Lett. 579, 1900-1903.
Cáceres, J.F., Stamm, S., Helfman, D.M., and Krainer, A.R.(1994). Regulation of
alternative splicing in vivo by overexpression of antagonistic splicing factors. Science. 265,
1706–1709
Graham, F.L., and van der Eb, A.J. (1973). A new technique for the assay of infectivity of
human adenovirus 5 DNA. Virology. 52, 456
Wong, T.K., and Neumann, E. (1982). Electric field mediated gene transfer. Biochem.
Biophys. Res. Commun. 107, 584-587
Potter, H. (1988). Electroporation in biology: Methods, applications and instrumentation.
Anal. Biochem. 174, 361-373
Chu, G., Hayakawa, H., and Berg, P. (1987). Electroporation for the efficient transfection
of mammalian cells with DNA. Nucleic Acid Res. 15, 1311-1326
De Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I.,
Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., and Lévy, N.(2003). Lamin a
truncation in Hutchinson-Gilford progeria. Science. 300, 2055
Eriksson, M., Brown, W.T., Gordon, L.B, Glynn, M.W., Singer, J., Scott, L., Erdos, M.R.,
Robbins, C.M., Moses, T.Y., Berglund, P., Dutra, A., Pak, E., Durkin, S., Csoka, A.B.,
Boehnke, M., Glover, T.W., and Collins, F.S. Recurrent de novo point mutations in lamin A
cause Hutchinson-Gilford progeria syndrome. (2003). Nature. 423, 293-298