Download 1 - TJ-Thomas

REGULAR BIOLOGY 2 FINAL REVIEW
1. Who is considered the father of genetics?
2. What are Mendel’s 2 laws of inheritance?
3. How do Mendel’s 2 laws of inheritance relate to the meiosis?
4. What were Mendel’s experiments?
5. What are the names that Mendel gave to each of his generations?
6. How did Mendel explain his results?
7. What is the difference between a heterozygote and a homozygote?
8. What is a Punnett square?
9. Know how to use a Punnett square.
10. What is the difference between dominant and recessive as it applies to alleles?
11. All the possible alleles that an individual has are referred to as what?
12. What is the physical appearance of an organism called
13. Be able to use a pedigree to show inheritance patterns.
14. What is a pedigree?
15. Know what the different symbols are that are associated with a pedigree.
16. Understand simple recessive heredity.
17. Understand simple dominant heredity?
18. Know examples of both simple dominant and recessive heredity?
19. What are the different types of complex patterns of heredity?
20. What are some environmental factors that influence heredity?
21. What are some examples of traits that are influenced by environmental heredity?
22. What are human examples of complex patterns of heredity?
23. Who discovered the structure of DNA?
24. What did they receive for this discovery?
25. What is the double helix of DNA composed of?
26. What is the one difference between nucleotides?
27. What are the 4 bases found in DNA and their abbreviations?
28. What DNA bases pair together?
29. What is the importance of the nucleotide sequence?
30. What is replication?
31. How does replication work?
32.
Give the complementary base for the following DNA sequence:
AATGCCGATCGATGCATTCGA
33. 33. What are the differences between DNA and RNA?
34. 34. What are the 4 bases found in RNA and their abbreviations?
35. 35. Describe how RNA is made?
36. What is RNA?
37. What does RNA stand for?
38. Describe the structure of RNA?
39. What are the differences between RNA and DNA?
40. What RNA bases pair together?
41. What are the 2 different types of RNA?
42. What are the 2 stages to gene expression?
43. What is transcription?
44. Be able to describe the process of transcription?
45. What role does RNA polymerase play in transcription?
46. Be able to read and make use of the genetic code.
47. What is translation?
48. All the possible alleles that an individual has are referred to as what?
49. What is the physical appearance of an organism called?
50. Be able to use a pedigree to show inheritance patterns.
51. What is a pedigree?
52. Know what the different symbols are that are associated with a pedigree.
53. Understand simple recessive heredity.
54. Understand simple dominant heredity?
55. Know examples of both simple dominant and recessive heredity?
56. What are the different types of complex patterns of heredity?
57. What are some environmental factors that influence heredity?
58. What are some examples of traits that are influenced by environmental heredity?
59. What are human examples of complex patterns of heredity?
60. What was Darwin’s belief regarding the nature of the world before his voyage?
61. What was Darwin’s belief regarding the nature of the world after his voyage?
62. What was the name of the ship that took Darwin on his voyage and where did he go?
63. How did Darwin’s finches allow Darwin to come up with his theory of evolution?
64. What is the mechanism behind Darwin’s theory of evolution?
65. Explain the 2 major ideas Darwin put forth in The Origin of Species.
66.
Explain why transitional species, such as the ancestors of modern whales, are crucial
evidence for evolution.
67. What is the driving force, or causes, of evolution?
68. Give one example of evidence that supports natural selection.
69. What is the classification system that scientists use to classify living organisms?
70. Why do scientists use scientific names instead of common names?
71. What are the six kingdoms?
72. What are the 8 levels of classification for living organisms?
73. Which of the 8 levels is most specific and least specific?
74. What is a scientific name?
75. How do you write a scientific name?
76. What is the name of the system in which we use to name organisms?
77. Who developed the system for naming organisms?
78. What is a species?
79. Describe each of the six kingdoms and what organisms are found in each?
80. What are the characteristics of life?
81. What are the levels of organization within an ecosystem in order?
82. Describe each level of organization within an ecosystem.
83.
Be able to give an example of an organism in each of the levels of organization in an
ecosystem.
84.
What is the key theme in ecology?
85.
What are the different factors that interact in an ecosystem?
86.
What type of interactions occur in an ecosystem?
87.
Explain the predator/prey interaction.
88.
What is the ultimate source of energy that enters an ecosystem?
89.
At what level does this energy enter an ecosystem?
90.
What organisms are located in this energy level?
91.
What is an autotroph?
92.
What is a heterotroph?
93.
What is productivity?
94.
How is productivity measured in an ecosystem?
95.
What are the different categories of consumers?
96.
What are trophic levels?
97.
What organisms are in the 1st trophic level?
98.
What do trophic levels show?
99.
What is the difference between a food chain and a food web?
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
What do food chains show?
What do food webs show?
In a food web or food chain, what doe the direction of the arrows show?
Is all of the energy transferred from one trophic level to another trophic level? Why or why
not?
Be able to explain the water cycle.
Be able to explain the carbon cycle.
Be able to explain the nitrogen cycle.
What is photosynthesis?
What organisms perform photosynthesis?
What is the equation for photosynthesis?
Know the visible spectrum.
Understand the properties of light.
What are the 2 pigments within plants associated with photosynthesis and what colors of light
do they absorb?
Know each step to photosynthesis, what is being produced and where the products are going?
What is the function of ATP and NADPH as it relates to photosynthesis?
What is cellular respiration?
What organisms perform cellular respiration?
What allows an organic molecule to posses energy?
Where is the energy stored in an organic molecule?
What is the chemical equation for cellular respiration?
Know each step of cellular respiration.
Be able to account for each molecule of ATP produced during cellular respiration.
What role does NADH play in cellular respiration?
What role does FADH2 play in cellular respiration?
How many ATP are produced for each NADH molecule?
How many ATP are produced for each FADH2 molecule?
Review and study your previous tests.