Download DNA Structure Review Questions Name: 1. Know the following 3

DNA Structure Review Questions
1. Know the following 3 scientists and their importance to DNA:
. Griffith
. Avery
. Hershey & Chase
2. What is the genetic code?
3. Why does DNA need to duplicate itself?
4. What are the 3 parts of a nucleotide?
5. What are the 4 nitrogenous bases in DNA?
6. What is the shape of a piece of DNA?
7. What is the difference between purines and pyrimidines?
8. What are the base pairs in DNA?
9. What did Rosalind Franklin do for the studies of DNA?
10. What did Watson & Crick build?
11. What hold two base pairs together in a strand of DNA?
12. What does helicase do?
13. What enzyme is used.to make daughter strands of DNA during replication?
14. Explain the 4 differences between DNA & RNA
15. Why do we need RNA?
16. What is the difference between tRNA and mRNA?
Name:
17. Where are proteins made in a cell?
18. What is protein synthesis?
19. What are the 4 steps in protein synthesis?
20. What is transcription? What is made during this process?
21. What enzyme is needed to make a complementary strand ofmRNA during transcription?
22. What are the base pairs in RNA?
23. What is translation? Where does translation occur?
24. What is a codon? Where is the codon located?
25. What types of bonds hold amino acids together?
26. What is a long chain of amino acids called?
27. What is an anticodon? Where is this located?
28. What are the start and stop codons? How do they work?
29. Know how to do the following:
. Make a copy of DNA (Daughter Strand)
. Make a copy ofmRNA
. Identify codons in a strand of mRNA . Write the anticodon for each codon
. Use a chart to identify an amino acid in a chain
DNASTRAND (on a separate piece of paper)
GTACGCTTCTCGCGCACTTCCGATAATCACT
30. Make a daughter strand of DNA using the strand given above.
31. Make a strand of mRNA using the strand of DNA given at the top of the page. (Hint: you must make
the entire strand!)
32. Look at your strand of mRNA. Write out the codons that will form amino acids.
(Hint: A certain codon should be the first one listed & a comma should be between each codon.)
33. Write the anticodon for each codon listed in question 32.
34. Using the genetic code, list the amino acids in the chain. (Place a comma between each amino acid)