Download Supplementary Data 1 (doc 909K)

Subjects and tissue specimens
Subjects were recruited from patients undergoing surgery as part of their routine
care at The University of Virginia Hospital with Institutional Review Board approval
(Protocol #10092). Samples of carcinoma or benign squamous mucosa (BSM) were
obtained from surgical resection specimens after clinical examination and sampling, and
comprised tissue that would otherwise be discarded. Samples were obtained from the
specimens within one hour of resection. The clinical histopathology slides and reports
were examined by a Board-certified pathologist (C.A.M.) to confirm the diagnosis of
SCC. Smoking history was confirmed by subject questionnaires or review of clinical
charts. The demographic characteristics of the cohort are shown in Table 1, with
individual demographic detail available in supplemental material.
Demographic data for cohort:
Site of primary Number
Age at diagnosis
Gender Histologic grade
tumor
of cases
(range, mean, median) (M:F)
(percent of grade
1, 2, 3 & 4)
Esophagus
3
60-71, 64, 61
3:0
0, 0, 100, 0
Head/neck
29
40-83, 62, 63
24:5
17, 10, 38, 34
Lung/bronchi
46
50-81, 64, 64
36:10
0, 13, 63, 24
RNA, DNA. protein isolation
All tissue samples were embedded in Optimal Cutting Technique (OCT)
compound (Sakura Finetek) and were subjected to cryostat sectioning. The subsequent
histologic sections were analyzed for areas corresponding to greater than or equal to 70%
tumor cellularity in the case of SCC samples. These regions were excised from the frozen
tissue block by sharp dissection. Samples of benign squamous mucosa (BSM) were
similarly dissected to ensure a similar percentage of non-neoplastic squamous epithelial
cells for comparison. RNA was isolated using Trizol (Invitrogen) extraction, according to
the manufacturer’s instructions. RNA integrity was analyzed by microcapillary
electrophoresis (Bioanalyzer, Agilent), and samples that did not show distinct 28 and 18
S rRNA peaks were rejected. DNA was isolated from paired microdissected areas using
standard proteinase K digestion followed by organic extraction and alcohol precipitation.
For protein isolation, tissue samples were similarly macrodissected from frozen tissue
blocks. Frozen tissues were crushed to a fine powder in a mortar and pestle cooled with
liquid nitrogen, then lysed in a Dounce homogenizer in RIPA buffer (20 mM Tris pH 7.5,
150 mM NaCl, 1% Nonidet P-40, 0.5% Sodium Deoxycholate, 1 mM EDTA, 0.1%
SDS). After centrifugation (12,000 x g), the supernatant was used as total protein extract.
Microarray genomic profiling
DNA samples were made into labeled probes and hybridized to Human Mapping
100K GeneChips (Affymetrix) using protocols, supplies and equipment supplied or
specified by the manufacturer. SNP array analysis was also performed on 9 normal
samples and included in the analysis cohort were 41 normal samples previously analyzed
by Affymetrix, available on their website. The per-allele signal intensities and genotypes
for each locus examined by the SNP array were generated using the Affymetrix power
tools suite. All samples were processed together starting from raw .CEL data. To process
signal intensity measures into copy number estimates for the SCC tumor cohort the
following analyses were conducted: 1) the “alleleA” and “alleleB” signal measures were
summed for each loci in each sample and across the normal reference pool, 2) the average
summed value for each locus in the reference pool was calculated, 3) for each sample the
summed intensity was divided by the average in the normal reference pool, then
multiplied by 2.
The following key assumptions were used to regularize these values: 1) copy
number is a discrete variable (units of genetic material are discrete) 2) few copy number
changes are expected per chromosome. The algorithm used is termed weak continuity
with structural constraints in the literature (7). As employed a single tunable parameter
adjusts how many copy number events are detected across a chromosome from a given
sample.
Microarray gene expression profiling
RNA samples were made into labeled probes and hybridized to U133A 2.0
GeneChips (Affymetrix) using protocols, supplies and equipment supplied or specified
by the manufacturer. Expression values, standard errors, and present (P) – marginal (M) –
absent (A) calls for each probe-set were generated from the raw data (.cel files) utilizing a
PM/MM model for gene expression (dChip, www.dchip.org).
Utilizing the P, M, and A calls, genes that did not exhibit at least 75% P or M
calls in at least one of the groups of the categorical variable being examined were
screened out. Following this, the Kruskal-Wallis non-parametric one-way analysis of
variance was used to assess statistical significance. The resulting nominal p-values were
corrected for multiple testing using a false discovery rate (FDR) approach (FDR<0.05).
To obtain a ranking of genes most up and down regulated between tumor and
normal samples an algorithm (5, 6) was used based on equally weighted contributions
from the difference of the mean hybridization intensities, the quotient of the mean
hybridization intensities, and the result of an unpaired Student’s t test between expression
levels in tumor and normal tissues. The final ranking reflects the sum of ranks of the
individual metrics.
Quantitative transcript RT-PCR
RNA samples were DNAse treated. Superscriptase II was used for first strand
synthesis. Quantitative real time PCR analysis was performed using an iCycler iQ system
(BioRad), measuring Syber Green DNA binding. Gene specific primers for EcoP were
Forward: 5’-GAGGAGCCAGCCTTCAAT-3’ and Reverse: 5’AAAGCCATTGCCATGGAATTC-3’. Internal control of B2M gene specific primers
were Forward: 5’-TGTGCTCGCGCTACTCTCTC-3’ and Reverse: 5’TCTCTGCTGGATGACGTGAG-3’. Expression of these genes was calculated as the log
of the ratio of ECOP to B2M.
Quantitative genomic PCR
Quantitative real-time PCR was used to validate the copy number values
constructed from the SNP array data. DNA extracted from SCC tumors and BSM tissue
samples were used in these experiments. Primers for the EGFR, ECOP and control locus
(CL) were EGFR-F: 5’-AAAAGGCAGTGGCTGAATTG-3’, EGFR-R: 5’AGGCGGTGGTTACGAGTATG-3’, ECOP-F: 5’AAGACAGACATGTAGACCAATGGA-3’, ECOP-R: 5’GCTGAGAGATGGAAGCAACC, CL-F: 5’-TCCATCCTTTATGTTTGGGTTC, CL-R:
5’GGGACACGTGTAACAAAATCAG. The control region was selected by examining
the SNP array data for a copy number call of 2 across all samples. All reactions were
conducted on an iCycler iQ system (BioRad), measuring Syber Green DNA binding.
Melting curve analyses were performed ensure single PCR products in each reaction. All
samples were run in triplicate. A standard curve from a dilution series of a control DNA
sample was used to calculate exact copies for each locus. Normalized copy numbers for
the loci being examined from our qPCR data were calculated as twice the ratio of copies
of EGFR or ECOP loci to the copies of control locus.
Anti-ECOP antibody production and immunoblot procedures
A peptide corresponding to the last thirteen amino acids of the ECOP protein
(TPPPPYEQVVKAK) was synthesized, coupled to KLH, and used as an immunogen in
rabbit. Pre and post immunization sera were collected. The serum from the immunized
animal was affinity purified against the same peptide used as the immunogen. Lysates
from an SCC cell line (SCC-9) were resolved on 12.5% polyacrylamide-SDS gels and
transferred to PVDF membranes. The membranes were subsequently immunoblotted with
pre/post immunization sera and affinity purified antibody. Affinity purified antiserum
recognizes ECOP in SCC-9, a squamous cell carcinoma derived cell line, as two protein
species of 21.2 and 19.7 kD (supplemental data). The proteins recognized by this
antiserum are specifically reduced by siRNA oligonucleotides directed against the ECOP
transcript, but not by scrambled oligonucleotide controls.
Cell lines and siRNA knockdown
SCC-9 and HeLa cell lines were grown in DMEM/F12 supplemented with 10%
fetal bovine serum. Two siRNAs were designed targeting ECOP mRNA; the first in the
coding sequence 5’-GGACUCUAUCCAACCUAUU-3’, and the second in the 3’-UTR
5’- GACAGGAGAAGUACUGACU-3’. The annealed double stranded siRNAs for the
aforementioned sequences along with a control siRNA were acquired from Ambion. The
siRNAs were introduced into cells using Lipofectamine 2000 (Invitrogen) according the
manufactures protocols. Cells were plated in 96 well dishes at a density of 5,000 cells per
well. 24 hours after plating, siRNA was introduced and following 48 hour from this point
viability was measured using Cell Titer Blue (Promega) assay according to the
manufacture’s protocols. Each experiment was conducted in a technical replicate of 3 and
averaged over 3 independent experiments.