Download Sickle Cell Handout

GENE EXPRESSION: PROTEIN SYNTHESIS
BACKGROUND INFORMATION
You have learned how a DNA molecule is able to act as a template for its own replication, and in so doing, you
have discovered how genetic information maintains the continuity of a species from one generation to the next.
You also know that genetic information is used to build and maintain the physical appearance (phenotype) of
the individual organisms. How is the information stored in DNA used by each organism that possesses it? How
do your cells use the information stored in the sequence of nucleotides in your DNA to build and maintain the
physical being that is you?
In this activity you will develop your own explanation of the relationship between a person’s genetic instructions
(genotype) and the physical result of those instructions (phenotype) by tracing the series of events that leads to
gene expression. The gene you will study is the gene for sickle cell disease, a potentially fatal condition. As
you and your partner work through this activity, you will create a poster that illustrates the molecular basis of
sickle cell disease.
PROCESS & PROCEDURE
Part A: Looking at Sickle Cell Disease
1. Begin your study of the molecular basis of sickle cell disease by reading the following information about
this inherited disorder and about the associated gene.
Hemoglobin and Red Blood Cell Abnormalities in Sickle Cell Disease
Each year about 1 in 625 African-American children in the United States is born with sickle cell disease.
This disease is caused by an abnormality in hemoglobin, the protein in red blood cells that carries oxygen to
the cells of the body. When the oxygen supply in the blood is low (ex: strenuous exercise or high altitude),
these abnormal hemoglobin molecules clump together instead of remaining separate as normal hemoglobin
molecules do. The figure below shows this difference between the behavior of sickle cell hemoglobin and
normal hemoglobin.
The clumping of the hemoglobin molecules at low oxygen levels causes the shape of red blood cells in
a person with sickle cell disease to become long and rigid like a sickle instead of remaining round and flexible.
(see figure below). (REMEMBER: hemoglobin is the protein inside the cell!)
Sickled red
Blood Cells
Normal Red
Blood Cells
This change in cell shape causes a variety of problems in the body (medical implications). For example, as
cells become sickled, they tend to block small blood vessels, causing pain and damage to the areas that are
not receiving an adequate blood supply (see below). The long-term effect of repeated blockages may
permanently damage a person's internal organs, including the heart, lungs, kidneys, brain, and liver. For some
people the damage is so severe that they die in childhood. With good medical care, however, many people
with sickle cell disease can live reasonable normal lives.
Sickle-shaped Red Blood
Cells in Blood Vessels
Normal shaped Red Blood
Cells in Blood Vessels
People who have sickle cell disease have two abnormal genes on chromosome #11 for the beta hemoglobin
chain, one inherited from each parent.
Inside the environment of the red blood cell, a molecule of normal hemoglobin consists of four protein chains
folded into a globular shape (2 alpha & 2 beta chains = quaternary structure!). The molecule remains folded in
this manner due to attractive forces that occur between amino acids in different parts of the protein chains that
make up the molecule.
The change in the amino acid sequence that occurs is a result of the single nucleotide mutation in the
hemoglobin gene. This mutation has no effect on the overall shape of the protein molecule when oxygen levels
are normal, so sickle cell hemoglobin behaves just like normal hemoglobin under these conditions. However,
when oxygen levels are low, the amino acid change alters the attractive forces inside the molecule, causing the
molecules of sickle cell hemoglobin to assume a different shape from those of normal hemoglobin. As the
figure below shows, it is this change in molecular shape under low oxygen levels- a change in shape that
results from only one change in the amino acid sequence- that causes sickle hemoglobin to form the rigid rods
characteristic of the condition.
The difference in behavior of sickle cell
hemoglobin is related to a shape change that
occurs at low oxygen levels. This shape change
results from the substitution of the amino acid
valine for a glutamic acid.
a. SHAPE: Molecules of normal hemoglobin will
not associate with each other under low oxygen
conditions because glutamic acid is polar,
whereas the grooves that form on adjacent
hemoglobin beta chains are nonpolar. This
groove always forms on the beta chain under low
oxygen conditions. Molecules of sickle
hemoglobin, however, will associate with each
other because valine is nonpolar. The nonpolar
amino acid is attracted to the nonpolar groove.
b. BEHAVIOR: Molecules of normal hemoglobin
remain in solution, even under conditions of low
oxygen. In contrast, molecules of sickle
hemoglobin associate together to form rigid
polymers under conditions of low oxygen.
Sometimes, the rods of hemoglobin can cause
the RBC to burst, resulting in anemia.
Part A- Background Questions: Be sure you have read the information! Do not just skim to find the
answers! Answer these on your own paper.
1) What is a gene? (use your own knowledge or use your textbook)
2) Explain the relationship between hemoglobin and a red blood cell (RBC).
3) What is the function of hemoglobin?
4) What medical problems do people with sickle cell have?
5) Why does is matter that glutamic acid is polar and valine is nonpolar? In other words, how does this change
from polar glutamic acid to nonpolar valine lead to the RBC being “sickled” in shape?
6) Is this hemoglobin protein in high or low oxygen conditions? How can you tell?
Poster Time! BE SURE TO READ EVERYTHING!!!
Copy the poster template provided underneath your answers from above. In this part of the assignment you will
create a poster that will illustrate the molecular basis of sickle cell disease. The top half of the poster is for
Normal Hemoglobin and the bottom is for Sickle Hemoglobin. As you read through the directions for Part
B and C, keep in mind that the information you fill in for sections 2-4 will be DNA/RNA nucleotides or amino
acids.
1. Genetic Instructions Inherited (provided for you)
2. DNA Sequence
3. mRNA sequence
4. polypeptide (protein) sequence
1
2
Genetic
DNA seq.
instructions
inherited
3
mRNA
seq
4
protein
(amino acid)
sequence
5
Hb shape
(1 hemoglobin
protein)
6
7
8
Hb
RBC shape @
medical
implications
behavior
low oxygen levels
(RBC: Red Blood Cell)
normal;
normal
(1 from each
parent)
mutation;
mutation
(1 from each
parent)
Part B: Looking at the Structure of the Gene Involved in Sickle Cell Disease
1. To understand in more detail how the information present in the hemoglobin gene is related to sickle
cell disease, refer to the DNA sequences below. These sequences are from the same section of the
two different sets of instructions of the beta hemoglobin gene (normal vs. sickled). This is only a portion
of the entire sequence DNA sequence coding for the protein. Copy them onto your poster in Column 2.
DNA Sequences for Hemoglobin Instructions
Normal Allele:
AGGTCTCCTCTAATGGGTCTCCTTAGGTCTCCT
Sickle Cell Allele:
AGGTCTCCTCTAATGGGTCACCTTAGGTCTCCT
2. Compare the 2 nucleotide sequences.
a. Draw an arrow or a circle on your poster to indicate the nucleotides in the sickle cell sequence
that differ from those in the normal sequence.
b. Can you name the specific type of mutation this is?
Part C: Looking at the Expression of the Gene Involved in Sickle Cell Disease
1. To understand how the difference in sequence between the normal and sickle cell instructions for the
hemoglobin gene results in the symptoms associated with the disease, determine the messenger RNA
(mRNA) sequences that corresponds to the DNA sequences that you examined in Part B. One member
of the group should determine the mRNA sequence that results from the DNA sequence that
represents the allele for Normal Hemoglobin. The other group member should transcribe the mRNA
from the DNA sequence that represents the allele for Sickle Cell hemoglobin. Write both mRNA
sequences in column 3 of your poster.
2. Compare the mRNA that results from the transcription of the normal allele of the hemoglobin gene to
the mRNA that results from the transcription of the sickle cell allele. Use an arrow or a circle to indicate
on your poster the nucleotides in the sickle cell mRNA that differ from those in the normal sequence.
3. Use the genetic code table in your textbook (pg. 303) to determine the amino acid sequence that would
result from the translation of both mRNA molecules. Write this sequence in section 4 of your poster.
4. Compare the amino acid sequence that results from transcription and translation of the normal allele for
the hemoglobin gene with the amino acid sequence that results from transcription and translation of the
sickle cell allele. Use an arrow or a circle to indicate on your poster the amino acids in the sickle cell
protein sequence that differ from those in the normal sequence.
The information for Sections 5-8 will be in picture form, which should be accompanied by labels. There are
four sets of pictures in the reading. Use these pictures and draw them in the appropriate place on your poster.
5. Shape of the hemoglobin molecule (Be careful! Hemoglobin is different than a red blood cell.)
6. Behavior of the hemoglobin molecule
7.
Shape of the red blood cell under low oxygen conditions
8.
Medical implications
Analysis
Fill-in the following paragraph which explains sickle cell disease. The paragraph starts with the genotype for
sickle cell, then moves through the phenotype, & ends with the medical manifestation of the genotype.
The 2nd column lists and compares the DNA sequence between a person with sickle cell disease and a person without
sickle cell disease. After examining the two sequences, it is apparent that a _____1______ mutation has occurred. The 3rd
column identifies the mRNA strand that formed in ________2_________ (the first step of protein synthesis) as a result of
the DNA code. ___3________ molecules brought amino acids to the mRNA strand located on the ______4________ to
form the _______5___________ protein. This protein is different between an individual with sickle cell and a person
without sickle cell in that the amino acid _______6__________ was replaced with _____7________. This difference led to
a difference in ____8________ for the hemoglobin molecule once it went to the ER and was folded into its proper
configuration. The mutated protein has valine on its beta chain, which has a ______9________ R-group. This R-group is
attracted to the nonpolar groove that forms on the ____10______ chain under ___11_______ oxygen conditions. As a
result, the defective proteins clump together forming rods. These rods causes the red blood cell to _______12_________.
The medical implications of this is that a person will experience symptoms such as ____________13_________________
________________________________________________________________________________________________.