Efficient expression of ribozyme and reduction of stromelysin mRNA
... 1995) (Okada et al., 1992). Thus targeted inhibition of one or more of these proteolytic activities may be a valid therapeutic approach for arthritis. Ribozymes are RNA-based enzymes that have the ability to cleave RNA molecules in a sequence-specific manner. Sequence specificity comes from the base ...
... 1995) (Okada et al., 1992). Thus targeted inhibition of one or more of these proteolytic activities may be a valid therapeutic approach for arthritis. Ribozymes are RNA-based enzymes that have the ability to cleave RNA molecules in a sequence-specific manner. Sequence specificity comes from the base ...
EIN4 and ERS2 Are Members of the Putative Ethylene Receptor
... is performed by a phosphorylation cascade that might modulate the activity of transcription factors regulating gene expression. The ethylene signal appears to be perceived by a family of ethylene receptors. Three members of the putative ethylene receptor gene family, ETR1, ERS (for ETHYLENE RESPONSE ...
... is performed by a phosphorylation cascade that might modulate the activity of transcription factors regulating gene expression. The ethylene signal appears to be perceived by a family of ethylene receptors. Three members of the putative ethylene receptor gene family, ETR1, ERS (for ETHYLENE RESPONSE ...
A bi-functional siRNA construct induces RNA
... In contrast, crook siRNA quantification is both direct and represents a constant for different siRNAs since detection is reliant upon the DNA component of the crook siRNA construct (Figure 1). The siRNA component of crook siRNA can be varied according to the chosen gene target. Moreover our non-radi ...
... In contrast, crook siRNA quantification is both direct and represents a constant for different siRNAs since detection is reliant upon the DNA component of the crook siRNA construct (Figure 1). The siRNA component of crook siRNA can be varied according to the chosen gene target. Moreover our non-radi ...
U2Word
... c. Tetranucleotides--> alternating peptide of 4 AAs (sometimes gave only di- and tripeptides. These contained one of the 3 stop codons.) Examples: UCUGUCUGUCUGUCUGUCUGUCUG --> ser-val-cys-leuGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAA --> val - ser - lys - stop; or stop; or lys - stop; or ser - lys - s ...
... c. Tetranucleotides--> alternating peptide of 4 AAs (sometimes gave only di- and tripeptides. These contained one of the 3 stop codons.) Examples: UCUGUCUGUCUGUCUGUCUGUCUG --> ser-val-cys-leuGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAAGUAA --> val - ser - lys - stop; or stop; or lys - stop; or ser - lys - s ...
Use of Gene Replacement Transformation to Elucidate
... 1A), which contains the disrupted qa-x gene, was constructed by cleaving at a unique Hind111 site inthe qa-x coding region and filling in the staggered ends using the Klenow fragment. This creates a unique NheI site withinthe qa-x coding region. The plasmid pAqa-IS wasconstructed in the following ma ...
... 1A), which contains the disrupted qa-x gene, was constructed by cleaving at a unique Hind111 site inthe qa-x coding region and filling in the staggered ends using the Klenow fragment. This creates a unique NheI site withinthe qa-x coding region. The plasmid pAqa-IS wasconstructed in the following ma ...
v7a29-zhu pgmkr - Molecular Vision
... highly similar and contain the conserved flavin and pterin binding domains. The C-termini of the proteins are highly variable between all identified cry genes [1-3,9]. xcrys are expressed in photoreceptor cells: The 3' UTR regions of the xcry cDNA clones, which contain unique sequence in each of the ...
... highly similar and contain the conserved flavin and pterin binding domains. The C-termini of the proteins are highly variable between all identified cry genes [1-3,9]. xcrys are expressed in photoreceptor cells: The 3' UTR regions of the xcry cDNA clones, which contain unique sequence in each of the ...
Inquiry into Life Twelfth Edition
... Secondary Structure Shifts • Small RNAs with proteins can affect mRNA 2° structure to control translation initiation • Riboswitches can be used to control translation initiation via mRNA 2° structure – 5’-untranslated region of E. coli thiM mRNA contain a riboswitch – This includes an aptamer that b ...
... Secondary Structure Shifts • Small RNAs with proteins can affect mRNA 2° structure to control translation initiation • Riboswitches can be used to control translation initiation via mRNA 2° structure – 5’-untranslated region of E. coli thiM mRNA contain a riboswitch – This includes an aptamer that b ...
Comparison of Statistical Models for Affymetrix GeneChip
... this does not necessarily mean that the mismatch probes are a good idea - but if they are present we should use them we have demonstrated this using both analytic considerations and experimental data a carefully designed experiment can be used to address many issues Many more genes may be expressed ...
... this does not necessarily mean that the mismatch probes are a good idea - but if they are present we should use them we have demonstrated this using both analytic considerations and experimental data a carefully designed experiment can be used to address many issues Many more genes may be expressed ...
A Major Species of Mouse μ-opioid Receptor mRNA and Its
... anchored primer AP (5⬘-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3⬘, included in the kit), which initiates the cDNA synthesis at the poly (A) region of mRNA. A negative control (without reverse transcriptase enzyme) was included to rule out the possible product from genomic DNA. The first round of 3⬘ RA ...
... anchored primer AP (5⬘-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3⬘, included in the kit), which initiates the cDNA synthesis at the poly (A) region of mRNA. A negative control (without reverse transcriptase enzyme) was included to rule out the possible product from genomic DNA. The first round of 3⬘ RA ...
Using the Hepatitis C Virus RNA-Dependent RNA Polymerase as a
... 5. Catalytic Mechanism and Polymerase Reaction Steps All known polymerases synthesize nucleic acid in the 51 to 31 direction [9]. Thus, replication in positive-stranded RNA viruses occurs via a negative-stranded intermediate. The polymerase reaction has three stages: initiation, elongation and termi ...
... 5. Catalytic Mechanism and Polymerase Reaction Steps All known polymerases synthesize nucleic acid in the 51 to 31 direction [9]. Thus, replication in positive-stranded RNA viruses occurs via a negative-stranded intermediate. The polymerase reaction has three stages: initiation, elongation and termi ...
Whole-transcriptome RNAseq analysis from minute amount of total
... increased the transcript coverage, which has in turn enhanced our ability to detect novel rare transcripts, novel alternative splice isoforms and direct measurement of transcript abundance (3). These technologies are greatly accelerating our understanding of the complexity of gene expression, regula ...
... increased the transcript coverage, which has in turn enhanced our ability to detect novel rare transcripts, novel alternative splice isoforms and direct measurement of transcript abundance (3). These technologies are greatly accelerating our understanding of the complexity of gene expression, regula ...
Introduction to cDNA Microarray Technology complementary DNA
... • Glass slides or similar supports containing cDNA sequences that serve as probes for measuring mRNA levels in target samples ...
... • Glass slides or similar supports containing cDNA sequences that serve as probes for measuring mRNA levels in target samples ...
PowerPoint
... sequences that serve as probes for measuring mRNA levels in target samples • cDNAs are arrayed on each slide in a grid of spots. • Each spot contains thousands of copies of a sequence that matches a segment of a gene’s coding sequence. • A sequence and its complement are present in the same spot. ...
... sequences that serve as probes for measuring mRNA levels in target samples • cDNAs are arrayed on each slide in a grid of spots. • Each spot contains thousands of copies of a sequence that matches a segment of a gene’s coding sequence. • A sequence and its complement are present in the same spot. ...
Descriptions of translation related genes that
... Small cytosolic ribosomal protein, involved in translation initiation and metabolic processes Component of heteroheptameric complexes, involved in mRNA processing Ribonucleoprotein involved in regulating mRNA translation, transport, processing PUF protein family member, involved in DNA metabolism an ...
... Small cytosolic ribosomal protein, involved in translation initiation and metabolic processes Component of heteroheptameric complexes, involved in mRNA processing Ribonucleoprotein involved in regulating mRNA translation, transport, processing PUF protein family member, involved in DNA metabolism an ...
The Comparison of Transcriptomes Undergoing Waterlogging at the
... under waterlogging stress. It is interesting to note that 3.1% of differentially expressed transcripts encode products that are involved in pathways related to cell-wall loosening enzymes. An additional 6.7% of the differentially expressed transcripts were predicted to encode enzymes related to prot ...
... under waterlogging stress. It is interesting to note that 3.1% of differentially expressed transcripts encode products that are involved in pathways related to cell-wall loosening enzymes. An additional 6.7% of the differentially expressed transcripts were predicted to encode enzymes related to prot ...
Molecular Mechanisms of Developmental Review
... lin-14 mRNA, a region with seven copies of a short sequence that could base pair with the lin-4 RNAs (Wightman et al., 1991; Yeh, 1991). In addition, these 3⬘ sequences are sufficient to confer appropriate temporal regulation on the translation of a heterologous gene, implicating these sites as dire ...
... lin-14 mRNA, a region with seven copies of a short sequence that could base pair with the lin-4 RNAs (Wightman et al., 1991; Yeh, 1991). In addition, these 3⬘ sequences are sufficient to confer appropriate temporal regulation on the translation of a heterologous gene, implicating these sites as dire ...
PDF - Blood Journal
... nuclear factors, transcribed from what appear to be conventional promoters, and are spliced.7 Other lncRNAs, both polyadenylated and nonpolyadenylated, arise from enhancers.8 It is estimated that many thousands of lncRNAs are encoded in the human genome and are expressed in exquisitely tissue-specifi ...
... nuclear factors, transcribed from what appear to be conventional promoters, and are spliced.7 Other lncRNAs, both polyadenylated and nonpolyadenylated, arise from enhancers.8 It is estimated that many thousands of lncRNAs are encoded in the human genome and are expressed in exquisitely tissue-specifi ...
Histone genes of Volvox carteri: DNA sequence and organization of
... Received November 22, 1987; Revised and Accepted March 23, 1988 Accession nos:H3=X06963, H4=X06964 ...
... Received November 22, 1987; Revised and Accepted March 23, 1988 Accession nos:H3=X06963, H4=X06964 ...
RiboT
... RiboT is a fantastic molecule: a ribosome with tethered subunits, that is able to substain the expression of an entire genome! That’s incredible! So, what now? ...
... RiboT is a fantastic molecule: a ribosome with tethered subunits, that is able to substain the expression of an entire genome! That’s incredible! So, what now? ...
Maintenance of Membrane Integrity and Permeability Depends on a
... this study, we used ethanol sensitivity of the nematode Caenorhabditis elegans to identify genetic factors involved in membrane integrity. In C. elegans, acute exposure to a high concentration (7% v/v) of ethanol changes membrane permeability, as measured by propidium iodide staining, and causes par ...
... this study, we used ethanol sensitivity of the nematode Caenorhabditis elegans to identify genetic factors involved in membrane integrity. In C. elegans, acute exposure to a high concentration (7% v/v) of ethanol changes membrane permeability, as measured by propidium iodide staining, and causes par ...
The ECF sigma factors of Streptomyces coelicolor A3(2)
... vitro transcription from one of four promoters (dagAp2) of the agarase-encoding gene dagA (Buttner et al., 1988). The cloning of the gene encoding S. coelicolor E several years later using a reverse genetics approach revealed that it belonged, together with E. coli E, to a new subfamily of the 70 ...
... vitro transcription from one of four promoters (dagAp2) of the agarase-encoding gene dagA (Buttner et al., 1988). The cloning of the gene encoding S. coelicolor E several years later using a reverse genetics approach revealed that it belonged, together with E. coli E, to a new subfamily of the 70 ...
main
... separated light and shock) and with different levels of conditioned stimulus luminance. Temporally separated light and shock resulted in increased responsiveness that resembled altered behavior of planaria trained with simultaneous light and shock. Increased luminance also caused increased responsiv ...
... separated light and shock) and with different levels of conditioned stimulus luminance. Temporally separated light and shock resulted in increased responsiveness that resembled altered behavior of planaria trained with simultaneous light and shock. Increased luminance also caused increased responsiv ...
RNA Editing, ADAR1, and the Innate Immune Response
... ADAR1 was originally thought to be the enzyme responsible for GluR-B mRNA editing [41,42] and through this function significantly affect neurological functions [43–45]. However, this important editing was subsequently attributed to ADAR2 [24]. ADAR1 indeed participates in the editing of many other s ...
... ADAR1 was originally thought to be the enzyme responsible for GluR-B mRNA editing [41,42] and through this function significantly affect neurological functions [43–45]. However, this important editing was subsequently attributed to ADAR2 [24]. ADAR1 indeed participates in the editing of many other s ...
Mutational Analysis Defines the Roles of Conserved Amino Acid
... Figure 2. Comparison of the crystal structures of (A) M.TaqI and (B) ErmC0 . For clarity, only the common catalytic domains are shown. The protein backbone is shown in the “ribbons” representation. AdoMet is shown in pink. Target adenine is shown in cyan. A, The coordinates of M.TaqI and the target ...
... Figure 2. Comparison of the crystal structures of (A) M.TaqI and (B) ErmC0 . For clarity, only the common catalytic domains are shown. The protein backbone is shown in the “ribbons” representation. AdoMet is shown in pink. Target adenine is shown in cyan. A, The coordinates of M.TaqI and the target ...
RNA interference
RNA interference (RNAi) is a biological process in which RNA molecules inhibit gene expression, typically by causing the destruction of specific mRNA molecules. Historically, it was known by other names, including co-suppression, post-transcriptional gene silencing (PTGS), and quelling. Only after these apparently unrelated processes were fully understood did it become clear that they all described the RNAi phenomenon. Andrew Fire and Craig C. Mello shared the 2006 Nobel Prize in Physiology or Medicine for their work on RNA interference in the nematode worm Caenorhabditis elegans, which they published in 1998.Two types of small ribonucleic acid (RNA) molecules – microRNA (miRNA) and small interfering RNA (siRNA) – are central to RNA interference. RNAs are the direct products of genes, and these small RNAs can bind to other specific messenger RNA (mRNA) molecules and either increase or decrease their activity, for example by preventing an mRNA from producing a protein. RNA interference has an important role in defending cells against parasitic nucleotide sequences – viruses and transposons. It also influences development.The RNAi pathway is found in many eukaryotes, including animals, and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short double-stranded fragments of ~20 nucleotide siRNAs. Each siRNA is unwound into two single-stranded RNAs (ssRNAs), the passenger strand and the guide strand. The passenger strand is degraded and the guide strand is incorporated into the RNA-induced silencing complex (RISC). The most well-studied outcome is post-transcriptional gene silencing, which occurs when the guide strand pairs with a complementary sequence in a messenger RNA molecule and induces cleavage by Argonaute, the catalytic component of the RISC complex. In some organisms, this process spreads systemically, despite the initially limited molar concentrations of siRNA.RNAi is a valuable research tool, both in cell culture and in living organisms, because synthetic dsRNA introduced into cells can selectively and robustly induce suppression of specific genes of interest. RNAi may be used for large-scale screens that systematically shut down each gene in the cell, which can help to identify the components necessary for a particular cellular process or an event such as cell division. The pathway is also used as a practical tool in biotechnology, medicine and insecticides.